https://github.com/fenderglass/Ragout
Raw File
Tip revision: ef228bf2555646fee110ea533f0546d104fbf9fe authored by Mikhail Kolmogorov on 17 March 2020, 00:49:47 UTC
newick parser fix
Tip revision: ef228bf
mg1655_contigs.fasta
>seq1
AGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCGTGCA
TCCGCACCATATTCAGCAAAATTAACGCCGTCAAAATCCAGAACAGAACGCTTTTCCACG
AAGACGTGATAAAGTAAAGAATATCAATGGATAACGAGACACGAATGCCGCCCGGTAAGT
CATGGACGTAACTGACATACTGGAACAGATTATCTTCGCTCTGGTTGATGATAATGTCGC
GCCCCGAATCGGTATCGGTTAGCGTGACATTGAGAAAACGCCAGAGGAGAGGGCGGTCAT
GAGTATAAAAGATATTCCGCAGATTGTTTTTGTTAATATCCAGCAGCACAATCCCTTTTA
GCTGCCCTGCGACATATACCGGCGTCAGCAAACTCATCACGTTCTGTTTAGTACGCTGAT
CCTGGTAAATGCTCGACAATACGGTACGCCCGGTAAATACCTTTTCAATATCTTTGCGAT
CGATGCCAATACTTCCTGACTGCAGGAAGGACCAGTTATTCATCGCAAAGTATTCAACAT
TAACCGGCTCATAAAAATAGACATAGCGGTCATTGAGATCGAGATAATAGTGAAATTTCT
CTTCGGCCATCCCAAGACCTGAACCGTAATCATCCTGGTGGCGGTTGCCTTCCACTGCCT
GATCAAAAGCGGGTAATAGTGCTGCAGCTTCCACAATTGTGTCGCAGTCAGTGGATGCGG
TTTGTAGTGTGCCGCGTAAGCCCGGGTATTTATGGGCAGTCAGGTTTAAGCCATGGGTGT
TATTGGCAGACTCAAAAGCCTCGCAGATGGCGCGCCGCTGTTCTGGCGACACTTCCGACT
GCTCAGCAGCGAGAGCGCGCATCACATGCGCGGCAATACTCTGATTCTGATACTTATCAT
AAAGAAAGGAGGAGTCTGCTTTCTGCACGATATAGCGCAGATAGGCACTCATTGCTCTGT
CGCTGGCGACAAGTTCAAAAATAAGGAAGGAAGATGTCAGCACAATGACACTTGCGGCGA
TAAAATGCCGGAGCATTCTATGGTGCAATTTCATGATAAATGGCACTCCTTCGGTTAGTG
AAACGAGAAAACCAGATAAAGTTCGATTGCGGCCTGGCACAGGGGCGCTAATTATACTCA
TCTCTGCGCCGCTGGGGAGGGGAAATTTAGGGGTAATAGTAATAAATTGTATGCAAAAGC
CACGCAAAAAGCATGGCTCTGAATATTTTTGCACTTAAATATGATGAATAATCACTTTGT
TGCCCCCCTCGCTTTTCGCTTCGCGTAAGGCTTTATCTGCTTCCGTCATGACAAGCGAGA
TATTACGCGTGTCACCCGTTGAAAAAACCGTGCCAATACTGATGGTCATTTGTTCAGGAA
CATCATATCTGTTACTAAAGCCGGTCAGGAGTTCGACATTTTTACGCATACGTTCCGCAA
TGATTTTTGCCTGGGCACTATTGAGTTCGGTAAATAGCAAGCCAAACACCTCACCCTCCA
GTCGCGCTAAAATATCATCGGGGCGGATGCTTTGCTGGATAATATCGACAATTGAAACCA
GCACTTTATCACCCACACGATGTCCCCATTGGGCATTGATGCGTTTGAACTGATTAATAT
CAACCAGCATGACACAGAAGTCCTTAACAACAGGTCGCGACAATAATGACTCTACGCTGT
TGAAAAAGTAGCGCCGATTATAAATATTGGTCAGCACATCATGAACTGCCAGTTTGCTGG
AGAGTTGCAGCTCCTGAAAAATGTTATAAATCAGAAAAGACACAACAAACAGTTTACTGG
AAACTTCAATCCCGCGACTGATATACCAGATAGTATAATTATACTCATCCAGAGTCAGTA
GAAGTAAGTTGCAGCATAGCGATGCCAGACATAATAATGCTATTAACGGCCATAGTTCGC
TGGCTAATCGTGTGCGCATGATAATAAAGAACAGTAAAAATGCCCACAGACAAACCAATA
TTTTTGTATAGTTGATTCCCCAGGTCGCAGTATGGTTGTCCGGACAGTAATCGACGACAT
ACAAAGAATAGTCAGCGTTATAACTGCTCAGATTGTGTGCCAGAAGGGGAAAAACTAAAA
AAGGGATCAGCGCCAGCAACAGGATTCCCGTTTTTTTCTTATTGTTGTCAAGGATGTTGT
CTTTTCCATAACAAAAGAGCGCCAGCGAGGTTAAACAAATAAAACTGAGTTGGCGGAAAA
TATAGAAAATAGAAACATCATTCGACTTTGTCTGGATCAGTGTACTGCCGTTAATTGGTT
TATGGATAATTACAATGGTTTCAACTAAATAGATAAGGCCACTTAAAAATGCAAGGCTTA
AAATGAGTGTTGGTAAAATTTGTTTGTTAGTGAAATATTTCATTAACATGAAAAGAAAAA
TGACGGCGTTAAGGAAAAACAAAGCCACAACAACCATCAGGTAATTCATCTGTGGGATGA
GTTTTACATTTGTGTTTTCGTTATATAAGGTAGTAATGCAAAATAAAATTAACGTCAGCA
ATAAACTGAAAATAAAAAAGCTTTGAGCTTTTAATTTTTGTGTACCCATAGAAACCATAA
AAAGGAGAGCAATGTGAGTGCTGGATTTTATTGATGGCAGAGATATATAGTTTTGACCAG
GATCAATTTTCGTTAACGATAAAAAATATTTAAAGAATAACCCCATGGAAATACGTGTTG
ACTGAATCATTTTTCCGAATGATTGTTTTCTGGAACTAAATTATGTAAAGGTTATGCTGT
CATATTTAAAGCGATTGTAAGCTAATGTATGTAATAAATGAGATAATTTACAGTAAGCTA
AAAATCAGCCAGGCGATAATGACCTGGCTGATAGTTTTAGCCTTTAGCTGTTGCATTTTG
TTTATGAAACAGTTCACGGAACACCGGATAAATATCATCCTGGTCGCGGATGTGCTGCAT
CGCAAAGTTGTCGAAAGTAGATTGCAGATGCTCATATTCTCGCCACAATGTCTGATGTGC
ACGACGGGTAATTTCGATATAGCTGTAATAACGAACAACAGGTAATAATTTTTTCGCCAG
GATTTCATGGCAAAGCGGAGAGTCATCGGCCCAGTTATCGCCGTCCGATGCTTGTGCAGC
GTAAATATTCCACTGTGCCGGGTTATAACGCTCTTTCACTACCTCATCCATCAGTTTCAG
GGCGCTGGAAACAATGGTGCCGCCTGTTTCCTGCGAGTAGAAAAACTCATGTTCATCGAC
TTCTTTCGCCTGGGTATGATGGCGGATGTATACGACTTCCACGTTCTTATACGTTCTGCT
GAGGAACAGATACAGCAGAATATAAAAACGCTTAGCCATATCTTTAGTGGATTGATCCAT
TGAACCGGAAACGTCCATCAGGCAAAACATCACTGCCTGGCTGGAGGGATCGGGCCGCTT
CTCGTAGTTCTTGTAACGTAAATCGAAGGTGTCAATAAAAGGGACGCGTTCAATTTTGGC
ACGTAATTCTGCAATTTCTTTGCGCAGACGTTCCTCTTCCAGCAGTTGCGCAGGTTCACT
GTTGCTGATGATGGCCAAATTCTCTTCCAGTGCATGAAGTTCCCGCCGCTTGCCTGCCGT
CATGGCTGTGCGTCGCGCCAGTGAGTTCTGCAATGAACGCACAACGCTGATATTGGCCGG
AACGCCGTTAGCGGTATAACCCGCCCGATGCGTTTTATATTCGGTCAGCTGGCGTTGTTG
GTTTTGTTTCAGATTCGGTAAGGCCAAATCTTCAAAGAGCAGATCAAGATACTCATCTTT
CGAAATCTGAAAGACAAATTCATCCTGACCTTCACCATCCTGGCTGGCCTGGCCCTGACC
ACTGCCGGAACCTCCGCCGCCACCCTGGGGACGTTCAATTCGGTCGTTCTGGACGAAATG
GTCATTGCCCGGATGCACGCGGTGGCGCAGACCGCCACGCCCCTGATGAAACATCGGTTC
GCTAATATCTTCCGTGGGAATGGATACGGATTCGCCGCTGTCGACGTCAGTCACCGAACG
CTTATTAATGGCCTCGGAGATCGACTGTTTAATTTGCGCTTTATAACGGCGTAAAAAACG
CTGGCGATTCACCATGCTTTTGTTTTTGCCGTTCAGACGCCGGTCAATAAACCAGGTCAT
ATGCCCCCCGTACTACATTTGCCAACTGTATGCTACGCCTGTGTTGCCGCTTCTCAGGCC
CACGGTTCGCTGTCGTTGTAGGCCCGGTAACATGTGTACCGGGCCAGGGTTGTTAAGACG
ATTTACGTACGCGCAAATACCATTCGCACAGTAAACGCACCTGTTTACGGGTGTAGCCTT
TTTCCATCATACGGTCGACAAAGTCGTCGTGTTTCTTCTGCTCGTCGGTTGACGTTTTGG
CGTTAAACGAGATAACCGGCAACAGCTCCTCGGTATTGGAGAACATTTTCTTCTCGATGA
CCGTGCGCAGTTTTTCATAGCTGGTCCAGTTCGGATTGCGTCCGCTGTTATTCGCTCTGG
CGCGCAGTACGAAGTTAACAATCTCGTTGCGGAAATCTTTTGGATTACTGATCCCCGCCG
GTTTCTCGATTTTCTCCAGCTCGGCGTTAAGAGACTCGCGGTCAAACAGCTGCCCGGTAT
CCGGATCGCGATACTCCTGATCCTGAATCCAGAAATCCGCGTAGGTAACATAACGGTCGA
AAATGTTTTGCCCATATTCGGAATAGGATTCAAGGTAGGCCGTCTGGATCTCTTTGCCGA
TAAACTCGGCATATTTCGGGATCAGATAACCTTTCAGGAACTCCAGATAGCGTTCTGCCT
GCTCTTGTGGGAACTGCTCGCGCTCAATCTGCTGTTCCAGGACGTAGAACAGATGGACCG
GGTTTGCTGCCACTTCTACATGATCGAAGTTGAACACGCGGGAGAGGATCTTAAACGCAA
AACGCGTCGACAGACCGTTCATCCCTTCATCGACACCGGCGTAGTCACGATATTCCTGAT
ACGACTTGGCTTTGGGATCGGTGTCTTTCAGACTTTCGCCATCATAAACCCGCATCTTTG
AATAAATGCTGGAGTTTTCTGGCTCTTTCAGGCGCGAAAGAATGGAAAAACGTGACAGTG
TTTCGAGCGTGCCAGGGGCGCATGGGGCGTGAGTCAATTCACTGTGATTAAGCAATTTCT
CGTAGATTTTGATCTCTTCGGAAATGCGCAAGCAATACGGCACCTTCACGATGTAAACAC
GATCGAGGAAGGCTTCGTTGTTTTTGTTATTACGGAAAGTGACCCATTCGGACTCGTTCG
AGTGTGCGAGAATAATCCCGTTGAACGGCAGGGCGGAGATACCTTCCGTCCCGTTGTAGT
TACCTTCCTGAGTGGCGGTTAACAAGGGATGCAGCACTTTAATCGGTGCTTTAAACATCT
CAACGAATTCCATGATCCCCTGATTGGCGCGGCACAGCGCACCGGAATAGCCGTAGGCGT
CCGGGTCATTCTGCGCGTAGTGTTCGAGTTTACGAATATCGACTTTCCCAACCAGCGCGG
AGATGTCCTGGTTGTTCTCATCGCCGGGTTCCGTTTTGGCGATAGCAATTTGTTGCAGAA
TTGACGGCCAGACCTTCACTACCCGGAACTTAGTGATATCGCCACCAAATTCATGCAGGC
GTTTTGCCGCCCACGGCGACATGATGGTGCCGAGATAACGGCGAGGAATGCCATACTCTT
TTTCCAGAATCTGCGCATCTTCCTGCGGATTGAAAAGACAGAACGGATGATCGTTGACCG
GGCTACGCTCACCGTTCGCGCTCAATACATAAATCGGTACGAGCTGCATTAATGATTTCA
GTCGCTCAGCAAGCGATGATTTACCCCCACCCACAGGCCCCAGCAGATACAGGATTTGTT
TCTTCTCTTCCAGCCCCTGAGCCGCGTGTTTCAGATAAGAGACAATCTGTTCAATCGCGT
CTTCCATGCCGTAAAACTCTTCAAACGCCGGATAACGTGCAATGACCCGGTTAGAAAAGA
GTCGAGAAAGTCTGGGTTCCTGGGCTGTATCGACCATGACAGGCTCACCGATAGCCATCA
ATAGCCGCTCAGCCGCGTTGGCATAAGCACTGCGATCTTGCCGACAAGTGGTAAGAAACT
CCTGCAGTGTGAACTCTTCGTCCTTGGCAGCTTCATATCGCTGGCGATAGTGATCGAATA
TATTCATGGTATGCCGTCCTTTCGTTTTTTAGCACAGGTTAAGAGCCGTTCATATGAATA
GTAGAGGCTCCCGGAAGAGGTAAACTGAACGACGTCTCTTGCTAAAACACAGCAACTCTC
ATGCCATTTTATCGACGATGAGAACAACGTGCCCGGTGATACACCTTCAAAATTAAGCGT
AGATGGCAAATGGAAAACTTGCCTGCACGGCTTTCTTAATTTCAATGGCATATCAACAAC
TCATCCATAAATTTTGCATAATTAATGTAAAGACCAGGCTCGCCAGTAACGCTAAATTCA
TTTGGCTGTAAGCGCGGTGTCATCCGCGTCAGGAAAATTAAACAGTTACTTTAAAAAATG
AAAACGTAAAAAGGTTGGGTTTCGATGTATTGACGGGTAAACTTTGTCGCCCGCTAAACA
TTTGTTTAAGGAATGATTAATTGTGACCAAACTCAAACTTCTGGCACTTGGAGTGCTTAT
CGCAACGTCTGCAGGCGTAGCGCACGCTGAAGGTAAATTTTCCCTGGGCGCAGGCGTAGG
TGTCGTTGAACACCCATATAAAGATTACGATACCGATGTTTACCCAGTACCGGTAATCAA
CTATGAAGGCGATAACTTCTGGTTCCGTGGCTTAGGTGGTGGTTACTACCTGTGGAATGA
CGCAACGGATAAACTTTCAATTACCGCTTACTGGTCGCCGCTTTACTTCAAAGCGAAAGA
CAGTGGCGATCACCAAATGCGTCACCTGGATGACCGTAAGAGCACCATGATGGCTGGTCT
GTCTTATGCTCACTTTACCCAGTACGGTTACCTGCGTACCACCCTGGCTGGCGATACCCT
GGATAACAGCAACGGCATCGTCTGGGATATGGCCTGGTTGTATCGTTACACCAACGGTGG
CCTGACCGTGACTCCGGGTATTGGTGTGCAGTGGAACAGCGAAAACCAGAACGAATACTA
TTATGGCGTATCGCGCAAAGAGTCCGCTCGCAGCGGTCTGCGTGGCTATAACCCGAACGA
CAGCTGGAGCCCTTACCTGGAGCTGAGCGCCAGCTACAACTTCCTCGGCGACTGGAGTGT
TTACGGTACCGCACGCTACACCCGTCTGTCTGATGAAGTTACTGACAGCCCGATGGTGGA
TAAATCCTGGACTGGCCTGATTTCTACCGGGATCACCTACAAATTCTGATAATGCATCTT
TCCAGGGCATTTTGTGCATAAAAACAGGGCGTCACGCCCTGTTTTGCATTACGGTGGTGC
AATACCTGGGAGGAAACAATGCAACAAAAAATGATTCAATTTAGTGGCGATGTCTCACTG
CCAGCCGTAGGGCAGGGAACATGGTATATGGGCGAAGATGCCAGTCAGCGCAAAACAGAA
GTTGCTGCACTACGCGCGGGCATTGAACTCGGTTTAACCCTCATTGATACCGCCGAAATG
TATGCCGATGGCGGTGCCGAAAAGGTGGTTGGGGAAGCATTAACCGGTCTGCGAGAGAAG
GTCTTTCTCGTCTCTAAAGTCTATCCGTGGAATGCTGGCGGGCAAAAAGCGATAAATGCA
TGCGAAGCCAGTTTACGCCGTCTCAATACTGATTATCTCGATCTTTACTTATTACACTGG
TCTGGCAGTTTCGCTTTTGAAGAGACTGTCGCAGCGATGGAAAAATTGATCGCCCAGGGA
AAAATCCGCCGCTGGGGCGTTTCTAACCTTGATTATGCTGATATGCAGGAACTCTGGCAG
CTGCCGGGGGGAAATCAGTGTGCCACTAATCAGGTGCTTTACCATCTCGGTTCACGAGGA
ATTGAGTACGATCTACTCCCCTGGTGCCAGCAACAGCAGATGCCGGTGATGGCTTACAGT
CCGTTAGCCCAGGCCGGGCGGTTGCGCAATGGACTGTTAAAAAACGCGGTAGTCAACGAA
ATTGCACATGCTCACAATATCAGCGCGGCACAAGTATTGTTGGCGTGGGTGATCAGTCAT
CAGGGTGTGATGGCGATTCCAAAAGCGGCCACGATTGCCCATGTCCAACAAAATGCGGCT
GTGCTTGAGGTCGAACTTTCTTCAGCGGAATTAGCTATGCTGGATAAGGCATATCCGGCA
CCAAAAGGAAAAACTGCGCTGGATATGGTGTGATGTTGTGTGCCGGATGCATTGCACCCG
GCACACAACATTAACGTAAATTAACGTTTCGCAACGCGAATGGATTGCGCCAGATGTGCA
GGTTTCTCTTTGGTCACTTTTTGCGTTTCTGAAGCGTAAGCCGTTTCTACACAAACAAAT
GTTTTGTAGCCATCATCCGGCATATCGCCCATGCTAATTGAAAGCGCCGGTCCCGGGTTC
CAGCCGACAACGTTCAGATGATGCTGGTGGCCTACGGCGATAATACGATTCAGCGCTTCA
TCATTAATCACGCTGCAATCTTGTGGATTCAGATACACGCGATCGGTACGGTCAGGGAAG
GTCTGAATACCATCGGTCAGTACATTTTCTTTCGCGTCATTCACTTTATCAATGAAGCGA
TCGCCCAGCCCACTGACGCTTACCTTAGCGATATCACCCACGTTAAAGTAGGTATGCAGG
GCAGAGGTGGTTTCAAATTCGCCATGTGATTCAAGATCGATTTCACAAGTTTTACCCACG
CGGAAATGCGCTAACAGCGTAAAGTCGTGCGGCCAGAATTTTTTCGTCTCTTCGCTTTGC
GTCAATTCAAAAGTCAGCGCTACGCCATCAGCATCTTCATGATGTGATTTCAGCGTCCAC
GGCAGGTTGCGGGCAAAACCGTGCGCAGGCAGACCTTGTTGTGCCGCCGGACCAAACCAC
GGCCAGCAAACCGGTACGCCACCGCGAATAGCGACGCCATTTTTGAACGGTGTGTTGTTG
CTCAACCACAGAACTTCTTCTTCACCCGCAGGTTTCCACGAGAGAAGGTGTGCGCCCTGT
AATGCAAAAGAGGCTTTTACCTGGGGATGATCGACCACAATGAGGTCCAGTTCATCCAGT
TTACGACGGGAGAGGACAGGGGAGATTTGTTCGATGACCGGAAGGGCAAAAATTTTCTTA
ATCATGACGCAGTCCTTTAACTTCATTTTATCAGGTAAAAAAAAGAGCGACCGAAGTCGC
TCTTTTTAGATCACAGTGTCATCTCAACTTATTTGGAGATGTGAGCGATCAGGTCCAGAA
CTTTGTTGGAGTAACCGGTTTCGTTGTCGTACCAGGATACCAGTTTCACGAAGTTGTCGT
TCAGAGCGATACCAGCTTTAGCATCGAACACGGAAGTGCAAACTTCGCCGTTGAAATCGG
TAGATACTACGTCATCTTCGGTGTAGCCCAGAACGCCTTTCATTTCGCCTTCAGCAGCAG
CTTTAACGGCAGCTTTGATCTGCTCGTAAGTTGCAGCTTTTTCCAGACGAACGGTCAGGT
CAACTACAGATACGTTCGGGGTCGGAACGCGGAACGCCATACCAGTCAGTTTGCCATTCA
GTTCTGGCAGTACTTTACCTACAGCTTTAGCAGCACCGGTAGAGGACGGGATGATGTTCT
GGGAAGCGCCGCGGCCGCCGCGCCAGTCTTTGTGAGACGGGCCATCAACGGTTTTCTGAG
TAGCGGTAGTAGCGTGAACGGTGGTCATCAGACCTTCGATGATGCCGAAGTTATCGTTGA
TAACTTTAGCCAGCGGAGCCAGGCAGTTGGTGGTGCAGGAAGCGTTGGAAACGATGTCCT
GGCCAGCATATTTGTCGAAGTTAGCGCCTTTAACGAACATCGGAGTGTTGTCTTTAGACG
GACCAGTCATAACCACTTTCTTCGCACCAGCGGTGATGTGTTTACGAGCAGTTTCGTCAG
TCAGGAACAGACCAGTTGCTTCAGCGACAACGTCAACACCAACTTCGTCCCATTTCAGGT
TAGCCGGATCACGTTCAGCGGTAACACGGATTTTTTTACCGTTAACGATCAGATGACCGT
CTTTCACTTCAACGGTACCGTCGAAACGGCCGTGAGTGGAGTCATATTTCAGCATGTATG
CCATGTAATCAGCGTCTAACAGGTCGTTGATTGCAACGATCTCGATGTCAGAACGTTTCT
GAGCAGCACGGAAAACAATGCGACCGATACGGCCAAAACCGTTGATACCTACTTTGATAG
TCATATATTCCACCAGCTATTTGTTAGTGAATAAAAGGTTGCCTGTAAAATTACAAAAAC
CTTACGCAGCGTCAAGCGGAATCGTGTCAATCATTGCGACAAATCAATCCTGTGCCTAAG
CATTACGCGACTGACTCGCCTCACTCTTCCTTTGGGCTTGAGACCACATGGGGTCGGCGC
CCCGAATTTTAAAGGGCAATTACGATAAAAATGTGATTTTCATCACGATTTAGGTGCAGC
CATTTCGTCGAGATCAAGTTTAGGACAAAATTTTGCCAGTTGGTGTTAATGTTTTGTTAG
AATCAGTCACGTAATGTGAGCACGATTAAAGTGAGATGTGAGCAAATGGCTAATAAACCT
TCGGCAGAAGAACTGAAAAAAAATTTGTCCGAGATGCAGTTTTACGTGACGCAGAATCAT
GGGACAGAGCCGCCATTTACGGGTCGTTTACTGCATAACAAGCGTGACGGCGTATATCAC
TGTTTGATCTGCGATGCCCCGCTGTTTCATTCCCAAACCAAGTATGATTCCGGCTGTGGC
TGGCCCAGTTTCTACGAACCGGTAAGTGAAGAATCCATTCGTTATATCAAAGACTTGTCA
CATGGAATGCAGCGCATAGAAATTCGTTGCGGTAACTGTGATGCCCATCTGGGGCATGTC
TTCCCCGACGGGCCGCAGCCAACGGGCGAACGTTATTGTGTTAACTCTGCCTCTTTACGC
TTTACCGATGGCGAAAACGGCGAAGAAATCAACGGTTGAAAAAACGATTCAGCAACTTAT
TCCACAGGAGCGGAAAAATTATGAATCTTGATGACATTATCAACAGCATGATGCCTGAGG
TATACCAGCGTTTGTCGACCGCCGTTGAACTGGGGAAATGGCCTGATGGCGTTGCGTTGA
CCGAGGAACAAAAAGAGAACTGCCTGCAACTGGTGATGCTGTGGCAAGCCCGCCATAATA
TCGAAGCACAGCATATGACAATTGACACAAATGGTCAGATGGTCATGAAGAGCAAACAGC
AGTTAAAAGAAGATTTTGGTATCTCAGCAAAGCCTATTGCCATGTTTAAGTAAGTGGTTC
ATCCCCTTTTTGCCTCGGCTATGAAGGGGATAGCCAACAATGACCCCACGACTCATCTCA
ATTATCTCGCCATGACCTGGCTAAGTCCCAGTCCGATCTCTTGCCGTCCCGTTCACACCT
GAATGACTTCTCCTGAACTTAAGTCTCAGACCTATTTGGCCGGTAATCCCTCTCGAATTT
GCTCTTTTTGCGCCCCGCCTTCCATCAACCTGTAACAGACCCAGCCATTTTCTGCGTAAT
TGTGATCTGAGTTGTAAAACGCAGATCATTATCTGTGTTTTACAGATTTAATGTTGACCT
CAAAAATCATGTGGGTAAGTATGATGGCCATCTAAGCAAAACTAAACACAGAGGATGACG
CAATGAAAGCACTGGCTCGGTTTGGCAAGGCCTTTGGCGGCTACAAGATGATTGATGTCC
CACAACCCATGTGTGGCCCGGAAGATGTAGTGATTGAAATTAAAGCCGCGGCAATCTGCG
GCGCAGACATGAAGCACTACAATGTCGATAGCGGTTCTGATGAGTTTAACTCTATCCGCG
GCCATGAGTTCGCAGGTTGTATTGCGCAGGTTGGTGAAAAAGTCAAAGACTGGAAAGTGG
GGCAACGCGTCGTATCGGATAACAGCGGTCACGTTTGCGGTGTTTGTCCGGCCTGTGAAC
AAGGTGATTTTCTGTGTTGTACAGAAAAAGTAAACCTTGGTCTGGATAATAATACCTGGG
GCGGTGGTTTTTCCAAATATTGTCTGGTTCCTGGTGAAATTCTCAAAATTCATCGTCATG
CGTTGTGGGAAATCCCTGATGGTGTTGATTATGAGGACGCAGCCGTACTTGACCCTATCT
GTAATGCCTACAAATCCATCGCGCAGCAATCGAAATTCCTTCCTGGTCAGGATGTGGTCG
TCATCGGCACTGGCCCACTCGGGCTGTTCTCCGTACAAATGGCGCGAATTATGGGGGCGG
TAAATATCGTCGTCGTTGGTCTGCAAGAAGATGTGGCGGTCCGCTTCCCGGTTGCAAAAG
AACTGGGTGCGACGGCAGTAGTAAATGGTTCTACCGAAGATGTGGTGGCGCGCTGCCAGC
AAATTTGTGGCAAAGACAATCTGGGACTGGTGATTGAATGCTCCGGTGCCAATATCGCAC
TGAAACAAGCCATCGAAATGCTCCGCCCGAACGGGGAAGTGGTACGCGTTGGAATGGGCT
TCAAACCTCTTGATTTCTCGATTAATGACATTACCGCCTGGAACAAAAGCATCATTGGGC
ATATGGCCTATGACTCCACCTCATGGCGTAACGCTATCAGGCTATTAGCCAGCGGCGCTA
TCAAAGTCAAACCGATGATCACGCATCGTATCGGCCTGTCGCAATGGCGCGAAGGGTTTG
ATGCGATGGTCGATAAAACCGCAATCAAAGTGATCATGACTTACGACTTTGATGAATAAC
CACTCTCCTGAAGGAACGTTATCGCATGGAACAGATAACAAAACCGCATTGTGGTGCACG
GCTGGATCGCTTACCGGATTGCCGCTGGCATTCATCAATGTTTGCCATCGTCGCGTTTGG
CTTGCTTGTCTGCTGGAGTAATGCCGTTGGTGGCTTGATCCTCGCGCAGCTGAAAGCGTT
GGGCTGGACAGATAATTCCACCACAGCCACATTCTCAGCAATCACGACCGCCGGAATGTT
TCTCGGTGCGCTGGTGGGCGGCATCATTGGCGACAAAACCGGTCGCAGAAATGCGTTCAT
CCTCTATGAGGCCATTCATATTGCCTCGATGGTTGTCGGTGCTTTCTCACCGAATATGGA
TTTCCTTATTGCCTGCCGTTTTGTGATGGGAGTTGGGCTGGGAGCTTTACTGGTTACGCT
GTTTGCTGGTTTCACCGAATATATGCCCGGTAGAAATCGTGGAACGTGGTCAAGTCGGGT
TTCCTTTATTGGCAACTGGTCATATCCGCTCTGTTCATTGATAGCGATGGGACTCACGCC
GCTGATTAGTGCAGAGTGGAACTGGCGGGTACAACTGCTTATCCCTGCAATATTGTCGCT
TATCGCTACGGCGCTGGCCTGGCGCTACTTTCCTGAATCCCCGCGCTGGCTGGAATCGCG
CGGACGGTATCAGGAAGCCGAGAAAGTCATGCGGAGTATAGAAGAAGGCGTCATACGCCA
GACGGGTAAACCTTTGCCGCCTGTGGTTATTGCTGATGACGGTAAAGCGCCACAAGCGGT
GCCGTATTCAGCCTTACTGACAGGAGTATTACTGAAACGCGTGATATTAGGCTCTTGTGT
GCTGATTGCCATGAACGTTGTGCAGTACACACTAATTAACTGGTTGCCAACAATATTCAT
GACCCAGGGGATTAATTTAAAAGACTCGATTGTTTTAAATACCATGAGTATGTTTGGCGC
GCCATTTGGTATTTTTATTGCCATGCTGGTGATGGATAAAATTCCGCGTAAAACAATGGG
TGTGGGGCTATTAATCCTGATTGCGGTGCTCGGATATATCTATTCACTGCAAACCAGTAT
GTTGCTCATAACGTTGATTGGTTTCTTCCTGATTACTTTCGTCTATATGTACGTTTGCTA
TGCCTCGGCAGTGTATGTCCCTGAAATCTGGCCGACAGAGGCCAAACTCCGTGGCTCCGG
TCTGGCGAATGCGGTAGGGCGAATCAGTGGTATTGCCGCACCTTATGCCGTTGCAGTGCT
GCTCAGTAGTTATGGCGTTACGGGAGTCTTTATTCTTCTGGGGGCGGTTTCAATTATTGT
CGCAATTGCTATCGCCACCATTGGAATCGAAACCAAAGGTGTCTCCGTTGAAAGTTTAAG
TATTGATGCAGTAGCCAATAAATAATACGGGTGGATTCAAAATGAAAAATTCAAAAGCAA
TATTGCAGGTGCCGGGCACAATGAAAATTATTTCAGCAGAAATACCAGTGCCTAAAGAAG
ATGAAGTTTTGATTAAAGTAGAATATGTCGGTATTTGTGGTTCAGATGTACATGGTTTTG
AATCAGGCCCGTTTATTCCGCCTAAAGACCCAAATCAAGAAATTGGCCTGGGTCATGAAT
GCGCCGGGACGGTTGTGGCTGTGGGAAGCCGCGTGCGCAAATTTAAACCGGGGGATCGGG
TAAATATCGAACCTGGCGTTCCTTGCGGTCACTGTCGTTACTGTCTGGAAGGCAAATATA
ACATCTGCCCGGACGTTGATTTTATGGCGACACAACCCAACTACCGCGGCGCATTAACGC
ACTATCTGTGTCATCCGGAGAGCTTTACTTACAAACTGCCCGACAATATGGACACGATGG
AAGGGGCGCTGGTGGAGCCTGCCGCAGTCGGGATGCATGCCGCGATGCTGGCAGATGTTA
AACCGGGTAAGAAGATAATTATTCTGGGAGCAGGTTGTATTGGTTTGATGACGTTGCAAG
CGTGCAAATGCCTGGGAGCAACGGAAATTGCCGTCGTTGATGTGCTGGAAAAACGTCTGG
CAATGGCGGAACAGCTTGGTGCGACAGTGGTTATTAACGGCGCAAAAGAAGACACTATTG
CACGCTGTCAGCAATTTACCGAAGACATGGGCGCAGATATTGTTTTCGAAACAGCGGGTT
CTGCGGTCACCGTTAAACAGGCACCTTATCTGGTAATGCGCGGCGGTAAAATTATGATTG
TTGGTACTGTACCCGGCGATTCGGCAATCAATTTCCTCAAAATCAATCGCGAAGTCACTA
TCCAGACGGTATTCCGCTATGCCAATCGTTATCCGGTCACGATTGAAGCTATTTCTTCAG
GGCGATTCGATGTGAAATCGATGGTGACGCATATTTACGATTATCGGGATGTACAACAGG
CATTTGAAGAGTCAGTTAACAACAAACGCGACATTATTAAAGGCGTTATTAAAATTAGCG
ATTAATTAATACGGGAGAACAGAACATGCTCGCAGATATCAGATATTGGGAAAACGATGC
CACAAATAAACATTATGCAATTGCCCATTTTAACGTATGGAATGCAGAAATGTTGATGGG
CGTTATCGACGCAGCCGAAGAAGCGAAATCCCCGGTTATTATTTCTTTTGGTACAGGTTT
TGTCGGTAACACCTCATTTGAAGATTTCTCTCACATGATGGTATCAATGGCACAAAAAGC
AACGGTGCCGGTAATAACTCATTGGGATCATGGTCGGAGTATGGAGATTATTCATAACGC
CTGGACTCATGGTATGAATTCATTAATGCGTGATGCTTCCGCGTTTGATTTCGAAGAAAA
TATTCGTTTAACCAAAGAGGCTGTCGATTTCTTCCATCCGCTGGGTATTCCGGTAGAGGC
GGAATTAGGGCATGTCGGTAATGAAACCGTTTATGAGGAAGCGCTGGCGGGCTATCACTA
TACCGATCCTGACCAGGCGGCTGAATTTGTTGAACGTACGGGCTGTGATTCATTGGCTGT
CGCCATCGGCAACCAGCATGGGGTTTATACGTCAGAGCCACAATTGAACTTTGAGGTCGT
CAAACGCGTACGCGATGCCGTTTCTGTTCCGCTGGTTTTGCACGGTGCATCGGGGATCAG
TGATGCCGACATTAAAACTGCAATTTCGTTGGGTATCGCGAAAATCAACATTCATACGGA
GCTCTGTCAGGCCGCAATGGTTGCAGTGAAAGAAAACCAGGATCAGCCTTTCCTGCATTT
AGAACGTGAAGTACGTAAAGCTGTAAAAGAACGGGCATTGGAAAAAATTAAACTGTTCGG
TTCTGATGGCAAAGCGGAATAATGATATGGATAATCTCGACGTTATTTGTATAGGTGCCG
CTATTGTTGATATTCCATTGCAACCGGTCAGTAAAAATATCTTTGATGTGGATTCTTATC
CTCTTGAAAGAATCGCAATGACCACCGGGGGTGATGCAATAAATGAAGCAACAATTATTT
CTCGTCTGGGCCATCGCACAGCATTAATGAGTCGTATTGGTAAAGATGCCGCAGGGCAAT
TTATTCTCGACCATTGCCGCAAAGAGAATATTGATATTCAAAGCCTGAAGCAGGACGTCA
GCATAGATACCTCTATTAACGTTGGACTGGTGACGGAGGATGGCGAGCGGACGTTTGTCA
CAAACCGTAATGGCAGTCTGTGGAAATTGAATATTGACGATGTTGATTTTGCGCGGTTTT
CTCAGGCGAAATTATTATCACTGGCCAGTATTTTCAACAGTCCACTATTGGATGGTAAAG
CGCTAACAGAAATTTTTACGCAAGCTAAAGCCCGGCAGATGATTATCTGTGCCGATATGA
TCAAACCGCGGTTGAATGAAACGCTGGATGATATTTGCGAAGCATTGAGTTATGTCGATT
ATCTGTTTCCTAATTTTGCCGAGGCAAAATTACTCACCGGGAAAGAGACACTGGATGAAA
TTGCTGACTGCTTTCTTGCGTGCGGCGTAAAAACGGTGGTGATTAAAACGGGTAAAGACG
GCTGCTTTATCAAGCGTGGTGACATGACGATGAAGGTGCCGGCGGTCGCAGGAATAACCG
CCATCGACACCATTGGCGCGGGCGATAACTTTGCTTCAGGTTTTATTGCGGCACTGTTAG
AAGGCAAAAATCTGCGTGAATGCGCACGCTTTGCCAATGCAACGGCGGCTATCTCGGTTC
TAAGCGTCGGTGCCACCACCGGCGTAAAAAACAGAAAGCTGGTCGAACAATTGCTGGAAG
AATACGAAGGATAATGAAGGCAAATGAAAAAGATACCTTTAGGCACAACGGATATTACGC
TTTCGCGAATGGGGTTGGGGACATGGGCCATTGGCGGCGGTCCTGCATGGAATGGCGATC
TCGATCGGCAAATATGTATTGATACGATTCTTGAAGCCCATCGTTGTGGCATTAATCTGA
TTGATACTGCGCCAGGATATAACTTTGGCAATAGTGAAGTTATCGTCGGTCAGGCGTTAA
AAAAACTGCCCCGTGAACAGGTTGTAGTAGAAACCAAATGCGGCATTGTCTGGGAACGAA
AAGGAAGTTTATTCAACAAAGTTGGCGATCGGCAGTTGTATAAAAACCTTTCCCCGGAAT
CTATCCGCGAAGAGGTAGCAGCGAGCTTGCAACGTCTGGGTATTGATTACATCGATATCT
ACATGACGCACTGGCAGTCGGTGCCGCCATTTTTTACGCCGATCGCTGAAACTGTCGCAG
TGCTTAATGAGTTAAAGTCTGAAGGGAAAATTCGCGCTATAGGCGCTGCTAACGTCGATG
CTGACCATATCCGCGAGTATCTGCAATATGGTGAACTGGATATTATTCAGGCGAAATACA
GTATCCTCGACCGGGCAATGGAAAACGAACTGCTGCCACTATGTCGTGATAATGGCATTG
TGGTTCAGGTTTATTCCCCGCTAGAGCAGGGATTGTTGACCGGCACCATCACTCGTGATT
ACGTTCCGGGCGGCGCTCGGGCAAATAAAGTCTGGTTCCAGCGTGAAAACATGCTGAAAG
TGATTGATATGCTTGAACAGTGGCAGCCACTTTGTGCTCGTTATCAGTGCACAATTCCCA
CTCTGGCACTGGCGTGGATATTAAAACAGAGTGATTTAATCTCCATTCTTAGTGGGGCTA
CTGCACCGGAACAGGTACGCGAAAATGTCGCGGCACTGAATATCAACTTATCGGATGCAG
ACGCAACATTGATGAGGGAAATGGCAGAGGCCCTGGAGCGTTAAATACTCAACACGATTC
ACCTCTGTTTCTGTGAAAACTGTGATGAAAATCTGTGATTCAAACAGGTTATTTTGAAAG
TAAACATCGGTTATGCGATAATCGCGCTAATGTGATGTAAAAAGATACAGGGGTGTAATC
GTGGCGGCAAAAGACAGGATTCAGGCAATTAAGCAAATGGTTGCCAACGATAAAAAGGTG
ACAGTCTCAAATTTGAGTGGGATTTTTCAGGTAACCGAAGAAACCATTCGCCGCGATCTT
GAGAAGCTGGAAGATGAAGGCTTTTTGACCAGAACCTATGGTGGTGCTGTTTTAAATACA
GCGATGTTGACGGAGAATATCCATTTTTATAAGCGCGCTTCATCGTTTTATGAAGAGAAG
CAGCTTATTGCACGCAAGGCACTACCCTTTATCGACAATAAAACCACCATGGCAGCCGAT
TCCAGTAGTACCGTAATGGAATTGCTCAAATTGTTACAGGACCGTAGTGGCCTGACGTTG
CTAACCAACTCGGCGGAAGCGATTCATGTTCTGGCTCAGTCAGAAATTAAAGTCGTTTCA
ACGGGTGGGGAACTAAACAAAAATACACTTTCACTGCAAGGAAGAATTACTAAAGAGATC
ATCAGGCGCTATCATGTCGATATCATGGTAATGAGTTGTAAAGGTCTTGATATTAACAGC
GGCGCGCTGGACTCTAATGAAGCGGAAGCTGAAATCAAAAAGACAATGATCCGTCAGGCG
ACAGAAGTTGCGTTATTGGTTGATCACTCTAAGTTTGATCGCAAAGCTTTTGTCCAGTTA
GCTGATTTTAGTCATATTAATTACATAATAACTGATAAATCACCGGGTGCAGAGTGGATA
GCATTTTGCAAAGACAATAATATCCAGCTGGTGTGGTAATTTAAGCACACGTTGTCAATA
TTATTTGTTCCTGCGCCTTGAAATAAAATGATGATAAAGATGCGGCAAGTGAATTTGCCG
CAATTGCTACCTTTTTAGCAAATCCGAGGCACCTAATGGAACAATATGATCAAATTGGCG
CAAGACTGGACCGCTTGCCTTTGGCCCGGTTTCATTATCGTATATTTGGTATTATAAGCT
TTAGTCTGTTATTAACAGGGTTTTTGAGTTACTCCGGTAATGTCGTCTTAGCAAAGCTGG
TAAGCAATGGATGGTCAAATAATTTCCTCAATGCCGCCTTTACCTCGGCATTAATGTTTG
GTTATTTCATCGGCTCACTTACTGGTGGGTTTATTGGTGACTACTTTGGGCGGCGCAGGG
CGTTTCGCATAAATCTTCTCATCGTCGGTATTGCTGCAACAGGGGCCGCTTTTGTCCCTG
ATATGTACTGGCTCATCTTCTTTCGCTTCCTGATGGGAACAGGAATGGGGGCGCTGATTA
TGGTTGGCTATGCCTCATTTACGGAGTTTATCCCCGCGACGGTGCGTGGAAAATGGTCCG
CGCGGCTCTCATTTGTTGGTAACTGGTCGCCCATGCTGTCTGCGGCGATAGGCGTGGTGG
TTATCGCTTTTTTTAGTTGGCGAATAATGTTTCTGCTGGGTGGTATTGGCATACTGTTAG
CCTGGTTTCTCTCAGGTAAATACTTTATCGAGTCGCCACGATGGCTGGCAGGGAAAGGGC
AAATCGCAGGTGCAGAATGCCAACTTCGTGAAGTAGAGCAGCAAATTGAAAGAGAGAAGA
GTATTCGTTTACCCCCGCTTACTTCGTATCAGAGCAACAGCAAGGTTAAAGTAATCAAGG
GTACTTTCTGGCTCCTGTTTAAAGGTGAAATGTTACGACGTACATTAGTCGCGATTACTG
TTTTAATTGCAATGAACATTTCGCTTTATACCATCACCGTATGGATACCGACCATATTTG
TTAACTCCGGCATTGATGTCGATAAATCAATATTAATGACCGCTGTTATTATGATTGGCG
CTCCGGTAGGAATATTTATTGCGGCATTAATTATTGATCATTTTCCTCGTCGGTTATTTG
GCTCCACCTTACTTATTATTATTGCCGTGTTAGGCTATATCTATTCAATTCAGACTACAG
AGTGGGCGATTTTAATCTATGGACTGGTGATGATCTTCTTTTTATACATGTATGTTTGCT
TCGCGTCGGCGGTTTATATCCCGGAGCTTTGGCCAACGCATTTACGCCTGCGCGGTTCGG
GTTTCGTTAATGCCGTCGGACGGATCGTCGCAGTCTTCACGCCCTATGGCGTTGCGGCAT
TATTAACACATTATGGGTCGATCACGGTGTTTATGGTACTTGGTGTTATGTTATTGCTCT
GTGCGCTGGTTCTCTCCATTTTTGGCATCGAAACGCGGAAGGTGTCGTTGGAAGAGATTT
CTGAGGTGAATTAAATCTTTCGTTGATGGCATCAATTGCCAGATGTGCCACTGACGTGTT
TTATTTGGCCTACAATGCCAGTACAGAATTGTAGGCCAGCGTAAAATTACCCCTGTGTCT
CTTCCCAGTCTGCCAGCGTATATAGCGTTGCCCCAGCTGCTGACATCTCCATAAACGCGT
GCGCACTGTCCTGGGGCTGGATATTCACGCCACGACAACCATCGGTAATCACGTTTACCT
TATAACCTAACTGTAACGCGTCCAGCACGGTAAACTTCACGCAATAGTCAGTAGCCAGGC
CCATAACGATCAATTCATCGATTTCATGATCGCGTAACCAGTCATCGAGAGAGGTTTTCT
GCCGACGGCCGTTATCAAAAAAGGCACTGTAACTGTCAACTAAAGGATTTTCGCCTTTAT
GGAACACCGCTGCGATCGCTTTTTGGTGCAGTAACGGATGTAATTGTGCGCCTTCACTGT
TCTGCACACAGTGATCTGGCCAGAAGGTTTGTGGCAAACCGTCGAGTTGGCCTGGCGTAT
AAGGCTCTACACCGTGCTGACTGGCAAAACTGCCGTGATTCGCCGGGTGCCAGTCCTGAC
TGGCGATAACCGCTTCACCGCGCGACTGGCACCAGTCAATCAGGCGGTTAGCGACATCCA
CCGTACTGTCACCTTCCGGCACGGCGAGCGCGCCACCAGCACAGAAATCATTTTGTAAAT
CGACCAGTAACAGGGCGCGAGGGGGCATTACAGTCTCCTTAATCATCCGGCGTCAGTTCG
CCGCGCAGGTTTTGGCTCATGGCCTTGCGAATGGTTTCAGTATCCAGTTCCTGGCTAAGC
AGGTAATGCAGTTTGGTTAGCGTGGCTTCTACAGTCATATCTGCACCGCCAATTACGCCG
GCATGGGCGAGGGCGTTACCGGTGGCATAACCACCCATGTTCACTTTACCGGACATACAT
TGTGTCAGGTTGACCACCACAATACCGCGATCGCTGGCTTCTTGTAATTCCTGCAGGAAG
GCTTTGTTTTGTGGCGCATTACCCACGCCATAGGAGCGCAGAATCAATGCTTTCACCGGT
TGGCGCAGAAAATTGCGCACGACGTCAGCAGAAATCCCTGGATAAATCGTCACTACGCCA
ATTGGTTGTGGGGTGATTGGATGAACGATTAATTCCCCTTCACCGTGCGGGGCGGGTGGC
GTATTCAAACGACGAATATGGATACCTGCTTCCAGTAACGGAGGAAGGTTTGGAGAGGCA
AACGCATCAAAACCATCGGCATGGGCTTTGGTAGTGCGGTTGCCGCGATACAATCGGTTA
TTGAAAAAGAGCGTTACTTCGTTGATCGGATAATTCGCCGCAACGTACAACGCATTCAGC
AGATTAATTTGTCCGTCAGAGCGTAACTCAGCCAGCGGGATTTGTGACCCTGTCACAATG
ACCGGTTTACCGAGATTCTCGAGCATGAACGACAGCGCAGAGGCGGTATACGCCATCGTG
TCGGTGCCGTGCAGAATGACAAAACCATCATAGTCGTCATAGTGCGCTTTAATATCTTCA
GCAATATGCTGCCAGTCTTCCGGCGTCATATCTGAAGAATCCATCAGCGGCGTATATTCA
TGAATGGTGAAATCTGGCATCTCCGGGCGATGGAATTCCGGCATCAGCGCCAGTTGGCGT
TGTAGATGACCTGACACCGGTATATAACCCTGCTCGGAACGCTGCATCCCGATGGTCCCG
CCCGTGTAGGCAACGTAAATTGATTTCTTTTGCATGATATTGATATGAATGATATCGAAA
GAGCAAAAGTATATACGTGAGGCAGGGGGAGCGCACCTGATACTATGCGGATAAGGAAAT
ATGGGGCGAAACAGCGGGAAGAGGATTCGTCGACGTAAAAAATAATGTGGCCGACGATCT
GTCGGCCACTCAGTACAAGACTTAACGCATGTTGGCGCAGGTCAGGCAAAACGCATAACG
GTTTTGTGGGTCATTAAACGCGGCCAGCTTGTCACTTTCACTTTTAACGGTAGAGGCTAC
CGAGGCCAGCGGTGCAGGTAACATGGCCTGGAACGCATCTGGCAACATTGCCCGGACAGA
ACCAGACATGTTGTCCATCACTTTGTCGAAGAAGGTCGGTTCATCAACGTAATATTCCAG
ATGCCACTGTTTCACTTTTGCCAGCTCTGCTGCTTTGGCGACCGCATCATCGAAATCCCC
GAGACTATCGACCAGCCCGTTAGCTTTTGCATCCTGACCGGTCCAGACGTGGCCCTGGGC
AATTTTATCAATCTGCTCCGGCGTCGAATGACGCGCATCAGCAACCAGCGTGATAAAGCG
TTTATAGCCATTCTCAATGCTTAACTGCATCATCAGCTGCGCTTCCGGCGGCAGTGCCCT
GGTGATAGAAACATCCGCCAGCGGTGAAGTTGAGACACCATCAGTATGAACACCAATCGA
ATCCAGACTATTTTCTACGGTGGTGATCACGCCGAAGATACCGATAGAACCGGTCAGGGT
GCTGGGGTTAGCCACAATGTAATTAGCTGGCGTGGAAATCCAGTAACCACCAGATGCCGC
CATGCCGCCCATCGATACAACCACAGGCTTACCCGCTGCCCGGGCTGCTGCCAGTTCAGC
GCGAATCACTTCAGACGCGGTAACGCTGCCGCCTGGGCTATTAACACGCAGGACAATCGC
TTTCACTTTCGGGTCAAGGCGAGCGTCGCGGATTTGTGCCGCAGTGGTATCACCGCCAAC
ATTCCCCTGAGTTTCCTCGCCATCCATAATTGCGCCATTAGCAAAGACGACACCGATGCT
GTCACCGGTATCTGCCGGCGTTTTCAATGCGTAATCGTAATAACTGATGGCGCGATAATT
TTTATCAGTCTTACTCCAGCCGAATTCTTTGGTCAGTGCTTTTTCGATTTCCGCACTCGA
TGCCAGTGCATCGACCAGCTTGTTTTCCAGTGCATATTTCGCGGTATCGCCACCGGTTTT
GGTTAAACCCTCAAGCAACCCTTGCGCGCCAGGGAATACCTGCTCAGCAGGGATCTGCCG
GTTAGCGGCAACAGTATTCAGATAGTTTTGCCACAGCTCACCAATCCAGCGGCTGTCAGC
TTCGCGGGCTGCCGGTGACATATCATCACGAATAAACGGTTCAACGGCAGATTTATACGT
ACCCACGCGGAACACATGGGTGGAAACTTTCAGCTTATCCAGCAACGATTTGTAGTACAG
ACCGTTGGTGGCAAAGCCGTGCAGATCAACCACGCCTTGCGGAGACAGCCAAATTTTATT
GGCGAAACTGGCGAGATAATATTGCCCCTGGCTGTAGTTCTCGCCAACGGCATAAACCGG
TTTCCCGCTGTCACGAAACTCTTTCAGAGCTTTGCCGATGTACTGCATAGACGGTTGGTC
GCCGCCTGCGAAGTTTTTCAGATCCATCACAATACCGGTGATATTGCGGTCGTCCTTCGC
CTGGCGAATAGTGTTGACGATATCAAACAGTGAGTTTTCCTGCAGACGATCGGAACTGGC
ACCAAGCAGCTGGCGGCTTAATTTACTAAACCGCTGAGAACTGTCGGGTTTATCGACGAT
CACACCAGAAATGTCCAGCAGCAGTGCGCCACGACTGGCCGTTTCTTTCGAATCACCACC
ACTGACCTGCATCCAAATCCCCACACCAACCAGTACGAGGAAAATAAAGAACAGGTTAAG
TACCATTTCACGGACGAAATTCAGCAGACGCCACGTCCATTTAAAAAATCCGGCAATAAA
TCGCCAAAGGGTTCGCATGTATTCTCCCAACTTAAGGTCACACCTGTCACAGGCGCAATA
GATGTGGTTATCGTAATGACCCAACCGGTACTTGTCAGCAGGAATTGCGGACTGTGCTGT
AACAAAATCCACTCTCGTGTTAATTTTGTGAATAAATATCACGACAGGAGTTAATCAAAT
GGATGCACTCGAACTATTGATCAATCGCCGTAGCGCCTCCCGCTTGGCTGAACCCGCGCC
AACGGGTGAACAACTGCAAAACATCCTGCGTGCGGGTATGCGTGCGCCGGACCATAAGTC
CATGCAACCGTGGCATTTTTTTGTGATTGAAGGGGAAGGGCGCGAGCGTTTCAGCGCCGT
ACTGGAACAGGGGGCGATTGCTGCCGGTAGTGATGACAAAGCTATCGACAAAGCCCGTAA
TGCGCCGTTCCGCGCACCGCTCATCATCACGGTGGTGGCGAAATGCGAAGAGAATCATAA
AGTCCCGCGCTGGGAACAGGAAATGTCTGCCGGATGCGCGGTCATGGCGATGCAAATGGC
AGCAGTTGCCCAGGGGTTTGGCGGCATCTGGCGCAGTGGCGCATTAACTGAAAGTCCGGT
AGTGCGTGAAGCATTCGGTTGCCGTGAGCAGGATAAAATTGTCGGTTTTCTCTACCTCGG
TACGCCGCAGCTGAAAGCATCTACGTCGATTAACGTCCCGGACCCGACGCCGTTTGTAAC
TTATTTCTGATAATTGTCGCGAAACTGTCTGGATTGTGAGCAAAGGCGCAGGAATTCAGA
CACTCTCACTTATCACTTCACGGAATGAGGGTTACCATACCCGGATTGCATTGACAGGAG
ATGTCCATGAGCGAGAACTCGATTCGTTTGACCCAATACAGCCACGGAGCTGGTTGCGGC
TGTAAAATTTCCCCAAAAGTGTTGGAAACCATCCTGCATAGTGAGCAGGCGAAGTTTGTT
GATCCGAATTTGCTTGTGGGTAATGAAACCCGCGACGATGCGGCGGTGTACGATCTGGGC
AATGGCACCAGCGTTATCAGTACCACCGACTTCTTTATGCCGATCGTTGATAATCCTTTC
GATTTTGGCCGCATTGCGGCGACTAACGCCATCAGCGATATCTTCGCGATGGGGGGCAAA
CCGATTATGGCGATTGCGATCCTCGGCTGGCCGATTAACAAACTTTCCCCAGAAATTGCC
CGCGAAGTGACCGAAGGTGGACGCTATGCATGTCGTCAGGCGGGTATTGCGCTGGCTGGC
GGTCACTCCATCGATGCGCCGGAGCCGATTTTTGGTCTGGCGGTAACGGGGATCGTACCG
ACCGAGCGGGTGAAGAAAAACAGTACCGCACAAGCCGGATGCAAACTGTTCCTGACGAAA
CCGCTGGGGATCGGCGTTCTTACCACGGCTGAGAAAAAATCACTGTTGAAACCAGAACAT
CAGGGACTGGCGACGGAAGTGATGTGCCGGATGAACATCGCAGGCGCGTCCTTTGCCAAC
ATCGAAGGCGTAAAAGCGATGACCGACGTTACGGGCTTTGGTCTGCTGGGCCACTTGAGC
GAAATGTGTCAGGGGGCTGGTGTGCAGGCACGCGTCGACTATGAAGCGATCCCGAAACTC
CCCGGTGTTGAAGAGTACATTAAGTTGGGCGCAGTACCTGGCGGCACTGAACGTAACTTT
GCCAGCTACGGTCATCTGATGGGTGAAATGCCGCGTGAAGTGCGCGATCTGCTGTGTGAT
CCGCAAACTTCTGGCGGTTTGCTGCTGGCGGTCATGCCGGAAGCAGAAAATGAGGTCAAA
GCTACAGCCGCCGAGTTTGGCATTGAACTGACGGCAATTGGCGAACTGGTGCCAGCGCGC
GGCGGTCGTGCCATGGTTGAGATTCGTTAATTCAATGCGGTTGTTTATTGCCGAAAAACC
GAGTCTGGCGCGCGCCATTGCTGATGTCCTGCCCAAACCGCACCGGAAAGGCGATGGCTT
TATCGAGTGCGGTAATGGTCAGGTGGTGACCTGGTGTATCGGTCACCTGCTTGAGCAGGC
GCAGCCAGACGCCTACGACAGCCGCTATGCGCGCTGGAATCTTGCGGATTTGCCGATTGT
CCCGGAAAAGTGGCAATTACAGCCCCGACCCTCCGTGACCAAACAACTTAACGTCATCAA
ACGGTTCCTGCATGAAGCCAGCGAAATCGTTCACGCCGGGGACCCGGATCGTGAAGGGCA
ATTGCTGGTGGATGAAGTGCTGGACTATCTGCAACTGGCACCGGAAAAGCGCCAGCAGGT
ACAGCGTTGCTTGATAAACGACCTGAACCCGCAGGCGGTTGAGCGGGCGATCGACCGTCT
TCGTTCCAACAGTGAGTTTGTACCGCTGTGCGTTTCTGCGCTGGCGCGAGCGCGTGCCGA
CTGGCTGTACGGCATCAATATGACCCGTGCGTATACCATTCTCGGTCGCAATGCCGGTTA
TCAGGGCGTACTTTCCGTGGGACGCGTGCAGACGCCCGTGCTTGGGCTGGTGGTGCGCCG
CGATGAAGAGATTGAAAACTTCGTGGCGAAAGACTTCTTTGAAGTCAAAGCACATATCGT
GACACCTGCCGATGAGCGGTTTACCGCTATCTGGCAACCGAGCGAAGCGTGTGAACCGTA
CCAGGATGAAGAAGGGCGCTTGTTACATCGTCCACTGGCGGAGCATGTGGTTAACCGCAT
TAGTGGTCAACCGGCTATTGTCACCAGCTATAACGATAAACGGGAATCAGAATCCGCGCC
GCTGCCTTTTTCGCTTTCAGCGTTGCAGATTGAAGCGGCAAAACGTTTTGGTCTGAGTGC
GCAGAACGTGCTTGATATCTGCCAGAAACTGTACGAAACGCACAAGCTAATCACTTATCC
GCGTTCTGATTGTCGCTATTTGCCAGAAGAACATTTTGCCGGACGCCACGCGGTGATGAA
TGCCATCAGTGTTCATGCACCGGATCTGTTGCCGCAGCCAGTGGTAGATCCAGATATACG
CAACCGCTGTTGGGATGACAAAAAGGTCGATGCGCACCACGCCATCATTCCGACCGCACG
GAGTTCTGCGATCAACCTGACGGAGAACGAAGCGAAGGTCTATAACCTGATTGCCCGTCA
GTATCTGATGCAATTCTGCCCGGATGCGGTGTTCCGCAAGTGTGTTATCGAACTGGACAT
TGCCAAAGGCAAATTTGTCGCTAAAGCGCGTTTTCTTGCTGAAGCAGGCTGGCGCACGCT
GTTAGGCAGCAAAGAGCGCGATGAAGAAAACGACGGCACGCCACTGCCTGTGGTGGCGAA
AGGCGATGAGTTGCTGTGTGAAAAAGGTGAAGTGGTAGAGCGGCAAACCCAGCCGCCGCG
CCATTTTACCGATGCAACACTGCTTTCGGCGATGACCGGGATCGCGCGCTTTGTGCAGGA
TAAAGATCTGAAAAAGATCCTCCGTGCGACCGATGGTCTGGGGACAGAGGCAACGCGTGC
CGGGATTATTGAACTGTTGTTCAAGCGTGGTTTCCTGACCAAAAAAGGGCGCTATATCCA
CTCCACCGACGCCGGAAAAGCGCTATTCCATTCGCTGCCGGAGATGGCGACGCGACCGGA
CATGACCGCGCACTGGGAATCGGTGCTGACGCAAATCAGCGAAAAGCAGTGTCGCTATCA
GGACTTTATGCAGCCGCTGGTGGGGACGCTATATCAGCTTATTGATCAAGCCAAACGTAC
GCCGGTGCGGCAGTTTCGCGGCATTGTGGCTCCGGGCAGTGGTGGCAGTGCTGATAAGAA
AAAGGCTGCACCGCGTAAACGTAGTGCGAAAAAAAGTCCGCCAGCAGATGAAGTCGGAAG
CGGGGCGATAGCGTAAGCGAGTGAATCTTTCGTGCTATTCGAGTCATATTCTGAAATATC
CAGCGGATCAAGAAAATTCGTTGGATATTTTTTTTGCATGGATAAAATTATCGCCTCTAA
AGTATGTAATAACAGGGAATGTGATGAAAAAAGTTTTATTACAAAACCATCCTGGGAGCG
AGAAGTATTCTTTTAATGGCTGGGAAATATTTAATAGTAATTTTGAACGGATGATTAAAG
AAAATAAGGCCATGCTGCTTTGTAAGTGGGGGTTTTATTTAACATGTGTTGTCGCTGTAA
TGTTTGTGTTCGCAGCGATAACATCCAACGGTTTGAATGAAAGAGGCCTGATTACCGCGG
GATGCTCTTTTCTTTATCTATTAATTATGATGGGGCTTATTGTTCGGGCCGGTTTTAAAG
CAAAAAAAGAACAACTGCATTATTATCAGGCTAAAGGTATTGAGCCGCTCAGTATCGAGA
AGTTACAGGCGCTACAATTGATCGCACCTTATCGATTCTATCATAAGCAATGGTCTGAAA
CGCTGGAGTTCTGGCCGCGAAAGCCTGAACCTGGCAAAGATACCTTCCAATATCATGTGC
TTCCTTTTGACTCGATCGATATCATAAGTAAAAGACGCGAGTCTTTAGAGGATCAATGGG
GTATCGAAGATAGCGAAAGTTATTGTGCCTTAATGGAGCATTTTCTTTCTGGCGACCATG
GAGCCAATACCTTTAAAGCAAACATGGAGGAAGCCCCAGAGCAGGTTATCGCCTTGTTGA
ATAAATTTGCTGTTTTTCCCTCAGACTATATCTCTGATTGCGCTAATCATAGCTCCGGTA
AATCCTCGGCGAAGCTAATATGGGCGGCGGAATTATCATGGATGATCTCGATATCAAGCA
CAGCTTTTCAAAACGGGACAATTGAAGAAGAACTGGCCTGGCATTATATAATGCTTGCTT
CTCGAAAGGCGCACGAGTTGTTCGAAAGCGAAGAAGATTATCAAAAAAATAGTCAAATGG
GATTTCTTTACTGGCATATCTGCTGCTATCGCAGAAAGTTAACGGATGCTGAACTTGAAG
CGTGTTATCGTTACGACAAGCAGTTTTGGGAGCACTACAGTAAGAAATGCCGTTGGCCCA
TAAGAAATGTTCCGTGGGGAGCATCATCCGTTAAATACTCATAAACGCCTGAAATTTTGC
CGGGGGCGCTGCGCTTGCCCGGCCTACATTAGAGCGTAACTGCAATGAATTGTGCCCATT
TGTAGGCCTGATAAGCGTAGCGCCATCAGGCATTTACAACTTAAATCACACCCTGCGCCA
GCATCGCATCGGCAACCTTCACAAAACCGGCAATGTTCGCGCCCTGCACGTAGTTGGTTT
GCTCACCTTCACCACCATGCTCAACACAGGCATGGTGGATATCCAGCATGATGTGATGCA
AACGTGCGTCAACTTTCTCGGCTTTCCAGCCCAGGCGCGCAGCGTTTTGTGCCATTTCCA
GGCCCGATGTAGCGACGCCACCAGCATTAGCCGCTTTACCCGGTGCAAATAGTACGCCTG
CCTGCTGGAACAGTTCAGTCGCTTCGATGGTGGTCGGCATATTTGCCCCTTCGGCGACGG
CTTTAACGCCATTAGCGATAAGCTGATGCGCGGCGTCAACATCCAGTTCATTCTGGGTGG
CGCAAGGCAGGGCGATATCAACCGGTAGAGACCACGGCTGTTGGCCTTCGAGATAGACCA
GACCAAATTCTTTGGCGTAATCTGCCACTCGACCATCGCGGCTGGCTTTGATTTCGATAA
GACGTGCCAGTTTCTCTTTCGTGAATCCGCTTTCATCAACTACAGTGCCGCTGGAGTCTG
ACGCAGTGATCACACGAGCACCAAATTCCATCGCTTTTTCGATAGCGTACTGGGCGACGT
TGCCGGAGCCAGAAACGGAAACGCGCATCCCTTCAAAACCCATACCGTGGCGTTTTAGCA
TTGCTTCTGTGAAATAAACCAGACCGTAGCCGGTAGCTTCCGGGCGAATAAGACTGCCGC
CAAATGAAAGGCCCTTACCGGTGAAGACGCAGGCGGTATTGTTGGAGAGCTTTTTCATCA
TCCCCGCCATAAAGCCGACTTCACGACCACCAACCCCGATATCACCTGCCGGAACGTCGG
TATCCGCGCCCAGGTGGCGATACAGTTCAGTCATCAGCGCCTGGCAAAAACGCATCACTT
CACCTTCGCTTTTTCCTTTCGGATCGAAATCGCTGCCGCCTTTACCACCGCCCATCGGCA
GAGTAGTCAGGGCATTTTTGAAGGTTTGTTCAAAGCCGAGGAATTTGAGAATGGAAAGGT
TAACTGACGGATGGAAGCGCATACCGCCTTTGTACGGGCCGATGGCAGAGCTGAACTGCA
CACGCCATGCACGGTTGACCTGTATCTGGTTGCGATCATCAACCCATACCACGCGAAACT
GGATCACGCGCTCCGGTTCAACCAGACGCTCCAGTAATGACATCTGGCGATATTTTGGAT
TTTGTTCAAGAAAAGGCCAGAGTGTGGTCATTACTTCACGAACGGCTTGCGCGAACTCGG
TTTGATTCGGGTCGCGCTTTTGGACATGGTTGAGGAATGACTCCAGAGAATATGTCTGAT
CCATAGATATAAAACCCTTATATATTAATACGATTGTGCTTATGTTGTTTATGTCATGTG
CTTTTGCAGTTTTCGACTATACCATCAAGAATGTGACGGTAAGCAAGAAAAAAATGACCC
AGGAAAGCAAATTAATAACGAGAGTAATCTCATAACCAAATGCGATAACTCAGACGCTAA
AGTTTTGCCACCCGGCTACCGTTATCAGTAGCAGAGACAATAACGTTAAGGAGTTCCCTG
TGAGTCGAGCATTGTTCGCCGTAGTATTAGCATTTCCATTAATTGCACTGGCTAACCCGC
ATTATCGTCCGGACGTGGAGGTAAACGTACCGCCAGAAGTGTTCAGTTCAGGCGGGCAGT
CAGCGCAGCCCTGTACTCAGTGCTGCGTTTATCAGGATCAAAATTATTCTGAAGGGGCGG
TAATTAAAGCCGAAGGAATACTGCTGCAATGCCAGCGTGATGACAAAACCCTTAGCACTA
ATCCGCTGGTCTGGCGGCGCGTAAAGCCATAAACGCCTCTAATAATGGAATGTCAGCAGG
GGCCAGCGGATATTGCAGCGCCTCTTCAGGTGAGCACCAGACCAGCGCCTGATGTTCATG
TGCCTGTAACGTCCCGTGGAAGTCGGGTACGTGCCAGGCATGAAGATGGATAATCCGCCC
CGAAACTTCTCGCTGATGGCTGGCAACATATTCACCCACAGTTGCTTCGATGCCCAGTTC
TTCGCGTAACTCACGCACCAGCGCCTGCCGCTGACTTTCATCCGGCTCGACTTTACCACC
GGCAAACTCCCATAATCCCGCCTGATCGCTCTGGGCGGGGCGTTGCGCGAGTAAAATTTT
GCCATCACGTTCAATGATGGCGGCAACAACTTCAATCATTTTCATAAATTACACACGGGC
AGATAAGCGAAAAATGCCATAATATCCGCACTGTTGCTCAATCAGAAAGGCTTTATATTT
AAGGAGTGCCTGTGCTAGACCGCCATCTTCATCCCCGGATTAAACCGTTGTTGCATCAGT
GCGTGCGGGTTCTTGATAAACCGGGCATTACGCCAGATGGTTTAACATTAGTGGGATTTG
CCATCGGCGTGCTGGCTCTGCCGTTTCTGGCGCTGGGCTGGTATCTGGCGGCGCTAGTCG
TCATTTTGTTGAACAGGCTGCTTGATGGTCTGGACGGTGCGCTGGCGCGGCGCAGAGAGC
TTACCGACGCGGGCGGCTTTCTTGATATTTCTCTCGATTTTCTCTTTTACGCGCTGGTGC
CGTTTGGCTTTATTCTTGCTGCACCGGAGCAAAATGCGCTGGCAGGCGGCTGGTTGTTGT
TTGCGTTTATCGGCACGGGCAGCAGTTTTCTCGCCTTTGCTGCACTGGCAGCAAAACATC
AGATTGATAACCCCGGTTATGCACATAAGTCGTTTTACTATCTGGGGGGATTAACCGAAG
GCACAGAAACGATCTTACTGTTTGTGCTGGGATGTTTATTCCCTGCATGGTTTGCGTGGT
TTGCGTGGATCTTCGGTGCGTTGTGCTGGATGACGACCTTTACGCGGGTGTGGAGTGGGT
ATCTGACGCTGAAGTCGCTCCAGCGTCAGTAATTGCAATGTTATTTGCTACTGTCCGGGC
CGCGTTCACCGGTTGCTACCGGATTTTTTGGATCGCTGCTCCATTCGTACCAGCCGCCGT
CATACACGGAAACATTCTTCCAACCCATGGCGCGTGCGTACATAAAGGTTTCGGACGCGC
GCCAGCCGGTGCCGCAGTAGAATGAAACTTGCTGCTCTGGTTTGATATTCCACGCTTTCC
ACATAGCGGTAATATCATCGGCGCTGCGCATGGTGCCATCCGGGTTATGAAAATCTTCCA
TATGCGTCGAGTCGCTACCAGCGTGTCCCCAACGTGCGCCGGCTATTTCACCTTTTGGTT
TAATATAGCTGTAACCGCTGGTCGTACCGATAAATTCTGGCCACGAACGAATGCTCACCA
GCGATGCATCCTGGCGATGCAGCAGTCCACGGGCCTGTTCCATATCGAGCATCAACTGCG
GTTGTGCCGGGATCTTCACGCCGAAATCCGGTTCCGCTTTCACTTTCGGTGGCGTTCCGC
GCTCAACAGGCAGTCCCGCGTCGGACCAGGTTTGCCAGCCGCCATCCAGCAGGCGCACAT
CTTTCACGCCAGCATAAAGCATAATCTGCGCCACACGCGCTGCAGCGTATACGTCACGCC
CATACAGAATGACCGTGGTGTCATGGCGAATGCCGTGTTTTGCCAGCATCGCTTTTAGTT
GTTCATCAGAAACTTTGTTCCACAGCGGTTCACTTTCCACTTCGTTGGTATCGATGTAGT
CAGCGCCGGGAATATGGCTGATAAGGTAAAGCTTAGGAGCGCCCCAGGCCGCTTCAATGA
CTTTCCAGTCACCGGCAGGTTTCGCCGTAACCTCTTTACCTTGTTGCAGGTCGTGCAGCC
ATTGCGGATAAACCAGCTGCTCAAAATGCGGCAGTTTTTGCAGACGGGAAGGTTCGCTTA
GCGCGTCACTCAGGATGGAGATATGCGTTAAACCTGCTTTTTGCAGTCGCGTTTTGACGG
CGTCGACATCTTTGTCATTACCGTACAGCGCCACCGGAGCATCGGTTTTCAGGTTATGTT
GCTTGATCCACGCGTTGAGCTGTTCGGTGCTCATTTTGTCAAGCCAGCTGGCAGAGAGGT
TTAAGGCGGCAAGTTCATGACCAGAAGGGCCATTTAAGGTTTGTGGCCAGCCGTTATAAA
ACGCGCTGGGGCGAGTATCTATCGCTTTGCCATTTTGTTGTTGAAGCTGGTCAAGTGTAA
GAGGCTTCGCCAGTTCAGCGGCCCACGAAGAAGCGCAAGCCAGCCCTAAAGCCATTGCCA
GCGCGGTCATTTGAGAAACACGTTTCATCGAAAATCCCGACATTGTAGTTTTGAGTGCGC
CATTCTGAACTGACGCATTGAGAAAAACTTTGCGTTATCGCAGTTTGTTGTAATTTTCTG
ACCACTGCGCCATATCCAGAACAGAACTATCAGCAGGAACATCCTGGAGATCGTGCGTTA
CCTGAACGACGGGGATCGCCAGGGCGCGAACTTCGCTGAACACCCACTGGCGAAAATTAT
CGCGCAGAGCCACATCAAGACGGCTGAATGGCTCATCCAGGAGTAACGCTTTTGGTTGGG
CGAGAAGGGCGCGTAGTAGAGCAACGCGCGCTCGCTGACCGCCAGACAAAGTGGCAGGAT
CCTGATGGAAAGCTCCCTCAAGGCCTGAACGCTCAAGTGCATCATTCACGGCATTACGTC
GGGCATTCCCTTTAAGTGTCGCCGGTAGCGCCAGCAGTAAATTTTGCCCGACACTGAACT
GGTCAAATAACAGTGCATCCTGAAAAAGAATGCCAATCTGACGCTGTGCGGTGGGTAGGA
TGTCAATCCGTTGCTCATTGAGCCATAGCTCACCTGTACAAGAAAACTGTTCGGCCAGTG
CACCAATCATCCATGAAAACAGAGTGGATTTTCCACAGCCAGACGGCCCCATTAACGTGA
CAATGTCACCTTTATCCACCGTAAAGTTAACGTTTGTCAGCAAGCGGCTTTCTGGTAAAC
GTAGCGAAACATTTTTCACGCAGAGCATTAGCGGAGTCCTTGTCTGACATAACCTACCCA
TTTTGCGACTAACGCGGTCAGGGCAAAAATAATAAGCGGTAATAGCAGTTGCCATAAAGC
CTGGGCGGCGAGAATACCGTTGCTGCCGCCGCTGCTTAATGCCACCGCCTCAGTGGTGAG
CGTCGGAAAACGCCCCGCGCCCAGCCACAGCGTTGGCATATACTGCGCAATACCGACTGC
AAATCCCACCGCGAAGGCAATCAGCACAGGGCGCAACATGAGTGGGCATTTCACGTAAAA
GAAGATTTTGGCCCGCGACCAGCCCAGTGTTTGCGCAATCAAAATTAACCGTGAATCAAT
GCGCTGCCAGGCGGGTTGCAGGATAAACAGCATCCACGGCATCACCCACAGCAGATGCCC
CCAGACCACCGCCGTCCAGCTTCCATCCAGTTTCAGCCATAGCGCCAGCGTGTACTGGCC
CGCCACCAGTGGCAGAGCAGGTAATAAAATGGGCAACCATAGCCACAACTGGCGACGCTG
TGGCCCCCATTCCAGCCACAGCAGTAACAGGAGCAAAGCGATGAATGTCGCCACCAGCCC
CATTGTCAGGCTGTTGATGAGCGCTTCACTATTGATCGTCGACTGATCCGCGAGGATCGC
CAGCAGAACCACACACAGCACACCGGTTAAGGGTAAAAAAATCGCCAGCGTATTGCCCGG
CAATAAAGGCGTGGCAGGCTTGCGAACGCCATCTACGCGGGGAATAGTGCGCCGCCAGCT
GCGCCATAGCAGATAGCTCAGCAAAACGTAGGCGGCGAGTAACAGCATCAACAGCAGGCT
GGCAAGCGCGCCTTTTGTTTGTTGGTCAATGTCGCCCTGGGTTAACCACTGCCAGCTAAT
TACCGCCAGCGTCGGGGGATTACCTGGCCCGAGAATAATTGCCACATCCACGACCGACAG
CGACCAGGCAACAATCGCCAGCATCGCCATTGCCAGCGCAGGCGCGACGGAGGGCAACAG
CAGCCAGTTCAGGCATTGCCAGCGGCTGTAGCCCAGCGAATCCAGCACAATGACCTGCTG
CAACAGCCATTTTTCGCTCAATACTGCTGCTAAGATCCACAGCAGAAATGCGCTTTCTTT
CACTGCAAGGGTGAGGCCCAGACCGATGCCAAATCGGTCCATTGGCGGAGTGAAATACGG
GAAATAGTCATAAAGCAGCCCTCCGTCAGCAAAGAGCAGAAGGGCGCTGGTGGCAAAAGC
CACATGGGGAATGGCGAGCAGCCACGGCAGACGGGCGCACATACGCTGCCATTTCGGCCC
AGGCCACAGCGCCACAATCACCAGCAGGGCAATCAACAATGCCCCGACCGCCGCGATGGT
TGTCGACACCAGCGTTGCCAGTAATGCCTGCGGTAACTGTGGATCGGCAAATAACGCCTG
CCAGTGTGTCAACGACAAAGCAGGCGATATCAGCGTGAGAGCTGCCGGGATCAGCGGTGC
ATAAATCACCGCCACCATCGCCCACAGCAAAAAGATTAATGCGTACCGTAACGGTGTAGC
CATTCTTGTTCCAGCGCATTTACCCAACCTGCGTGCGGTTCAGCCAGTACCGGCGGCAGA
TCCTGCGGCATTCTTGATTGCAATGATTCGCGCTGCCCGTCAGGCAGTTTTTGCGGATCG
AGAACAGAAGGATCGCCCCAGACAGCGGGATCTGCTTTACGCAGTTGCGCATCGGGTGAG
AGCAGGAAATTGGCAACTACCTTCGCCGCAGCACTGGCATTCGCGTTGGCAGGAATGGTG
ACGAAATGCACGTTGCCAATCATCCCCTCGCGAAAGCCAAAACTGTAACTGCTTGCAGGC
AAATCGCCGCTGGCGATTTTTTGCTGCGCATGCGCGGGGTTAAAGGTCAGCGACAGGCGC
AATGTGCCGGCTTTCAGCAGAGCATCCATCCGCGCGGGTGAAGGCGGGAAATCCTTTCCT
TCGCGCCACAAATACGGATGCAGCACATCAAGATATTGCCACAAGGGAGCAGTGACACGG
GCGAAAGTCGCATCGTCCGGCGCTTCTTTTAATGCGGCGGGATCGGGCGTCAGCATAATC
AGCAACTGTTCAAGAAACGCCGTGCCGGTAAAGTCCGGTGGGCGCGGATAGGTAACCGTG
CCGGGATTGGCTTTAGCAAACTCCAGTAAGGCTTGCGGCGTTTGTGGTGGCTGTGGCGTA
ACATCGCGGCGGGCGATAAACGTCAGTTGTGCGCCGCCCCAGGGCGATTCCGCACCTTGT
GTCGGCACAGAAAAATCTTCCCGCACCGGCAGCTGTGTGTCGACATAGCGCCAGTTGGGC
AGAGTCTCCGCCCAGCCCGTTTGTAATAAATTGGCCTCTTTTAAGGTGCGGAAGTTTTCG
CCGTTCACCCAGAGCAGATCCACCGAGCCGCCCGTTTTACGTCCGGCTGCGGCTTCGGTC
TGAATGCGCTTCACCGCGTCTGCGGCATCCGCCAGACGGACAATCTTCAGGTTTATAGCG
TAATGGGTTTTCATCTCGCCGCTCACCCAGTCGAGATAGCGGTTAATTGCGGTATCGCCG
CCCCAGGCGTTAAACCAGACGGTTTGCCCTTTGGCCTCATTTTTAATTTCTTGCCAGTCA
CTGGCATGTGTTGCCAGAGAAAACAGCGATAACAATCCCAGCAACCACCCACAATGGCGC
ATCATCTCTCCTTAAGAACGTTTTTCAGGAATACGGCACAGCCCCTGAGCGGGAATGTCC
ATGGCAGAATTAAAACGGGCTGACAGATTTTGCAGGCCGATCAATGCCGTCAGTTCGGTG
AGCGCCTGAGCGTCAAAATGCGCAGCCAGTCGGGTACGCAGGGCATCATCGACCGTTGGC
GGCGTTACGCTTGCGGCTTCGGCGTACTCCAGCGCCAGCCGTTCTTCATCGCTAAAGAGC
GGGCTTTGCCGCCAGTCAGCCACTGCCAGCAGTTTATCGCTGCTGCCGGTGCGCTCGGCG
ACTTTCATACTGGTGATATCCACACAAAACTCACACAGGCACATTTGCGCAATGCGCGCG
CTGACAAGCGATCGTACTACCGGATCGAGCGGTGAGCGTTTGCGCTCCAGCCAGCCAACA
AACATCGACACCAGATAAAAGATAAACGGGATCCGCCCCCACCAGCGAATGGGGCTTAGC
ACCTCGCCGTAATGGCGACGATGCAGCCACGCCTGTGGACGTAAAATTAAAGGAATTTTG
CTAAGCGGCGGTAAACCCATCAGGCATTCCTCTTCTGGCGTTCAAGCCATATTTTCTTCG
CCATAAAAATCACCACGGTCAGGGCAAACAGAATAAACAGTCCGGTGACAAACCAGAAAG
TACCGCCTGTTAACATGCTGCCCGCCCAGGAATAAACAATAGTTGCCGGTAACTGACCAA
GCCCGGTGGCGATAAAAAACGAGCGAAAACGTATTGAAGTCAAACCGGCAGCATAGCTGA
TTGGATCGAAAGGGACAAAAGGCAATAACCGACAGACCAGAATGGTGTGTTTGCCGTAGC
GAGTGAAAAAGCCGTCCATACTGTCAAGCACGGTTTTGCCGGTTAATTTTTCCACCACTT
CGCGGCCCATCACTCTGGCGATAAAAAAGCACAGCGCCGCGCCGGCCATCGAACTGGTCC
ACGACAGCAAGCCGCCCCAGAACGCGCCAAACAGCGACGCATTGGCAAAGGTGATCAAAA
ACGCAGGTAGCGGTGCAGCAATGGCCTGCAAAATCATCAACAAGAACGAGACAACTGCCG
CCAGTGCGCCGTAAGACTGAATAAAGCGTTCTATACCCTGTTGGTCCACGGCGGCAAACG
CCGCAACGCTGCGATTGATAAACTCATGGACGCCGGGAAGCAGCGCCCATGCCAGCAGCA
TAGCGAACAACAGGATGATGAGGGTTATACGGTAGTACCAGATTTTTCGCGATTGCATCA
TCATCATCCTTTATCCTGGCTTTATTCGGCGATTTTAAAGGTAACCGTTGCCAGCGTGTT
ATCCGCCGGGAGAACTGAGGCATTGCCTTTGAATTTAACTTCACCACGTTTTTCAACCGC
ACCATAAGTGTATGTTGCATTGCTGACGATGCCGACCGGGCAGCTATCCAGACACACCAG
GCAACCCGTTTTCTTCTCTTCTGCTGCCGTTAAATTACCGCCAAAGCGCATGTCCAGTTT
CTTGCCATTACTGTCAACAATCACTTCATCGAAGGAATACGCTTTTGCCGCCCCTTGCCA
GTTGACCGAAATATCCAGTTTGCTGCCTGTGACATGAGTCGTTTCTTTATTATCCATCGT
CATGTTTTCGCCCGGCGTACCACCTGCCTCTTTCAGGGCTTCATAAAATGCTTTCGGGGT
CGCATAACCCATAAACAGCGATTTATGTCCGTTGGAGCCATCTTTAAACACAATACCGTG
ACGAGTGTCGTCGGTGAGGAAACGACCATTAATTTGCACCAGCATGGTTACCGTATGGTT
ATTGGCATCGACACGCAGCGGTTGGCTGTTCGAAAGTCCGTCGTATTCCACTTTTGCCGC
CGCATTCTCTTGTTGATCGCAGCCGCTAAGCCCAGCAACAGCCAGTAAACAGAGTGCAGC
CAGTCCTTTTTTCCATGACACTGAATAATGTTGCAACATCGTTCTATCCTTCATTTTTTG
GGTGAGTAAGTGGGCTGCGGCGCGAAGCAGACAGATCCACATGTTTGTGTCGGGCGTAGA
GTTTTGCGAGCTGGACGAGAATAAACAGCGCCAGGCCCGCCAGACAGAGTTGTAAAATAA
AGCGCAGCGTAATGCCTTCATTGGCGAGATCGCTTGCCATCACGGTATAAATAACAATAC
CGGGTAGGGTCGTGAGTGCCGAAATAAGGGTATAAGGCCAGAAGGCGATTGTGGTTAATC
CGTAAGCGTAATTTTGAATATTGTAAGGAAACAACGGGATTAAGCGGGTCAGAATAAGAA
AATCAATACCGTTACGCGCAATGCCTTTTTCAATGGCCTGGAAGGTATTGCTATGGCCAA
CGTATTTCAGCAGTAAATCACGTCCCAGCCAGCGCGCCAGCAGGAATGAGCACGAGGAGG
CCAGCGTGGCGGCAATTAATGAGAGTAGTGTCCCTAAGAGCGGGCCAAAAACTATTCCTC
CCGCGATCACCAGTATGCTTCCTGGTAACAGCAAGAGGGTGGCAATGATGAATAACAGAA
TATAGAGGCTATAGCCGAAAAATCCGCTCTGGCGGATGAGTGTCTGTAAGTGGGGTAAAT
CGGTGAGCAGATCGAATAAACCGAAAGCGTGGATAGCGTAAATGACCAGCGCAAAAATAA
GACAGGCAAAAAGAAATTTACGCTCAGCGTTCATCGTGGAGTTTCCTATATCAAACTTGA
TAATAGAGAAGTGGTCAGACAACTAAAAACGCAGAGACGGTATAACAAAGGACGGCAGGC
AACAAATCATTACTGACAGTTTGTTGATTTTTCTCAAGGTTAATTCTCCTGACCCAGTTT
GAGCCAGGAGAGCTGCTAAATTAGCGGCGGAAGGTCGCCCAGACGGGGGCGTGATCGGAC
GGTTTTTCCATGCTGCGGATTTCATAGTCGATGCCGGTTTCTACGCAACATTCTGCCAGC
GGTTGGCTGGCGAGCAGCAGGTCGATGCGCAGACCACGGTTATCGTCAAAACCTTTTGAG
CGGTAATCAAACCATGAGAAACGATCTGCTGTTTGCGGATTCGCATGGCGGAAGGTATCG
ACCAACCCCCAGCTCATCAGCCTGTCCATCCATTCGCGCTCTTCCGGCAGGAAAGAGCAT
TTACCGGTACGCAGCCAGCGCTTACGGTTTTCTTCGCCAATGCCGATATCCAGATCTGTA
GGGCTGATATTCATATCGCCCATAATCAGTACCGGATTATCACGTTTGAGTTCGGTTTCC
AGGTAGTTTTGCAGATTCTGATAAAACTGCGCTTTTGCCGGGAATTTTATCGGATGGTCG
CGGCTTTCACCCTGCGGGAAGTAACCGTTGATCACGGTGACATTACCCAGCAGTGAGGGG
ATTTCCGCCATAATAATCCGCCGCTGCGCCTCTTCGTCGTCACCGGGAAAGCCGCGACGC
ACGGCAATCGGCGTCTCTTTGGTCAGCAGCGCCACGCCATAATGGCCTTTCTGCCCGTGA
TAAAACACGTTGTAGCCGAGCTTCGCCACCTCTTCGAGCGGAAACATATCGTCATGAACT
TTTGTCTCCTGCAGGCCAATCACATCCGGTTGGTGCTTTTCGACGATGGCTTCAAGCTGG
TGAGGTCTGGCGCGCAGGCCGTTGATATTAAAAGAGACAAATTTCATAGTCGCTGCCATT
TATTCAGATAAAGAGTGCGTGGATGGTAGCAGAATTTCGCGTTGCTTACCGCCTGTTGTT
AAGTGATTTGATCGATGGTTGTTAATGATGTCAACGATGGCGCAAAAAATGCCCGCTTTT
GGTGCGCGCTGCGTCAGAATGGCGCAGTAATTTCCAGTAAATTTCGTCAATGATCACAAT
TCCAGAATTATATTTTACTTCTGCATAACATTGCGTTTTTTATTCTTTTTATTCACCCAC
ATCGCAAACGTATTCACTTTATATGCACTTTAAATGCATATGGTTTGGTTATAACTCCTT
GATTTCCAGTTAGCCTCCGCCGTTTATGCACTTTTATCACTGGCTGGCACGAACCCTGCA
ATCTACATTTACAGCGCAAACATTACTTATTATTAACATATAAATAACGAATTATTTACT
GTAGAGGTCGCTATGTCTCAGCCAATTACGCGTGAAAACTTTGATGAATGGATGATACCT
GTTTACGCTCCGGCACCCTTTATACCGGTACGTGGCGAAGGTTCGCGCTTGTGGGATCAG
CAGGGGAAAGAGTATATCGACTTCGCGGGTGGCATTGCGGTGAACGCGCTGGGCCATGCG
CATCCGGAACTGCGTGAAGCGCTGAACGAACAGGCGAGTAAGTTCTGGCATACCGGCAAC
GGTTACACCAACGAGCCGGTACTGCGACTGGCGAAAAAATTGATCGACGCCACGTTTGCC
GATCGCGTCTTCTTTTGTAACTCCGGTGCGGAAGCCAACGAAGCGGCGCTAAAACTGGCG
CGTAAATTCGCTCACGACCGCTACGGCAGCCATAAGAGCGGCATCGTGGCGTTCAAAAAT
GCGTTTCATGGTCGCACGCTGTTTACTGTCAGTGCGGGTGGGCAGCCAGCCTATTCACAG
GATTTTGCGCCACTGCCGGCGGATATTCGTCATGCTGCATATAACGATATTAACTCTGCC
AGCGCGCTGATTGACGACTCTACCTGTGCGGTGATTGTCGAACCCATCCAGGGGGAAGGC
GGTGTGGTGCCAGCCAGCAACGCGTTTTTACAAGGTCTGCGTGAATTGTGTAACCGCCAC
AATGCGCTGTTGATTTTTGATGAAGTACAAACCGGCGTCGGGCGCACCGGGGAACTGTAT
GCCTATATGCACTACGGCGTGACGCCTGATCTGTTAACTACCGCCAAAGCGCTGGGCGGC
GGTTTCCCGGTCGGTGCGTTGTTGGCAACCGAAGAGTGCGCCCGCGTGATGACCGTTGGC
ACTCATGGCACCACCTATGGCGGTAATCCGCTGGCCTCGGCGGTGGCAGGCAAAGTGCTG
GAGCTCATCAACACACCAGAGATGCTTAATGGCGTTAAACAGCGTCACGACTGGTTTGTT
GAGCGTCTTAATACTATTAATCACCGCTATGGTTTGTTCAGTGAAGTTCGCGGCTTAGGT
TTGCTGATTGGCTGTGTACTGAATGCCGATTACGCCGGGCAAGCGAAACAGATCTCTCAG
GAAGCGGCGAAAGCAGGCGTGATGGTACTGATTGCGGGTGGCAACGTGGTGCGTTTTGCG
CCTGCGCTCAATGTCAGCGAAGAAGAGGTGACGACCGGACTGGATCGCTTTGCAGCTGCT
TGCGAACACTTTGTTAGCCGAGGTTCATCATGATGGTCATCCGTCCCGTTGAGCGATCAG
ATGTCTCGGCGCTGATGCAGCTTGCCAGCAAAACGGGCGGCGGCCTGACGTCGCTTCCCG
CCAATGAAGCCACGCTTTCGGCGCGTATCGAAAGGGCAATCAAAACCTGGCAAGGCGAAC
TGCCCAAAAGTGAGCAGGGCTATGTGTTCGTGCTGGAAGATAGCGAGACAGGCACCGTGG
CGGGGATTTGTGCCATTGAGGTGGCGGTTGGGCTGAACGATCCCTGGTACAACTATCGCG
TCGGCACGTTGGTTCACGCCTCAAAAGAGCTGAATGTCTATAACGCATTGCCGACGCTGT
TTCTCAGTAACGATCACACCGGCAGCAGCGAGCTGTGCACGCTGTTTCTCGACCCGGACT
GGCGCAAAGAGGGCAACGGCTATTTGCTGTCGAAATCGCGCTTTATGTTTATGGCGGCTT
TTCGCGACAAGTTTAATGACAAAGTGGTTGCTGAAATGCGCGGGGTGATTGACGAACACG
GCTATTCACCGTTCTGGCAAAGCCTCGGTAAACGCTTCTTTTCGATGGATTTTAGCCGCG
CCGATTTTCTCTGCGGCACCGGGCAAAAGGCATTTATTGCAGAACTGATGCCGAAACATC
CGATCTATACCCACTTTTTATCCCAGGAAGCCCAGGACGTCATCGGTCAGGTACATCCGC
AAACCGCGCCTGCCCGCGCGGTGCTGGAGAAAGAAGGTTTTCGCTACCGTAACTATATCG
ACATCTTTGACGGTGGGCCGACGCTTGAGTGTGACATCGACCGCGTGCGCGCCATCCGTA
AAAGTCGGCTGGTGGAAGTGGCAGAAGGGCAGCCTGCGCAGGGCGATTTCCCAGCCTGCC
TGGTCGCCAATGAAAATTATCACCATTTCCGCGTGGTGCTGGTGCGTACCGATCCGGCAA
CCGAGCGTTTGATTTTAACCGCCGCACAACTGGATGCCCTCAAATGCCACGCCGGGGATC
GCGTTCGTCTGGTGCGCCTGTGCGCAGAGGAGAAAACAGCATGACTTTATGGATTAACGG
TGACTGGATAACGGGCCAGGGCGCATCGCGTGTGAAGCGTAATCCGGTATCGGGCGAGGT
GTTATGGCAAGGCAATGATGCCGATGCCGCTCAGGTCGAGCAGGCTTGTCGGGCAGCCCG
TGCGGCGTTTCCGCGCTGGGCGCGGCTTTCATTTGCTGAACGTCATGCCGTTGTCGAACG
CTTTGCCGCACTGCTGGAAAGCAATAAAGCCGAATTAACCGCGATTATTGCCAGAGAAAC
GGGTAAGCCGCGCTGGGAAGCGGCAACCGAAGTGACGGCGATGATCAATAAAATCGCGAT
ATCAATTAAGGCGTATCACGTTCGTACCGGCGAGCAGCGTAGTGAAATGCCGGACGGCGC
GGCGAGCCTGCGACATCGCCCGCACGGCGTGCTGGCGGTGTTTGGGCCGTATAATTTCCC
TGGTCATTTGCCGAACGGACATATCGTTCCGGCATTGCTGGCAGGTAACACCATTATCTT
TAAACCCAGCGAACTGACACCGTGGAGTGGCGAAGCGGTAATGCGTTTATGGCAGCAGGC
TGGCTTGCCGCCAGGCGTGCTGAACCTGGTGCAGGGCGGGCGTGAAACGGGTCAGGCGCT
GAGTGCGCTGGAGGATCTCGACGGTTTGCTGTTTACCGGTAGCGCCAATACAGGCTACCA
GTTGCATCGCCAGCTCTCCGGTCAGCCGGAGAAAATTCTCGCCCTTGAGATGGGCGGTAA
TAATCCGCTAATTATCGATGAGGTGGCGGATATCGACGCGGCTGTCCATCTGACCATTCA
GTCGGCGTTTGTCACAGCCGGTCAACGCTGCACCTGCGCCCGCCGTTTATTGCTGAAAAG
CGGGGCGCAGGGCGATGCGTTTCTTGCTCGTCTGGTTGCCGTCAGCCAGCGATTAACGCC
GGGCAACTGGGATGACGAACCGCAGCCGTTTATTGGCGGGCTGATTTCTGAACAGGCCGC
ACAGCAGGTGGTTACTGCATGGCAGCAACTGGAAGCGATGGGCGGACGACCCCTGCTTGC
GCCGCGCTTATTACAAGCAGGGACATCGTTGCTGACGCCGGGGATCATTGAAATGACAGG
CGTTGCTGGCGTACCAGATGAAGAGGTGTTCGGACCGTTATTGCGCGTCTGGCGTTATGA
TACTTTCGATGAAGCGATTCGAATGGCGAATAACACTCGCTTCGGACTCTCTTGCGGTCT
GGTTTCCCCCGAGCGGGAAAAGTTCGATCAACTGTTGCTGGAGGCGCGGGCGGGGATTGT
TAACTGGAACAAACCGCTTACCGGTGCTGCCAGTACCGCGCCATTCGGCGGCATTGGTGC
TTCCGGTAACCATCGCCCCAGCGCCTGGTATGCCGCAGATTACTGCGCATGGCCGATGGC
GAGCCTGGAGTCGGACTCGTTAACATTGCCCGCCACGCTTAACCCCGGGCTGGATTTTTC
CGATGAGGTGGTGCGATGAACGCCTGGGAAGTCAATTTCGACGGGCTGGTAGGGCTGACG
CATCATTACGCGGGCCTGTCGTTTGGTAATGAAGCCTCTACCCGTCACCGTTTTCAGGTG
TCTAACCCGCGACTGGCGGCGAAGCAGGGCTTACTGAAAATGAAAGCCCTTGCCGATGCG
GGATTCCCCCAGGCCGTGATCCCGCCGCACGAGCGTCCGTTTATTCCGGTGCTGCGTCAG
TTGGGATTCAGTGGTAGCGATGAGCAGGTACTGGAAAAAGTTGCACGCCAGGCACCGCAC
TGGCTTTCCAGCGTCAGTTCCGCTTCGCCAATGTGGGTAGCCAATGCGGCAACGATCGCG
CCATCTGCCGATACGCTGGATGGCAAAGTGCATCTCACCGTTGCCAACCTGAACAATAAA
TTTCACCGTTCGCTGGAAGCGCCCGTCACTGAATCGCTGTTAAAAGCGATTTTTAACGAC
GAAGAGAAATTTAGCGTCCATTCGGCGTTGCCACAGGTAGCGTTGCTCGGTGATGAGGGG
GCGGCAAACCACAATCGTCTCGGCGGTCATTACGGTGAACCGGGTATGCAACTTTTTGTC
TACGGGCGAGAAGAAGGCAATGATACCCGGCCTTCCCGTTATCCGGCGCGACAGACTCGC
GAAGCCAGCGAGGCGGTGGCAAGGCTGAATCAGGTGAATCCCCAACAGGTGATTTTCGCC
CAGCAAAACCCGGACGTTATCGACCAGGGCGTTTTTCATAATGACGTGATTGCCGTGAGT
AACCGCCAGGTGCTGTTTTGCCACCAACAGGCGTTCGCTCGCCAGTCACAGTTACTGGCA
AACCTGCGTGCGCGGGTCAATGGTTTTATGGCGATAGAAGTTCCGGCAACTCAGGTTTCC
GTGTCTGATACGGTGTCTACCTATCTGTTTAACAGCCAACTGCTGAGCCGCGATGATGGT
TCCATGATGTTGGTGCTGCCTCAGGAGTGTCGGGAACACGCCGGAGTATGGGGTTATCTC
AATGAACTCCTTGCCGCTGACAACCCGATTAGCGAACTAAAAGTCTTTGATTTACGTGAA
AGCATGGCGAATGGCGGCGGCCCGGCGTGCCTGCGGTTGCGGGTGGTATTGACAGAAGAA
GAACGCCGGGCGGTGAATCCGGCGGTGATGATGAACGATACGCTGTTTAATGCGCTCAAT
GACTGGGTGGATCGTTACTACCGCGATCGCCTTACTGCTGCCGATCTGGCCGACCCGCAA
TTGCTGCGCGAAGGGCGGGAAGCACTGGATGTATTGAGCCAATTACTGAATCTCGGTTCG
GTTTATCCGTTCCAGCGCGAGGGAGGGGGCAATGGATAATTTTCTTGCTCTGACCTTAAC
GGGTAAAAAACCGGTTATCACCGAGCGAGAAATCAACGGCGTTCGCTGGCGCTGGCTGGG
CGATGGTGTGCTGGAACTGACGCCATTAACGCCACCGCAAGGCGCACTGGTGATTTCAGC
GGGAATACACGGTAATGAGACGGCACCTGTGGAGATGCTGGACGCGTTGCTTGGCGCGAT
ATCTCACGGCGAGATCCCGTTACGTTGGCGGTTGCTGGTGATCCTCGGGAATCCTCCTGC
GCTGAAGCAAGGGAAACGTTATTGCCATAGCGATATGAATCGAATGTTTGGCGGTCGTTG
GCAGCTATTTGCTGAAAGCGGAGAAACCTGTCGGGCGCGCGAACTGGAACAGTGCCTGGA
AGATTTTTATGACCAGGGCAAAGAATCTGTGCGCTGGCACCTTGATCTACATACCGCAAT
TCGTGGCTCCTTGCATCCGCAGTTCGGTGTATTACCGCAACGCGACATTCCCTGGGACGA
GAAATTTCTGACGTGGCTGGGTGCGGCGGGGCTGGAGGCGCTGGTGTTCCATCAGGAACC
TGGTGGTACGTTTACCCATTTCAGCGCCAGACATTTTGGCGCGCTGGCCTGTACGCTGGA
ACTTGGCAAAGCGTTGCCCTTTGGGCAAAACGATCTTCGCCAGTTTGCAGTAACTGCCAG
CGCAATTGCTGCGCTGCTATCTGGTGAGAGTGTCGGTATCGTGAGAACACCGCCGCTCCG
TTATCGGGTGGTTTCGCAAATTACTCGCCACTCGCCGTCCTTCGAAATGCATATGGCAAG
TGACACGCTGAATTTTATGCCGTTTGAGAAAGGAACATTGCTGGCGCAGGACGGAGAGGA
ACGTTTTACCGTAACCCATGATGTAGAGTATGTGTTATTCCCTAATCCGTTGGTAGCGTT
GGGATTACGCGCGGGATTAATGCTCGAAAAAATAAGCTAATACTTACCCGCAGAAATCAT
TCTGCGGGTATTAAGTTGCTTTCTTATAAATTAATACAGATTAATCCTGGTTATTTGCTT
TATTTATCACCAGTCATCCGGTATAGTTCTTCATAATCTCTGCAAAATCATCGTGTTGTA
ATATTCTCTCATCACTCTCCATCAAATTTTCTTTTTTTCTCCATAATTGGCGCAAAAGTG
TTTTTTACACTTTCATTGTTTTACCGTTGCTCTGATTAATTGACGCTAAAGTCAGTAAAG
TTAATCTCGTCAACACGGCACGCTACTTAAGAAAGCCGTAATAAATAACTGAAAGGAAGG
ATATAGAATATGCGTAAATTAACTGCACTGTTTGTTGCCTCTACCCTGGCTCTTGGCGCG
GCTAACCTGGCCCATGCCGCAGACACCACTACCGCAGCACCGGCTGACGCGAAGCCGATG
ATGCACCACAAAGGCAAGTTCGGTCCGCATCAGGACATGATGTTCAAAGACCTGAACCTG
ACCGACGCGCAGAAACAGCAGATCCGCGAAATCATGAAAGGCCAGCGTGACCAGATGAAA
CGTCCGCCGCTGGAAGAACGCCGCGCAATGCATGACATCATTGCCAGCGATACCTTCGAT
AAAGTAAAAGCTGAAGCGCAGATCGCAAAAATGGAAGAACAGCGCAAAGCTAACATGCTG
GCGCACATGGAAACCCAGAACAAAATTTACAACATCCTGACGCCGGAACAGAAAAAGCAA
TTTAATGCTAATTTTGAGAAGCGTCTGACAGAACGTCCAGCGGCAAAAGGTAAAATGCCT
GCAACTGCTGAATAATCTTTCAGCCAAAAAACTTAAGACCGCCGGTCTTGTCCACTACCT
TGCAGTAATGCGGTGGACAGGATCGGCGGTTTTCTTTTCTCTTCTCAAACAGTTGTAAAA
AAAGCCTGATCACCACTAACGTAAATCACCCGAGTTGCCGATAACCATCCACGGTTACCT
GAACGATAACAATGAAAAGAACGGGCCGGGAGCGAGTATGGAATACTTTGATATGCGTAA
AATGTCGGTGAATCTGTGGCGAAATGCTGCCGGTGAAACGCGCGAAATTTGCACGTTCCC
ACCGGCAAAACGTGATTTTTACTGGCGTGCCAGCATTGCATCCATCGCGGCGAATGGGGA
GTTTTCTTTGTTTCCCGGCATGGAAAGGATAGTGACGTTGCTGGAAGGCGGCGAGATGCT
CCTTGAAAGCGCAGACCGCTTTAACCATACCTTAAAACCGTTCCAGCCTTTTGCCTTTGC
AGCGGACCAGGTGGTAAAAGCGAAACTGACGGCAGGGCAGATGTCGATGGATTTCAACAT
CATGACACGCCTGGATGTCTGTAAGGCGAAAGTCAGAATTGCCGAACGTACGTTTACTAC
CTTTGGCTCACGCGGCGGGGTGGTGTTTGTGATTAACGGGGCGTGGCAACTGGGCGATAA
ATTGCTCACTACCGACCAGGGCGCGTGCTGGTTCGATGGCAGGCACACCCTGCGGCTTTT
ACAACCGCAAGGTAAACTGTTGTTCAGTGAAATCAACTGGCTCGCTGGTCATTCGCCGGA
TCAAGTTCAGTAATTTCATAGTTACCGGAAAGCAGCGGCTTACAAAGAATTTTATAACCG
TCGTGATCAAACCCGGCGGGTGTCCGAATTAACGTTGTCGCTTCTTCCAGCGAATTAACC
GCCCCCAGCCACAGCCAGTTTTGAATAATATGATATTGAGTCATTTCCGGGTGCTGTTCT
TTCAGCGCCACCGCCCCTTGCCAAGGCCAACACACCACCCGCAAACGCTCCAGAGACTGG
CGCAAGCGTAGCGCATGTTCCTCATGGCTCTCTTTACCGCAGCATGCTCCGGCGCAACGT
TTTAGCGCTGAACGAAAACATGCACGACCGCGACTTAACGGTTCCAGTCCCAGCAGGCCA
TAACAAAGTTTTTGTTCATCAGCGATGGTCTGCAATGCTTGCAAAGCTGCGCGCCTATTG
GCAAACAGGCCAAACAGGTTGGGGGCTCGTGAAAAATCCACCTCTTTGGCATACACCACA
TCGACGCGCTTTTCATTTAATTGCAGGGCACAGAGCTGGCGATTGCGGCGCAACCGTTTA
TTAAACAGCGGCTGTTGTTCTTTGATTAATCGCGCTTCAAGGAGCAGAGCGCCGATTTCA
CCGGCGGTACATATCCAGCTGATCCGTCGGGATTGCCGTAGCATGGCGGCTTCATCCGGG
GTACGTAAATGAGAAAGGACGCGGCTGCGGATGTTAACGCTTTTGCCGATATAGAGCGGC
ATGGTGTCACTTTCACCATGAAACAGATACACCCCTGGTCGGGTGGGTAAGTCATTAAGG
AATGAACGTAAATGTTCGGGATATTCATAAATTGCCGCAGCTTCAAATTCGAGCCGCGGA
GAAGTTAAACGCCGTACCACTGTTGACTCCGAATGCTGGTTATCTATCCAGTGTAACAGG
CGGGAAGCGATTAAAAAAGAGGCGGGTCGATGACAAAGGTTACACCGTCTGACGTGCTAC
GCCTGTCAGGCCTATTCGACTCCTGCAATGTATTGAATTTGCATAGTTTTATAGGTCGAA
TAAGGCGTTCACGCCGCATCCGGCGTGAACAAATTACTCTTTTTCGCACAATCCAATATG
TGCAAATTATTACTTTTTCCAGAAATCATCGAAAACGGTAATTGGCGGACGGCGTTTATG
TTCGGTTTTCAGATACCAGTTCTCTATTGTTCTGGCGACCTGTTGAGGTACGTTTTTCCC
TTCCAGATAGTCGTCGATATTGTCATAGGTCACGCCGAGTGCCACTTCATCTGGCAGAGA
AGGGCGATCATCTTCCAGATCGGCCGTTGGCGCTTTCTTATAAAGGTGTTCCGGGCAAGC
TAATGCCGCCAGTAACTGTTTACCCTGACGTTTGTTGAGACGATACAGCGGATTAATGTC
CGTACCGCCGTCACCATATTTAGTGAAGAATCCGGTAATGGCTTCTGCTGCATGATCGGT
GCCCACCACGACACCGCTGGTCATACCCGCAATGCTATATTGTGCTTTCATCCGCTCACG
CGCTTTTTCATTGCCACGGACAAAATCGCTCAGTTCAATGCCTGCTTCCCGCAATGCCTG
TTCGCTGGCCAATACCGCGCCCTTGATATTAACGGTTAATACGCGATCCGGTTGAATAAA
GGCAATGGCATCCTGGCAATCTTGTTCGTCGGCCTGAACACCATAGGGCAGGCGTACGGC
AATAAATTGCAGTGATTCGTTGCCGGTTTCCAGGCGCAGCTCATTAATCGCCATCTGGCA
CAGCTTTCCGGCAAGCGTGGAGTCCTGACCGCCGCTGATCCCGAGCACCAGTGATTTAAT
GAACGGATAAGTTTGCAGGTAGCTTTTCAGAAAATCGACACTACGACGAATTTCCTCTTC
AGCATTAATCTGCGGTTTTGCGCCCAGCGCCTTTATTATTTGTTGTTGCAATGTCATTGA
ACCCCTCCAGACAGAAAAGACAAAACTTCCTTAAAGCTAACCCGTTGCTACTGAAACGAC
AAGCGACAGCGGGCTGAATGGTGGTTAAAACGTCATACAGGAATCCTCTGAAAGCGGAGC
CGTTTCGTTCACGGGCTTGAAAAAGCGCCCAATGTATTCCAGGCTTATCTAACACGCTGA
TAAACAAGAGGACGGAATATGAACAAGAATATGGCAGGAATTCTGAGTGCAGCGGCGGTA
TTAACCATGCTGGCGGGTTGTACGGCTTATGATCGTACCAAAGACCAGTTTGTACAGCCT
GTGGTGAAAGACGTCAAAAAAGGCATGAGCCGGGCGCAGGTTGCACAAATTGCGGGTAAA
CCTTCGTCTGAAGTGAGCATGATCCATGCTCGCGGTACTTGCCAGACCTACATCCTGGGT
CAACGTGATGGTAAAGCAGAAACCTACTTTGTCGCGTTAGATGATACCGGACATGTCATC
AACTCCGGTTATCAGACCTGTGCTGAATACGACACTGATCCACAGGCTGCGAAGTAATCA
ATTCGTCTGAAAGCTTGAGTAACAACGGAAACCGGCCATTGCGCCGGTTTTTTTTGGCCT
GAGTTCTTAATTATCTTCGCGAATTATTTGCCCGAAATGTGAAGAGGGTCATAACCACAG
GTCAAGGAGAAACAATTTATAAGGTCAAAGAAATACTATTGCTCAGGTCTATACCGTATA
CTCCTTTCAGCCACAAAAAAAGTCATGTTGGTTTCGCAAGTTACCCAGAGCATGGAAGCA
GGTTAAGGCTTGCGGAGTGTCTGGCTGACAGATAATCGTCGATGAGGGCAGTTTTATGGA
AAAGAAACACATTTATCTGTTTTGTTCTGCGGGCATGTCTACCTCTTTACTGGTATCAAA
AATGCGCGCACAGGCAGAAAAATATGAAGTTCCGGTCATTATTGAAGCATTTCCGGAAAC
ACTGGCTGGTGAAAAAGGTCAGAATGCCGATGTCGTGTTATTAGGGCCGCAGATTGCTTA
TATGTTGCCCGAAATCCAGCGTTTGTTACCCAACAAACCGGTTGAAGTAATTGACTCGCT
GCTTTATGGCAAAGTCGATGGTTTAGGCGTGCTTAAGGCTGCGGTTGCAGCGATTAAAAA
AGCCGCAGCAAATTAATTTATTTTAAATTTTCCCGTCAAAGAGTTATTTCATAAATCAAT
ACCGCAATATTTAAATTGCGGTTTTTAAGGGTATTTTTCTATGAGTAATGTTATTGCATC
GCTTGAAAAGGTACTCCTCCCTTTTGCAGTTAAAATAGGAAAGCAGCCACACGTTAATGC
AATCAAAAATGGCTTTATTCGCTTAATGCCGTTAACCCTTGCGGGGGCCATGTTTGTATT
AATTAACAACGTTTTTCTAAGCTTTGGGGAGGGGTCGTTTTTTTATTCCTTAGGTATTCG
CCTCGACGCCTCAACCATTGAAACACTTAATGGTCTGAAAGGTATTGGCGGCAACGTATA
TAACGGAACATTAGGAATAATGTCTTTAATGGCACCGTTCTTTATTGGCATGGCGCTGGC
AGAAGAGCGTAAAGTCGATGCGCTGGCGGCTGGGTTGTTATCCGTTGCAGCATTTATGAC
CGTCACCCCATATAGTGTCGGTGAGGCCTATGCGGTTGGTGCAAACTGGTTAGGTGGGGC
GAATATCATCTCCGGGATTATTATTGGCCTGGTGGTGGCAGAAATGTTTACCTTTATTGT
CCGCCGCAATTGGGTCATTAAACTGCCCGACAGCGTACCTGCTTCAGTATCGCGTTCCTT
CTCGGCATTAATTCCCGGCTTTATTATTCTTTCCGTGATGGGGATTATTGCCTGGGCGTT
GAATACCTGGGGCACCAACTTCCATCAGATCATTATGGATACCATCTCAACCCCACTGGC
ATCGTTGGGTAGCGTGGTGGGCTGGGCCTATGTGATCTTTGTTCCACTGCTCTGGTTCTT
CGGTATTCATGGCGCGCTGGCGCTGACCGCACTGGACAACGGCATTATGACGCCGTGGGC
ACTGGAAAATATCGCGACCTATCAGCAATATGGTTCCGTCGAAGCGGCGCTGGCAGCCGG
TAAGACCTTCCATATCTGGGCCAAGCCGATGCTGGACTCCTTTATTTTCCTTGGGGGCAG
TGGTGCGACTTTAGGCCTGATCCTGGCTATCTTTATCGCCTCTCGCCGTGCTGATTATCG
TCAGGTGGCAAAACTGGCGCTGCCGTCCGGCATCTTCCAGATTAACGAACCGATTCTGTT
TGGTCTGCCAATTATCATGAACCCGGTGATGTTTATCCCGTTTGTACTGGTACAACCGAT
TCTGGCGGCAATCACCCTCGCAGCGTACTACATGGGCATTATTCCTCCGGTGACCAATAT
TGCACCGTGGACCATGCCAACCGGTCTGGGAGCCTTCTTTAACACCAACGGTAGCGTCGC
CGCATTGCTGGTCGCACTCTTCAACCTTGGCATCGCAACGTTAATTTATCTGCCCTTTGT
TGTGGTGGCTAACAAAGCACAAAATGCGATTGATAAAGAAGAGAGCGAAGAAGATATCGC
TAACGCCCTGAAATTTTAATCGATGCCGGTACGGGTAATCGTGCCGGTAAGAAAAGAGAG
GAACGATGTATGATGGATCTCGATAACATTCCCGATACGCAAACGGAAGCTGAAGAGCTG
GAAGAAGTGGTGATGGGGCTGATCATCAACTCCGGACAAGCGCGCAGCCTGGCGTATGCG
GCACTGAAACAGGCGAAGCAGGGCGATTTTGCCGCAGCAAAAGCCATGATGGATCAGTCA
CGGATGGCATTGAATGAAGCGCATCTGGTACAGACGAAACTGATTGAAGGCGATGCGGGC
GAAGGTAAGATGAAAGTGAGTCTGGTGCTGGTCCACGCTCAGGATCATTTAATGACGTCC
ATGCTTGCGCGTGAACTGATTACTGAATTAATTGAGCTTCATGAAAAACTGAAGGCATAA
GGAGTCGATGATGCAGCCAGTGATTAACGCGCCGGAAATTGCCACTGCCCGAGAACAGCA
GTTGTTTAATGGCAAAAACTTCCATGTGTTTATCTATAACAAAACTGAGAGTATCAGCGG
ACTGCATCAGCACGACTATTATGAATTTACTCTGGTATTAACCGGGCGTTATTTCCAGGA
GATTAACGGTAAGCGCGTGTTACTGGAACGGGGCGATTTTGTTTTTATTCCGTTAGGTTC
GCACCATCAAAGTTTTTATGAGTTTGGTGCCACGCGCATATTGAACGTTGGGATCAGTAA
ACGCTTTTTTGAGCAGCATTACCTGCCATTGTTGCCTTATTGCTTTGTCGCTTCGCAGGT
ATACCGGACCAATAACGCTTTTCTCACCTATGTGGAAACAGTGATTTCTTCATTGAATTT
CCGCGAAACAGGGCTGGAAGAGTTTGTTGAGATGGTTACTTTTTATGTCATTAACCGTTT
ACGTCATTACCGCGAAGAACAGGTGATTGATGATGTACCGCAGTGGCTGAAAAGTACGGT
AGAAAAGATGCATGATAAAGAGCAGTTTAGTGAATCGGCGCTGGAGAATATGGTGGCGTT
GTCAGCCAAATCACAGGAATATTTGACGCGAGCGACTCAACGATATTATGGCAAAACGCC
AATGCAGATTATTAATGAAATCCGTATTAATTTTGCCAAAAAACAACTGGAAATGACCAA
CTATTCAGTGACGGATATTGCGTTTGAGGCCGGTTATAGTAGCCCGAGTTTGTTTATTAA
AACGTTTAAGAAATTAACGTCCTTTACGCCTAAGAGCTATCGTAAGAAATTGACTGAATT
TAATCAGTAAGTCGTTATACCTGACAATTCACATATCTGTCCTGTTGCTGGATTATTTAT
GTCCGGGGGGGCAGATATGCCAGATATCAGTATTCTGTACTGAAGGGAGAAATTATGAGC
CAGAAATTAAAAGTCGTCACTATTGGTGGCGGGAGCAGCTATACCCCGGAGTTACTGGAA
GGATTTATTAAGCGTTATCACGAATTGCCGGTCAGCGAATTATGGCTGGTGGATGTCGAA
GGTGGTAAACCGAAACTGGATATTATTTTCGATCTCTGCCAACGGATGATTGATAACGCT
GGCGTCCCGATGAAGCTTTATAAAACGCTGGATCGCCGCGAAGCATTGAAAGATGCTGAT
TTCGTTACTACCCAACTGCGCGTTGGCCAATTACCGGCGCGTGAACTGGATGAACGTATT
CCATTAAGTCATGGTTATCTTGGTCAGGAAACCAACGGCGCGGGCGGTTTGTTTAAAGGT
CTGCGTACCATTCCGGTGATTTTTGACATCGTAAAAGATGTCGAAGAACTTTGTCCGAAT
GCATGGGTGATTAACTTCACTAACCCGGCGGGAATGGTCACTGAAGCCGTTTATCGTCAT
ACCGGATTTAAACGCTTTATCGGCGTGTGTAATATTCCGATCGGCATGAAGATGTTTATT
CGCGATGTTCTGATGCTGAAAGACAGCGATGATTTATCTATCGATTTGTTCGGCCTCAAC
CATATGGTGTTCATTAAGGATGTGCTGATAAATGGCAAGTCGCGCTTTGCCGAATTGCTT
GATGGTGTGGCGTCAGGGCAGTTAAAAGCGTCCTCTGTAAAAAATATTTTCGATCTGCCA
TTTAGTGAGGGCTTAATTCGTTCGTTGAATCTGCTGCCATGTTCTTATCTGCTGTATTAC
TTCAAGCAGAAAGAGATGCTGGCTATTGAAATGGGCGAATACTACAAAGGCGGCGCACGA
GCGCAGGTAGTACAGAAAGTCGAGAAACAACTTTTTGAGCTGTATAAAAATCCTGAGCTG
AAAGTTAAGCCGAAAGAACTGGAACAGCGCGGTGGGGCTTATTACTCTGATGCAGCATGC
GAAGTGATCAACGCTATCTACAACGACAAGCAAGCAGAACATTACGTTAATATCCCGCAT
CATGGGCAGATTGATAATATTCCGGCAGACTGGGCAGTAGAAATGACCTGTAAGCTGGGG
CGCGATGGCGCGACGCCACATCCGCGCATTACGCATTTCGATGATAAAGTAATGGGGCTG
ATTCACACCATTAAAGGCTTCGAGATTGCTGCCAGTAACGCCGCACTTAGCGGAGAATTT
AACGATGTGTTACTGGCGCTAAACCTTAGTCCGTTGGTGCATTCCGATCGCGATGCTGAG
CTGCTGGCACGCGAGATGATTCTGGCGCACGAGAAATGGCTGCCAAACTTTGCCGACTGC
ATCGCAGAGCTTAAAAAAGCACATTAACCGAGGCTGATTATGGAACGCTTACTGATTGTT
AATGCCGATGATTTTGGCTTAAGCAAAGGTCAGAACTACGGCATTATCGAGGCCTGTCGC
AATGGGATTGTCACGTCGACGACGGCGCTGGTGAATGGGCAGGCTATTGACCATGCGGTG
CAGTTGAGTCGTGATGAACCGAGTCTGGCCATAGGGATGCACTTTGTCCTTACTATGGGT
AAGCCACTGACAGCTATGCCGGGGTTAACCCGCGATGGTGTGCTGGGAAAATGGATCTGG
CAGTTGGCAGAAGAAGATGCTTTACCGCTGGAAGAAATTACTCAGGAGCTTGTCAGTCAG
TATTTGCGTTTCATTGAGCTATTTGGACGCAAACCTACGCATCTTGATAGCCATCATCAT
GTGCATATGTTCCCGCAGATTTTCCCGATTGTTGCCAGGTTTGCGGCAGAGCAGGGCATT
GCGTTGCGGGCGGATCGTCAGATGGCGTTTGATTTGCCGGTCAACCTGCGCACTACCCAG
GGATTCAGCAGTGCATTCTACGGTGAAGAGATCAGTGAGTCGCTGTTCCTGCAAGTGCTG
GATGACGCAGGCCATCGGGGTGATCGTTCGCTGGAGGTGATGTGTCATCCGGCGTTTATC
GATAATACTATCCGTCAGAGTGCTTACTGTTTCCCACGCTTAACGGAGCTGGATGTGTTG
ACATCAGCGTCGTTGAAAGGTGCTATCGCTCAGCGTGGTTATCGGTTGGGGAGTTATCGG
GATGTGTAAGTGAGGATGTTTGCCAGATGCGGCGTGAACCTTGCATCCGGCGATTAATTC
CTACAAAGGCGGCGTAACTGCGCCGCTTGAGACTGCTGACAAACGCAAAACTGCCTGATG
CGCTTCGCTTATCAGGCCTACGTGTTTCCTGCAATATATTGAATTTGCACAGTTTTGTAG
GCCGGATAAGGCGTTCACGCCGCATCCGGCATAAACAAAGCGCACTATGTAAATCATTTG
AGGCGGCGCAATTGCGCCGCCTCCCATCAGGCAGGAATTTTGTCAATCTTAGGAATGCGT
GACCACACGCGGTGTGCTGCCATCAGCGTTAGCAGTTCATCCATAAAACTACCGTCAGCG
CTGTCAGCTTCCACAATCCCTTCTTCACCCTGGTCAGCGATCTTGATTGTTGCTTTAAAC
TTGCGCGCGTCACCCGCCAGCGCAATCGGTTTAAGGTGTTTGTAGGCTTCCATCAGGTAG
TAGTTGGCATCGCCGTTGTCAGCGATATCCGCGATATTGCCGCAAGGGACAATGACCGCA
TCGACCGTCAGCGAAGGTGCACCGGCAAAGGTAGCGGCTATAGGCAACACCGTACCGTCA
TCCGCAGTCACTTCACCCATTCGGGAGTAGAGCAGTTTGGCATGAACGCCTTTGGCCTTC
AGCGCCTTGAGAATGGCCAGAAGGTCTGCCGATCTCACTTCATCATTAAGTAAAATCGCT
ACCACGCGACCTTTCACATCACCGTCAGGAATGGCGTACAAACTTAAGGATGGATCCTTT
TTCAGACCGTTGACGTCCGGAGGTGGGGTGATATTCAGCTGGTCGTCAGTCAGTTCGATA
CCGAGATTTTTCGCCACCGCCTGGGCCAGAGTGAGATCAATATGCGCCAGCTGGTCAACA
ACGCGCTCACGAATATACGGACGAACGACTTTGCTTAACTCAAAACTGAAACCATCGACA
ATATGGCGCTGCTCAAATGGCGTCTGACTTAGCCAGAACAGACGCGGATGGGAATAATAT
TCGCCAAACGATGGGCTGCGCTCGCGAACTTTATTGCCTTCCACGCGCTCCTGGTATGAT
TCAAAACCGCCGCGTTTCGGCCCCGGCGGTGTTTCGCGCGGCCAGTTATCGTTAATCGAG
TTCGGTTCGTAATTCGCCGGGTTAGTGTCGATCCCCATGCGATGCATGCCGTCACGCTGG
AAATTATGGTAAGGGCAGGTCGGACGGTTAATCGGAATCTCATGGAAATTCGGCCCACCA
AGACGACTGATTTGTGTATCGGTATAGGAGAACAAACGTCCCTGCAACAGCGGATCGTTG
GTGAAGTCCAGTCCCGGCACGATATGCCCAGGATGGAAAGCCGCCTGTTCGTTTTCAGCA
AAGAAGTTATCCGGGTTGCGATTGAGCACCATTTTGCCGACACGCTGAACGGGCACCAGT
TCTTCCGGGATAAGTTTGGTTGGATCGAGAAGATCGAAGTCGAACTTGAATTCATCTTCT
TCAGGAATCAACTGGAAGCCCAGTTCGTATTCCGGAAAATCGCCTGCTTCAATGGCTTCC
CACAACTCGCGGCGGTGGAAGTCCGGGTCACGTCCGGTGAGTTTTTGTGCTTCATCCCAA
ACGAGTGAGGCTTTACCTGCCAGTGGTTTCCAGTGGAAACGTACAAACGTTGCCTTCCCT
TCGGCATTAATCAGGCGGAAGGTGTGAATACCGAAGCCTTCCATGGTGCGGTAACTGCGG
GGGATGCCGCGATCCGACATCGCCCACATCACGTTGTGCAGAGTTTCAGGTTGCAGAGAA
ACATAATCCCAGAAAGTATCGTGGGCACTTTGCCCTTGTGGAATTGCCCAGTGCGGTTCT
GGTTTTACCGCATGAACAAAATCGGGGAATTTATGCGCATCCTGGATAAAGAAGATTGGC
GTGTTATTGCCAACGAGGTCAAAAATACCCTCTTCGGTATAGAACTTGGTGGCAAAGCCA
CGGATATCACGCACGGTATCAGCAGAGCCAGCACCACCCTGAACGGTAGAGAAACGTACA
AATACTGGGGTGATTTTGTTCGGATCTGAGAGGAAATCCGCTTTGGTAATATCGCTTAAG
CTTTTATATGGCTGGAAATAACCGTGAGCGGCTGATCCGCGTGCATGAACAATACGTTCC
GGAATGCGCTCATGGTCAAAGTGGGTGATTTTCTCGCGCAGAATAAAATCTTCCAGCAGC
GTTGGACCACGGCTACCGGCACGCAGTGAGTTTTGATCGTCGGCGATGCGCACGCCCTGA
TTAGTGGTCAGCGCATAATTTTCACTGCCTTTGCGTACGTCTTCCAGAGAATTAAGTTTT
TCGTTACGCGTATCAGGGGCTTTCAGGCTCCCTGGGGCGGTAGGTTGTGCACCTGGCGGT
GTTGGTTCAGCCGCTGGACGATGAGAGCCGTCCTCAGGTGCCAGTGAGTCCATCCCCGGT
TTCGCTTCGCTGGAATCGTGTAGTGGTGACTGGTGCTGATGTGGGTTCTTTTCGTTATGT
TGCGACATTGAACTCGTCTCCTTAATTTATTACTGAAAGGGCCGCTGTTTTGGTCAAAAA
ACTCTCTAACTATAGACCACCAGCCAGATCCCGCTTCGGAGACTATTCTGGAAACGGTGT
TATGAAATACACGCAAAGCGGGACGTACAGGGGCTAAATCGGCTAAACTACAGTTTTTCT
GATTTTTAATATGCGTTTAGTGAAGCCAGTAATGAAGAAACCGCTCCGCCAGCAAAACCG
CCAGATTATTAGCTATGTCCCACGCACGGAACCCGCGCCGCCAGAACATGCGATAAAGAT
GGATTCGTTTCGTGATGTCTGGATGCTGCGTGGCAAATATGTTGCGTTTGTACTGATGGG
AGAGTCATTTCTGCGCTCACCGGCGTTTACTGTGCCTGAATCTGCCCAACGTTGGGCAAA
TCAGATCCGCCAGGAAGGGGAAGTGACTGAGTAAGGATTACATACCTCCCGGTTTTGCCG
GGAGTTACATGACCTGAAATTCTGTATTTCGTTGCTACATTCATTCAAACCACCTGTAAC
AAAAAGCTGCCTTTGACGATCTATTGCTATAAATAAGTGATCTTTTTTCTTTAATTGTTT
ATTTATTTTAAAATGGTTAAGTTTTGCTAATCATGATGAGCTATTTTTGATAGTTCATCC
TGTGGCGTCGCTCTTAAACTTATATTGTAAATGACTTAGATTTAAATGAGATAATAATTT
TGTTAACAATATGAGGCGGGAGATGTTTTCTACAAACTTAATACAGAGTAATTATGGTGA
TTTAAATATTAAAAGCCTGGCTTTCGACTCTTTTAAAGAAAGGCTGCAGTCTACTATGAC
AGCACTCACTTTCTTTATATCAACGGGTCAATGTGACTGCGATGAAATAGCAGAATCAAA
CTTTAATTATATGATTGCCTATATGTCTAACATTAACTATGATGCCTCAAAGCCAGGAGC
GCCAGCACTTAGTTTTGATACATATCTGCAGGACAATGTTAAATATAGAGTAATAATTAA
TAATCTTTATGGTAGTGAAATTCGGATAAGAGGTATAAATAAAGATTTTATTGGAATGGA
TGTCACTTCTGTATTTCGCCCAGAAAAAATGACCAATTTGATCAGTATAAAAAACAGGTT
GGTTATTCACTATTTAAGGACTATATACTATGAACAAAATTATATACATCCTGTCGGGAG
CATTTTTGCTGCGATTCAAAAAAATGAGAGTCTCCTAAAGTTTCCTTCGATAATATCAAT
GCTTAATATCAATCTTCTTTTTAATCCACTAAATCTTCCGGGAATGGGAAGTGGTGTGCT
TGAAGATATTATGAGTATTCCAGATAGTTCACTTAGAAAACGTCTCGGGTATGAGGTTTT
AAGCTTCTCGCTACAGGCACATTCATTGAGCCAGGAATGTATTGATAAGTTGGACATTTT
TTTCGCTGACGATCTGTTTAAATATGAGTCAGTATGCATCGCCGCGATGGAACATTTAAA
AAGTAAGGCAACGGCCCCTATACAAAACGGACCGTTGCCAGCATAAGAATTAATGGTGTG
CCAGTTCGGCGTCGTCTTCGCTATCCAGAATGGCTTTATCGGTTTGCTTCAGCCACTGGC
TGGTCAGCGTGCCAGCTGTCATCGAGCCACTAACGTTTAACGCCGTACGGCCCATGTCGA
TAAGCGGTTCAACGGAGATTAACAGCGCCACCAGGGTTACTGGCAGGCCCATCGCAGGCA
GTACAATCAGTGCGGCGAAAGTTGCACCACCACCGACACCGGCAACGCCTGCGGAACTAA
CGGTAACAATACCGACCAGCGTCGCAATCCACATCGGGTCCAGCGGGTTAATGCCAACCG
TAGGCGCAACCATCACCGCCAGCATTGCCGGATACAAACCGGCGCAGCCGTTCTGACCAA
TGGTTGCACCGAAAGAGGCGGCGAAACTGGCGATGGATTCAGGAACGCCCAGACGACGCG
TTTGTGCTTCCACATTCAGTGGGATAGACGCAGCACTGGAACGGCTGGTAAAGGCAAACG
TCAGCACAGGCCATACCTTACGGAAGTACTTCAGCGGACTCACGCCATTAATGCCCAGCA
GAATGCCATGCACTGCAAACATAATCAGCAGACCGAGGTAGGACGCGACAACGAAACTTC
CCAGTTTGATGATGTCTTGCAAGTTAGAACCTGCAACCACTTTGGTCATTAGAGCCAGAA
CGCCGTAAGGGGTCAACTGCATGACCAGGCGAACCAGTTTCATCACCCAGCTTTGTAGGG
TATCGATAGCGGCTAAGACGCGTTCACCTTTCGGCGCATCATCCTTCAGCAGTTTCAATG
CAGCTACGCCGAGGAATGCGGCAAAAATTACCACGCTGATAATTGACGTCGGATTGGCTC
CGGTAAGATCGGCAAACGGGTTTTTCGGGATAAAGGACAAGACCAGCTGCGGAACGCTCA
GATCAGAGACTTTACCAACATAGTTACTTTCAATGGCGTTCAGACGTGCAGTTTCTGCAC
CACCCTGAACCAGACCTTCAGCCGTCAAACCAAACAGGTTGGTGACCAGCACACCGACCA
GCGCCGCAATCAGCGTGGTAAACAAAAGCGTACCGATGGTCAGAAAACTGATTTTGCCTA
ACTGAGATGCGTTATGCAGACGGGCAACCGCGCTCAGAATAGAGGCGAAGACTAACGGCA
TAACGATCATTTGCAGCAGTTGAACATAGCCGTTACCAACGATGTTAAACCACTGTACAG
AATCTTTAAGTACCTGGCTGTCAGAACCATAAATGGTATGCAGGGCAAGGCCAAAAACCA
CACCCATCACCAGACCCACCAGCACTTTTTTCGCCAGACTCCACTGTTTATGGCGGGTCT
GAGCCAGCGCAAACAGCAGTACAACGAACACCACGATGTTCGCAATTAATGGAAAGTTCA
TCCCCGTTCTCCTGATCTTATTATTTCTATCACTGCGTAGCAGTCATAGTGTTGGCGCAA
GATTAACAGAACTGTGAGCTGGCTCTTATATTCAAATGGAATTGCTTATTCCAGAAAGGT
GATTTTTGCCTTTTTAGTATTCAACCTGATGCTTAATAAGCCGATGAAACTGGATCTGCA
AGGTATTGATCATTTGCGATGACCAACGAACAGCGCTGTTCTCGGGTAATGAATGGGGCA
TCCATACCGACCAGACAAATAATGCCATGCAGATAAAACGTTCCAGTTGGTTGCCCTTTT
GGGGAACCAGGATAGGCAAGCGGAAACGCCAGCGGCATGGCCAGAGCAGGGGAACACCGG
CGGGTGTCAGCATATCGGCAAGTATGTGGCTCAAATAACCCAGCACCATTCCTTGTAGCG
CATCAGCCGGAATGAACCAGCCTTCCGGAACCTTAAGGTAAAAGGTTGCCAGCAGCGCAA
ATACCGCCAGCAGACTGTGGGTAAAACCACGATGCCCAAAAGCGCGGGCGATCGGTTTTG
ATATCCATTTTAATCGCTGCCCAAGAAACGACTTTGGGTGATCGATGTCCGGTAACAAAC
ACGTCAGGATTGCGGAAGGGACAATATGCCACCAGTCACCCTGTGCCAGCACGGGCGTCA
GCTCGGCATTTTTGGCAAATACCGCACAAGCAATAGAAAAGAGAAGGTGACCTTCCGCCG
TCATGATAAAACTCACTAAACTGTCGATACGTACAGTATAGGATTTTTATACAGTGCACG
GAAGTGGTGACGGTGTAACTCTTTCTCTTAAATTGACGATTAATCCGTCAGTTGAATGCA
ATTTCAGATAAAGAACCAGGGGCAGCGAGATCACTGCCCCTGGTCATTAACCGAGAAGGT
CTTTTGCGGTGAGTTCTGTCAGCGATGAAAGTTTGACGTCTGCTAATACAAAACGTGGAT
CATTTTGCGCTTCTGGCGCAGGAACGACGATGGAACGCATGCGGGCTGCTTTAGAGGCGA
TCATGCCATTTACCGAATCTTCCAGCGCTACGCAGGTCAGAGGGTCAACGCCCAGTTTTG
CTGCGCAGTCGAGATATACTTGCGGATGCGGCTTGCTGTAAGGCAGTTTTTCGGCCGAGG
CGAGGGCATCGAAACTGTCGCGTAAGTCAAACATGGTCAACACTTTTTCCAGCATATGTA
GTGGTGACGCGGAGGCCAGTCCCACCAATAAACCTTGTTCTTTGCATAACGCAACGGCTT
CGCGCACGCCTGGTAATAATGGACGTGTCTCTTCAACCAGTGAAATGGCACGGGCAATAA
CCCGTTCTACTACTTCCTGACGGCTTGGCCCATTCCACGGTTGCCGGGCGTACCAAAGAT
CGACCACCATATCGATGCGTAAACCTAAGGTGTCCGGCAGCTCGTTACGACGGGAGATAT
CCACCCCCAGGCTTGCCATCACATCCAGTTCGGCTCGATCCCATAAAGGTTCTGAGTCGA
TAAGTAATCCATCCATATCAAAAATTGCAGCAAGAATCTGACGCGGGGTTGACATTACAA
CCTCTCCTTTAGAGCATTATGTGTAAGGTATTAAGCCGTGCTTATGATTAAGCGCCTATC
ATATCGCCTTTAAAGAATGGGCGAAAACAGATATCTACAGGTAAACTAAGTGAAACGACG
CGTCTTAATCAAGGAGAACTCATGACGTATCAACAAGCTGGACGCATTGCTGTTTTGAAA
AGGATTTTGGGTTGGGTGATTTTTATACCTGCATTGATCTCTACATTGATTTCTTTGCTG
AAATTTATGAATACCCGGCAGGAAAACAAGGAAGGCATTAATGCGGTCATGCTCGACTTT
ACTCATGTCATGATCGATATGATGCAGGCGAATACGCCTTTTTTGAATCTATTCTGGTAT
AACTCCCCGACGCCCAATTTTAATGGTGGCGTGAACGTTATGTTCTGGGTGATTTTCATC
CTGATTTTTGTCGGACTGGCGTTGCAGGATTCCGGTGCCCGGATGAGTCGCCAGGCGCGC
TTCTTGCGGGAAGGTGTTGAAGATCAACTCATTCTGGAAAAAGCCAAAGGGGAAGAGGGG
CTAACGCGTGAACAAATTGAGTCCCGTATTGTTGTTCCGCACCATACTATTTTCCTGCAG
TTTTTCTCACTGTATATCCTGCCGGTTATTTGTATTGCTGCAGGTTATGTGTTCTTTTCT
CTGCTTGGGTTTATTTAATCAAAAGGCCGCACGGAGCGGCCATTATCCTCAACCCATATC
ATGCTGCTAATAATCTATCCAATGACTGCTGAGCAATAACCAAATGCTGACCGCCAAATA
ACCTTGCACGATTTAACAGCGTGTAGAGTTGGTAAACCGGTTGACGTTCAAGGAAATCGG
CAGGTAGCGGGGATACTGACTGATAGCCGTCATAGATTTGTGGCGGCTGTTCAGTATGCA
GCGGTAACATCGCCAGGTCGCACTCTCGGTCACCCCAGTAGCAGGCCGGGTCGAAAATGT
ACGGGCCATCCGGACCCAGTGCACAGTTGCCGGACCATAAATCGCCGTGCAACAGAGAAG
GCTGCGGTTGATGTGAGGCCAGACGCTGCTGAATATGCTCGACGATGGCGTCGATATTGC
CGAAAGCGATCCCTTTTTCTGCAGCCAGTTCCAACTGCCAGCCAATCCGTTGTTCAGCAA
AAAACGTTGACCAGCGACGTTGCCAGGTGTTGGGCTGTGGAGTTGTGGAGAGCGCGTTAT
CGAAATCAAGGCCAAATTGTGGTTGGTCGCTCCATTGATGTAAACGCGCAATTTGCTGAC
CAAGAATAAATGCGCTATGCGCATCCAGCGGACGAGGTGGGAGATAATCCATCACCAGAA
AACTGTAGTCACGGTCAGCGCCAACTGCCCAAACCTTAGGCACGGTGACGGTTTTACTAC
GCGACAGTAACTCCAGTTGGTCGGCTTCGGCGGTAAAACCGGGAAGCAGTTCCCTTTCAT
CACATTTGACGAAAAAATCATGTCCTGCATAGCGCAAATGCCATGCGGCATGGACTTCTC
CGCCAGGCAGTTCATTACGCAGTTCGATTTCGCCTTCACCTAACTGCTCGCTCAAAAGAC
GACTGATTGCCTGCCACATGATGTCTCTCCCATGTTGTCTGCCAGATCATAAGGTTAGCG
CAAGAATGCGGTGTAAAAACACGAGCTAACGCACACCACAGACTGATTATTGCCCAAAAA
CCATTTATTTTCTGTTGCTATTCCATTCCTCCCAGGTCGTGATGGTGATTTCAGGATCTT
TGCCGGTTGCACTTTGGGTAAGCCCCGAAACCAGTTCTCTAATTTCTTCTTCACTTTGGG
TACTGATAAGTCCAAAAGTGTTAGTTCCCAGCTCATGGATATTTCCCTCATCATCCGTCA
TAGTGAGCAAAAAACCGTCGCGAGTCAGGTAATTATTCAACTCGTTAATTTCAGTCAATG
TATCCTCATGCAACATGACGGTTATGACATAACGGACAAGATCGCCACTGGCCATAGTTC
ACCCCTTTGTTATCACATGACTTTTGAGCATAGTCGGAGAAACGCGTTGCCGACAGGTTG
GTGATGATTCCCCCAATGCTGGGGGAATGTTTTTGTTAGCGGGAAAGGTAAGCGTAAATT
TTTTGCGTATCGTCATGGGAGCACAGACGTGTTCCCTGATTGAGTGTGGCTGCACTCCCC
GCAGCTACGCCAAAACGAACCATCTCTTCAAGAGAGGCATTTTCTGCCAGTTTCAGTGTC
ATCGCGCCGACCATGCTGTCACCAGCGCCAACGGTACTCTGGCTTTTCACCGGTGGTGGC
ACCACCTGAATACAGTTTTCACTATCAACACCCAGCGCTCCTTGTGGACCCAGGGAAACG
ACAACCCGTTTGGCCTTGCCGCTATTAACGATTTCCTGCGCGGCTTTGCGGACATCGTCC
GGCTGGGTGAGTTCGCGATTCACCAGCGCACTGAGTTCTTTTTGGTTAGGCTTAACCAAC
TCGATGTTACCAATTGCCAGTGCTGCACTTAACGCTTCGCCAGAACTGTCGACGATGCAG
CGGATCCCTTGTTTTTGCGCAGCGGAAATCAGTTGGGTTAATTTTTCCAGCTTCACACCT
GGCGGCAGGCTTCCGCTTATGACCAGGATGGCCCCGGATTCAATTTCCAGAACTTGCTCT
TCAAGCTGGCGAAACTCATCTTCATTTAATGCCGCGCCTGGCATAACAAAACGATACTGC
TCACCGCTTGCTTCCACATGTACGTGTAAATTCTGCCGGGTCCAGTCTTTGGCTTCTACA
GTAGCGACGGGGACATTTTCATCCGCCAACAGTGAAACCAGGTGTTCGCCGGTCGCGCCA
CCCGCCGGGAAGATCGCTGTGGCACTGCCTCCAAGATGGGCAATGGCGCGGGCGACGTTG
ATGCCGCCGCCCCCGGGTTCGAACACCGGTGCGGTACAGCGCAGTTTTCCTTCGGGATAA
ATTTGCGGGGTAATTGTTGCGCTATCGAGAGAGGGCGCAAGTGTCAACGTATAGATACGT
ACCATCATTTCCTCCTATAGGCTGATTTCAGTCTGGCACCGAATCAGCGGAAAGTGAAGA
AATTAACAATATGATTTATTGGAGCTTTATTTAAAATTTTGCAGATAAATATATATAAAT
AAAAATCTGTTTTCGCCACATGCTTATTCAAAAAATGAAATAAGAATACATTGCTAAGTT
ATTCGCGCCTTTTTATAATTCGTTACCTTTCCAGGGACGCTAATCTTTGATCCTTAAGAA
AGTTTCCGGGACCGCGATGGTCTCTTTTTTTGTTGTACGGACTCTTGATAAATGAAGCTT
TTGAAGACAGTTCCTGCCATCGTTATGTTGGCGGGGGGCATGTTTGCGTCACTGAATGCA
GCTGCCGATGATTCCGTTTTTACTGTCATGGATGATCCTGCCAGCGCTAAAAAACCTTTC
GAAGGTAATCTGAACGCAGGATATCTTGCACAATCAGGCAATACGAAAAGCTCCTCACTT
ACGGCTGACACCACCATGACCTGGTATGGACACACCACTGCCTGGTCGCTGTGGGGGAAC
GCCAGTAATACTTCTTCTAATGATGAGCGTTCTTCAGAAAAATATGCGGCGGGCGGGCGT
AGCCGTTTTAATTTAACTGATTATGACTATTTATTTGGTCAGGCAAGCTGGCTGACAGAC
CGTTATAACGGCTATCGAGAGCGCGATGTGTTGACCGCGGGTTATGGTCGTCAGTTTTTG
AATGGCCCGGTACACAGTTTCCGCTTTGAATTCGGTCCAGGTGTGCGTTACGACAAATAT
ACCGACAATGCCAGTGAAACCCAGCCGCTGGGCTATGCCTCCGGGGCTTATGCATGGCAG
TTGACTGACAACGCTAAATTTACGCAGGGTGTTTCGGTCTTTGGCGCGGAAGACACAACG
CTGAACTCCGAAAGCGCATTAAATGTTGCTATTAATGAACATTTTGGACTGAAGGTGGCT
TACAACGTCACATGGAACTCTGAACCTCCAGAGTCTGCACCGGAACATACCGACCGTCGG
ACAACCTTATCGCTGGGCTACAGCATGTAAAATTATCTGCCGGACCGTGTTATGCGGTCT
GGCTGTCTTCGTTTGTCACTGCTCAGCCCCAAATCATTGCTGCCCAACGTAGCAACAACA
TAGCGCCACAGATTGCCAGTAGCACCACCACCATCTTCCAGTGTTTTTTATCAAAGCGTT
TAGTCGGCATACCAGTGTCCTGCATATCTCTTGTGCGTGATAACGGAGTGTAACAAAAGG
GACAGGCATCAAGGGATTTTTTGTTATTACAGCCGTCGGGTGGCGTTGTGCACATGGTCA
CTGTTTCTGCGTTTTATGAAAAAAATAAAATTATGTATCGATATATATCGTAAATAGCTG
GTTATAAATACGTCTTTATTTCATCAGCACTAAAACTCAGGCTTTGGCTGATTGCATTAA
TAGCAGCATAATATGTTTCTACAGTTTTATAATGCTTATGATGAATGGCTATATGAACAG
CTGACATGTTGTCATGATTTTTAGCGGCCAATAGTGTAAATAACTGATGTTGACTAAAAG
AATGTTTTTTTGCAAAAGCACCCAGCGTCGATATATAAGATAACACGACGTCTTCATTAC
CCTTGCTCATGGCGATGTATAATGCAGGGGTTCCCTGTGCTGTAGCTCCTTTTAATAAAT
CCATGATGTTAGCTTTGCTCAACTTGTATTTAAAGGCGATGCCATTAATTTTAGAGAGGA
ACCGTGTGACACACAAAGGGTGATTATTTTCCATTGCGGCGTATAATCCTGGCTCACCAT
CATGTATTTTCATGGCTAAAATACTCATCACCAGTTTTTTGTTTAAAAGCTCTTGTGCTA
TTGGAGTGGTTAATGCATTCAGAAAGATATCGATTATTTCATCGAATCCATACAACATGG
AGATATAAAGTCCAGGTGTTTCGTTAGCACTTTTAGTTTGCAGTAATTTAACCAGATTAT
CTTCATGAATGATGTGATTATCTACCAGTGACTGAATTTCTTGCATAAATATTTTCACGT
TGTCAGTATGTCCGTTCATCATAGCCAAAAATAAAGCAGGTGTACCAACGCTATTCTGCG
CAGTTATTATTTCAATGATTTCTTTTTCAGGGAGTATGGGCAACTGTTTGAATAATGTAA
TAAGCTGTTGAGACTGGCCTGTAGCCATTATTAACAACATTGCCGATGGATGTATAGGGG
CAAATGGCATTCGTGATGCAATACCCGCGAAAATAGCCCCTGGAACTCCCACAGGTAATA
GGGGCAGAATAGCAATTGCACAGTTGCGAACATATCTATCAGCCCAGGTCTGAGCATCGG
GACCTGAACTGATGAACTTATCAAGCGAAAGAAAGCCCCGTGCTGTCCTGTGGGTGTCTC
TGACGGCAACGTTGGTATCGTTCGGGTCGTAAACGGACACAACATAATTTAATTGTCCAT
ACACTGACTGCTTTATTCGTAGCCTTACTGACAAAGTATGATTGTCTATATATAAAATCG
CGGACATATGACTGACATTGTTTGCCATCATTCGACAAAAGAAAATATCTAAAGCGAAGC
CAAAATCCTTACTCGCGATAACGCGACTCCCTGCAGGAGGATGGCGAAGTAATGCTCTGA
ACTCCGCGTCCCGGACTAAGGGGACATGCTGCTGTATGGATTCAACGGAGGAGTAATGTT
TAATCAGGTTGACTTTGCCTTTTCCATTTCTCAATGAATCAAGGGCGTATTGCAATGACA
GATGGCGACAAAAAATAGCGTCAGAAGGAGATTGCAAAAAACATGCACTACCATTGAGAT
TTACTGTTGGGTGTATAGTTTTTTTCTCTATGGATTTTTTTAGACAGTTTCATACAATGG
TTACGATCTTCAGCAGTTAACTGTTCCTGTTCAATATAATCCAGTATGCTTCGCAAATGG
TTAGCTTTAATAGGCGTGGTTTCCAGTAATAAGGAAATGATTTCTTTTTTATAGTGTAAT
GTAATGAGTATATTTTCTGTATGGATGGGTGAAGTGGCAAAGTTAATGGTAAAAAGGGCA
GTGGAATAACAATTTTGTGATATTTTTCGACAGTTTGCGGTAAATTCCTGAGTAACACAG
TATGACAGCATCGAACTTAAGTCAGAGGTATCAAGTAGGGTGATGAGCTGGCGCGCAAAT
TGATTAATAGGCTCTGATGAAGGTGTTGGTATGTCGCTATCGATGTGCAATCTATGAGGA
GACTTATAATGAGTTCTGATAATGATATCGTTTTGACTCATAATCTGTTCGCCTTATATA
TATCTGGAGGTTTTGAGGATGATGATTAATTATTATCGCCAGAACGAAATGTGCACGAAA
AATTGTTATAAGAATTGTGTCACTTTTATCATTGTGATATGACCACTTCGTCATTAATCT
CATGAGCGTTTAAAATACTACCGCCAAATCACGCAACGAACTTTGCTGGATTCAGTTTAT
GCTGCTGTAAATCCGCTCGCAGTAAACCTTTCAGACGCACCGTGATGTTATCAGTTGTTC
TTTAAGCGTTTTGCTGGTGTACTCACTACAAACGAATTGCGAATCGAATCAATGTGAAAC
GGAAAGGTACAATCTCCCTTTTTTTAGTGTTAACATCGCTCAACCGGGTGGAAGGTGAGA
GGTTAATGTCTTTCATTTGTGTACCTGATTGCGAACCAATTTAGCATTTGTTGGCTAGAT
GGTTTCGCAATGAACTGTTAATAAACAAATTTTTCTTTGTATGTGATCTTTCGTGTGGGT
CACCACTGCAAATAAGGATATAAAATGCCTGTTATAACTCTTCCTGATGGCAGCCAACGC
CATTACGATCACGCTGTAAGCCCCATGGATGTTGCGCTGGACATTGGTCCAGGTCTGGCG
AAAGCCTGTATCGCAGGGCGCGTTAATGGCGAACTGGTTGATGCTTGCGATCTGATTGAA
AACGACGCACAACTGTCGATCATTACCGCCAAAGACGAAGAAGGTCTGGAGATCATTCGT
CACTCCTGTGCGCACCTGTTAGGGCACGCGATTAAACAACTTTGGCCGCATACCAAAATG
GCAATCGGCCCGGTTATTGACAACGGTTTTTATTACGACGTTGATCTTGACCGCACGTTA
ACCCAGGAAGATGTCGAAGCACTCGAGAAGCGGATGCATGAGCTTGCTGAGAAAAACTAC
GACGTCATTAAGAAGAAAGTCAGCTGGCACGAAGCGCGTGAAACTTTCGCCAACCGTGGG
GAGAGCTACAAAGTCTCCATTCTTGACGAAAACATCGCCCATGATGACAAGCCAGGTCTG
TACTTCCATGAAGAATATGTCGATATGTGCCGCGGTCCGCACGTACCGAACATGCGTTTC
TGCCATCATTTCAAACTAATGAAAACGGCAGGGGCTTACTGGCGTGGCGACAGCAACAAC
AAAATGTTGCAACGTATTTACGGTACGGCGTGGGCAGACAAAAAAGCACTTAACGCTTAC
CTGCAGCGCCTGGAAGAAGCCGCGAAACGCGACCACCGTAAAATCGGTAAACAGCTCGAC
CTGTACCATATGCAGGAAGAAGCGCCGGGTATGGTATTCTGGCACAACGACGGCTGGACC
ATCTTCCGTGAACTGGAAGTGTTTGTTCGTTCTAAACTGAAAGAGTACCAGTATCAGGAA
GTTAAAGGTCCGTTCATGATGGACCGTGTCCTGTGGGAAAAAACCGGTCACTGGGACAAC
TACAAAGATGCAATGTTCACCACATCTTCTGAGAACCGTGAATACTGCATTAAGCCGATG
AACTGCCCGGGTCACGTACAAATTTTCAACCAGGGGCTGAAGTCTTATCGCGATCTGCCG
CTGCGTATGGCCGAGTTTGGTAGCTGCCACCGTAACGAGCCGTCAGGTTCGCTGCATGGC
CTGATGCGCGTGCGTGGATTTACCCAGGATGACGCGCATATCTTCTGTACTGAAGAACAA
ATTCGCGATGAAGTTAACGGATGTATCCGTTTAGTCTATGATATGTACAGCACTTTTGGC
TTCGAGAAGATCGTCGTCAAACTCTCCACTCGTCCTGAAAAACGTATTGGCAGCGACGAA
ATGTGGGATCGTGCTGAGGCGGACCTGGCGGTTGCGCTGGAAGAAAACAACATCCCGTTT
GAATATCAACTGGGTGAAGGCGCTTTCTACGGTCCGAAAATTGAATTTACCCTGTATGAC
TGCCTCGATCGTGCATGGCAGTGCGGTACAGTACAGCTGGACTTCTCTTTGCCGTCTCGT
CTGAGCGCTTCTTATGTAGGCGAAGACAATGAACGTAAAGTACCGGTAATGATTCACCGC
GCAATTCTGGGGTCGATGGAACGTTTCATCGGTATCCTGACCGAAGAGTTCGCTGGTTTC
TTCCCGACCTGGCTTGCGCCGGTTCAGGTTGTTATCATGAATATTACCGATTCACAGTCT
GAATACGTTAACGAATTGACGCAAAAACTATCAAATGCGGGCATTCGTGTTAAAGCAGAC
TTGAGAAATGAGAAGATTGGCTTTAAAATCCGCGAGCACACTTTGCGTCGCGTCCCATAT
ATGCTGGTCTGTGGTGATAAAGAGGTGGAATCAGGCAAAGTTGCCGTTCGCACCCGCCGT
GGTAAAGACCTGGGAAGCATGGACGTAAATGAAGTGATCGAGAAGCTGCAACAAGAGATT
CGCAGCCGCAGTCTTAAACAATTGGAGGAATAAGGTATTAAAGGCGGAAAACGAGTTCAA
ACGGCGCGCCCTAACCGTATCAATGGCGAAATTCGCGCCCAGGAAGTTCGCTTAACAGGT
CTGGAAGGCGAGCAGCTTGGTATTGTGAGTCTGAGAGAAGCTCTGGAGAAAGCAGAAGAA
GCCGGAGTAGACTTAGTCGAGATCAGCCCTAACGCCGAGCCGCCGGTTTGTCGTATAATG
GATTACGGCAAATTCCTCTATGAAAAGAGCAAGTCTTCTAAGGAACAGAAGAAAAAGCAA
AAAGTTATCCAGGTTAAGGAAATTAAATTCCGTCCTGGTACAGATGAAGGCGACTATCAG
GTAAAACTCCGCAGCCTGATTCGCTTTCTCGAAGAGGGTGATAAAGCCAAAATCACGCTG
CGTTTCCGCGGTCGTGAGATGGCGCACCAGCAAATCGGTATGGAAGTGCTTAATCGCGTG
AAAGACGATTTGCAAGAACTGGCAGTGGTCGAATCCTTCCCAACGAAGATCGAAGGCCGC
CAGATGATCATGGTGCTCGCTCCTAAGAAGAAACAGTAAGGCCTTCAAGTAGCACTGTCT
GTGGAGCCTTCGGGCTTCACAGGCTTTGTTCGCCTTTGTTTCGTTTATTAACAATGCGAA
GTGGAAGTTATTAAAATGCCAAAAATTAAGACCGTACGCGGTGCTGCTAAGCGCTTCAAA
AAAACCGGTAAAGGTGGTTTTAAGCACAAGCACGCTAACCTGCGTCACATTCTGACCAAA
AAAGCGACCAAACGTAAACGTCACCTGCGTCCGAAAGCCATGGTTTCCAAAGGCGATCTG
GGCCTGGTAATCGCGTGCCTGCCGTACGCATAAGCCGTTAACGTTTTTAACTTTTTAATT
AGAATATAGATACAGGAGAGCACATATGGCTCGCGTAAAACGTGGTGTTATTGCACGTGC
ACGTCACAAGAAAATTTTGAAACAAGCTAAAGGCTACTACGGTGCGCGTTCTCGCGTATA
CCGCGTTGCCTTCCAGGCTGTTATCAAAGCTGGTCAGTATGCTTACCGTGACCGTCGTCA
ACGTAAGCGTCAGTTCCGTCAACTGTGGATTGCGCGTATCAACGCAGCAGCACGTCAGAA
CGGTATTTCTTACAGCAAATTCATCAATGGCCTGAAAAAAGCCTCTGTTGAAATCGACCG
TAAGATCCTGGCTGATATCGCAGTATTCGACAAAGTAGCGTTCACCGCTCTGGTTGAAAA
AGCGAAAGCAGCTCTGGCATAAGCCAGTTGAAAGAGGGAGCTAGTCTCCCTCTTTTCGTT
TCAACGCCATCAAAACATTGACTTTTATCGCCGTAGCCTTTTCAATAAAGGTCTTTTGAA
GAGTACCAAAAGGTAACGCAAGCAATGAATGCTGCTATTTTCCGCTTCTTTTTTTACTTT
AGCACCTGAATCCAGGAGGCTAGCGCGTGAGAAGAGAAACGGAAAACAGCGCCTGAAAGC
CTCCCAGTGGAGGCTTTTTTTGTATGCGCGTTTTGAAAAATAAAAAGCCTGTCTCATCAG
GTGTAATTGTCGCAGCCAGACTGGACACGGCCAGCGCGGAGAAACCGGAGCGTATTTAAG
TACGTGAGAATTTCGAGCACAGCCCGGGACCAAAATGGCAAGTAAAATAGCCTGATGGGA
TAGGCTCTAAGTCCAACGAACCAGTGTCACCACTGACACAATGAGGAAAACCATGTCACA
TCTCGCAGAACTGGTTGCCAGTGCGAAGGCGGCCATTAGCCAGGCGTCAGATGTTGCCGC
GTTAGATAATGTGCGCGTCGAATATTTGGGTAAAAAAGGGCACTTAACCCTTCAGATGAC
GACCCTGCGTGAGCTGCCGCCAGAAGAGCGTCCGGCAGCTGGTGCGGTTATCAACGAAGC
GAAAGAGCAGGTTCAGCAGGCGCTGAATGCGCGTAAAGCGGAACTGGAAAGCGCTGCACT
GAATGCGCGTCTGGCGGCGGAAACGATTGATGTCTCTCTGCCAGGTCGTCGCATTGAAAA
CGGCGGTCTGCATCCGGTTACCCGTACCATCGACCGTATCGAAAGTTTCTTCGGTGAGCT
TGGCTTTACCGTGGCAACCGGGCCGGAAATCGAAGACGATTATCATAACTTCGATGCTCT
GAACATTCCTGGTCACCACCCGGCGCGCGCTGACCACGACACTTTCTGGTTTGACACTAC
CCGCCTGCTGCGTACCCAGACCTCTGGCGTACAGATCCGCACCATGAAAGCCCAGCAGCC
ACCGATTCGTATCATCGCGCCTGGCCGTGTTTATCGTAACGACTACGACCAGACTCACAC
GCCGATGTTCCATCAGATGGAAGGTCTGATTGTTGATACCAACATCAGCTTTACCAACCT
GAAAGGCACGCTGCACGACTTCCTGCGTAACTTCTTTGAGGAAGATTTGCAGATTCGCTT
CCGTCCTTCCTACTTCCCGTTTACCGAACCTTCTGCAGAAGTGGACGTCATGGGTAAAAA
CGGTAAATGGCTGGAAGTGCTGGGCTGCGGGATGGTGCATCCGAACGTGTTGCGTAACGT
TGGCATCGACCCGGAAGTTTACTCTGGTTTCGCCTTCGGGATGGGGATGGAGCGTCTGAC
TATGTTGCGTTACGGCGTCACCGACCTGCGTTCATTCTTCGAAAACGATCTGCGTTTCCT
CAAACAGTTTAAATAAGGCAGGAATAGATTATGAAATTCAGTGAACTGTGGTTACGCGAA
TGGGTGAACCCGGCGATTGATAGCGATGCGCTGGCAAATCAAATCACTATGGCGGGCCTG
GAAGTTGACGGTGTAGAACCGGTTGCCGGCAGCTTCCACGGCGTGGTCGTTGGTGAAGTG
GTTGAGTGTGCGCAGCATCCGAACGCTGACAAACTGCGTGTGACAAAAGTGAATGTCGGC
GGCGATCGCCTGCTGGACATCGTCTGCGGTGCGCCAAACTGCCGTCAGGGCCTGCGTGTA
GCGGTAGCGACCATTGGTGCTGTTCTGCCGGGTGATTTCAAAATTAAAGCGGCGAAACTG
CGTGGCGAACCGTCTGAAGGGATGCTGTGCTCCTTCTCTGAACTGGGCATTTCTGACGAT
CACAGCGGCATTATCGAACTGCCTGCGGATGCGCCGATTGGCACCGATATCCGTGAATAC
CTGAAACTTGATGACAACACCATCGAAATCAGCGTGACGCCAAACCGTGCCGACTGCTTA
GGCATCATTGGTGTTGCGCGTGACGTTGCCGTGCTGAACCAGCTGCCGCTGGTTCAACCG
GAAATCGTTCCGGTTGGTGCGACCATCGACGACACGCTGCCGATTACAGTCGAAGCGCCG
GAAGCCTGCCCGCGTTATCTTGGCCGTGTGGTAAAAGGCATTAACGTTAAAGCGCCAACT
CCGCTGTGGATGAAAGAAAAACTGCGTCGTTGCGGGATCCGTTCTATCGATGCAGTTGTT
GACGTCACCAACTATGTGCTGCTCGAACTGGGCCAGCCGATGCACGCTTTCGATAAAGAT
CGCATTGAAGGCGGCATTGTGGTGCGGATGGCGAAAGAGGGCGAAACGCTGGTGCTGCTC
GACGGTACTGAAGCGAAGCTGAATGCTGACACTCTGGTCATCGCCGACCACAACAAGGCG
CTGGCGATGGGCGGCATCTTCGGTGGCGAACACTCTGGCGTGAATGACGAAACACAAAAC
GTGCTGCTGGAATGCGCGTTCTTTAGCCCGCTGTCTATCACCGGTCGTGCTCGTCGTCAT
GGCCTGCATACCGATGCGTCTCACCGTTATGAGCGTGGCGTTGATCCGGCACTGCAGCAC
AAAGCGATGGAACGTGCGACCCGTCTGCTGATCGACATCTGCGGTGGTGAGGCTGGCCCG
GTAATTGATATCACCAACGAAGCAACGCTGCCGAAGCGTGCAACCATCACTCTACGTCGT
AGCAAACTGGATCGCCTGATCGGCCATCATATTGCGGATGAGCAGGTAACTGACATTCTG
CGTCGTCTCGGCTGCGAAGTGACCGAAGGCAAAGACGAATGGCAGGCAGTTGCGCCGAGC
TGGCGTTTCGATATGGAGATTGAAGAAGATCTGGTTGAAGAAGTCGCGCGTGTTTACGGC
TACAACAACATCCCGGATGAGCCGGTACAGGCAAGCCTGATTATGGGTACTCACCGTGAA
GCTGACCTGTCGCTCAAGCGCGTGAAAACGCTGCTCAACGACAAAGGCTATCAGGAAGTG
ATCACCTACAGCTTCGTTGATCCGAAAGTGCAGCAGATGATCCATCCAGGCGTTGAAGCC
TTACTGCTGCCAAGCCCGATCTCTGTTGAAATGTCAGCAATGCGTCTTTCTCTGTGGACT
GGCCTGCTGGCAACCGTGGTGTACAACCAGAACCGTCAGCAGAACCGTGTGCGCATTTTC
GAAAGCGGTCTGCGTTTCGTACCAGATACTCAGGCACCGTTGGGCATTCGTCAGGATCTG
ATGTTAGCCGGTGTGATTTGCGGTAACCGTTACGAAGAGCACTGGAACCTGGCAAAAGAG
ACCGTTGATTTCTATGATTTGAAAGGCGATCTTGAATCCGTTCTCGACCTGACCGGTAAA
CTGAATGAGGTTGAGTTCCGTGCAGAAGCGAATCCGGCACTGCATCCGGGGCAATCCGCA
GCGATTTATCTGAAAGGTGAACGTATTGGTTTTGTTGGGGTTGTTCATCCTGAACTGGAA
CGTAAACTGGATCTTAACGGTCGCACTCTGGTGTTCGAACTGGAGTGGAACAAGCTCGCA
GACCGCGTGGTGCCTCAGGCGCGCGAGATTTCTCGCTTCCCGGCGAACCGTCGTGACATC
GCGGTGGTGGTCGCAGAAAACGTTCCCGCAGCGGATATTTTATCCGAATGTAAGAAAGTT
GGCGTAAATCAGGTAGTTGGCGTAAACTTATTTGACGTGTACCGCGGTAAGGGTGTTGCG
GAGGGGTATAAGAGCCTCGCCATAAGCCTGATCCTGCAAGATACCAGCCGTACACTCGAA
GAAGAGGAGATTGCCGCTACCGTCGCCAAATGTGTAGAGGCATTAAAAGAGCGATTCCAG
GCATCATTGAGGGATTGAACCTATGGCGCTTACAAAAGCTGAAATGTCAGAATATCTGTT
TGATAAGCTTGGGCTTAGCAAGCGGGATGCCAAAGAACTGGTTGAACTGTTTTTCGAAGA
GATCCGTCGCGCTCTGGAAAACGGCGAACAGGTGAAACTCTCTGGTTTTGGTAACTTCGA
TCTGCGTGATAAGAATCAACGCCCGGGACGTAACCCGAAAACGGGCGAGGATATTCCCAT
TACAGCACGGCGCGTGGTGACCTTCAGACCCGGGCAGAAGTTAAAAAGCCGGGTCGAAAA
CGCTTCGCCCAAAGACGAGTAATCTGATCTAACTAAAAAGGCCGCTCTGCGGCCTTTTTT
CTTTTCACTGTCGAAGAGTCACCGTAAAATCAACGCCATGACACTTCAGCAGAACGGATA
CCATGCTGACACTTGCCCGCCAACAACAGCGACAAAATATTCGCTGGTTATTATGCCTGT
CAGTTTTGATGCTGCTGGCGCTTCTCTTAAGCCTTTGCGCCGGTGAACAATGGATCTCGC
CAGGTGACTGGTTTACTCCTCGTGGCGAACTGTTCGTCTGGCAAATTCGCCTGCCACGTA
CGCTGGCTGTATTGCTGGTTGGTGCGGCGCTGGCTATATCCGGCGCTGTAATGCAGGCGT
TGTTTGAAAATCCTCTGGCAGAACCTGGACTACTTGGCGTCTCTAACGGCGCAGGCGTGG
GGCTTATCGCCGCGGTATTGCTTGGGCAAGGGCAACTCCCCAACTGGGCGCTAGGGCTGT
GTGCGATTGCTGGCGCGCTTATCATCACTTTAATACTCTTACGTTTCGCCCGTCGTCATC
TTTCGACCAGTCGGTTATTGCTGGCTGGCGTTGCATTAGGGATTATCTGTAGCGCACTAA
TGACGTGGGCTATCTACTTTTCCACCTCAGTTGATTTGCGTCAGCTGATGTACTGGATGA
TGGGCGGTTTTGGCGGCGTAGACTGGCGGCAAAGCTGGCTGATGCTGGCATTGATCCCCG
TGTTGTTGTGGATCTGTTGTCAGTCCAGGCCGATGAATATGTTAGCACTTGGCGAGATCT
CGGCGCGGCAACTGGGTTTACCCCTGTGGTTCTGGCGCAATGTGCTGGTGGCAGCGACCG
GCTGGATGGTTGGCGTCAGTGTGGCGCTGGCGGGTGCTATCGGCTTTATTGGTCTGGTGA
TCCCCCATATTCTCCGGTTGTGTGGTTTAACCGATCATCGCGTATTACTTCCCGGCTGCG
CGCTGGCAGGGGCGAGCGCATTGCTGCTGGCCGATATTGTAGCGCGCCTGGCATTAGCTG
CCGCAGAGCTGCCTATTGGCGTGGTCACCGCAACGTTAGGTGCGCCGGTGTTTATCTGGT
TATTGTTAAAAGCAGGACGTTAGCCGCAAAAAGACGGTCTATGATTAAAAGCTAAGATTT
TTACTGACCACACCCAGGAGAAACGATGCAAGATTCCATTCTGACGACCGTAGTGAAAGA
TATCGACGGTGAAGTGACCACGCTGGAGAAGTTCGCCGGTAATGTGCTGTTGATTGTCAA
TGTCGCCTCAAAGTGTGGCTTAACGCCGCAATATGAGCAGTTGGAGAATATTCAGAAAGC
CTGGGTCGATCGAGGTTTTATGGTGCTGGGATTCCCGTGCAACCAGTTTCTGGAACAAGA
ACCGGGCAGCGATGAAGAGATTAAAACTTACTGTACCACCACATGGGGGGTGACGTTCCC
GATGTTCAGTAAGATTGAAGTTAATGGCGAAGGACGCCATCCGCTGTATCAAAAATTGAT
TGCCGCAGCGCCGACCGCAGTCGCGCCGGAAGAGAGCGGATTCTATGCCCGTATGGTCAG
CAAAGGCCGTGCACCGCTGTACCCGGATGATATTTTATGGAATTTTGAAAAATTCCTGGT
TGGCAGGGACGGAAAAGTCATCCAGCGTTTTTCCCCGGATATGACGCCGGAAGATCCCAT
TGTGATGGAAAGCATTAAACTGGCGTTGGCAAAATAATGTCTATTGTGATGCAGTTACAA
GATGTTGCGGAATCTACCCGCCTGGGGCCGCTTTCTGGCGAGGTTCGGGCTGGGGAGATC
CTGCACCTGGTGGGGCCGAATGGCGCGGGTAAGAGTACCTTACTGGCGCGAATGGCCGGA
ATGACCAGCGGTAAGGGAAGCATTCAGTTCGCGGGGCAACCACTGGAAGCATGGTCCGCA
ACAAAACTCGCGCTGCATCGCGCCTATCTTTCACAACAGCAGACGCCGCCGTTTGCAACG
CCGGTCTGGCACTACCTGACACTGCATCAGCACGATAAAACGCGTACCGAACTACTGAAT
GATGTCGCAGGGGCGCTGGCTCTTGATGACAAACTCGGACGTAGCACCAATCAACTTTCC
GGCGGTGAATGGCAACGCGTACGTCTTGCTGCGGTGGTGTTGCAAATCACACCACAAGCC
AATCCCGCAGGCCAATTGCTGCTTCTTGATGAGCCGATGAACAGTCTTGATGTTGCGCAA
CAAAGTGCGTTAGACAAAATTCTGAGCGCGCTGTGTCAGCAAGGACTGGCGATTGTGATG
AGCAGTCACGATCTCAACCACACATTGCGTCATGCGCATCGGGCGTGGTTGCTAAAAGGT
GGAAAAATGCTGGCCAGTGGACGCAGGGAAGAGGTGCTCACGCCGCCAAATCTGGCGCAG
GCCTATGGGATGAATTTTCGCCGTCTGGATATCGAAGGTCACAGAATGCTGATTTCGACC
ATCTGATTTCATTAGTATCTTGAAAATCGGGTAATTACGACGCTAAATTAATGCAAGAAT
AAAAAACAGAGGAACCGTACGGAATGCGTTTCTGCCTTATTTTGATCACAGCACTGCTTC
TGGCCGGGTGTAGCCACCATAAAGCACCGCCGCCAAATGCCAGACTTTCTGATTCGATTA
CCGTTATTGCCGGTTTGAACGACCAGCTACAAAGCTGGCATGGCACGCCGTATCGTTATG
GTGGCATGACGCGGCGCGGTGTGGACTGTTCGGGATTTGTGGTTGTGACGATGCGCGATC
GTTTCGATTTGCAGCTGCCCCGTGAAACCAAACAACAAGCCTCTATTGGCACGCAAATTG
ATAAAGACGAGTTGCTGCCAGGTGACCTGGTCTTTTTCAAAACGGGGTCCGGACAAAATG
GTTTGCATGTAGGTATTTACGATACCAACAACCAATTTATCCACGCCTCTACCAGCAAGG
GAGTGATGCGTTCCTCACTTGATAATGTCTATTGGCAGAAAAATTTCTGGCAGGCGAGAC
GAATCTAGTATGTCGAAAAATGGACGGCGATGATACATCGCCGTCCATTTACTCCTGAAT
ACAGTAGTATTTTGCAGACAAAAATTCCGTAAATGGATTATTCGTTTATAATCAGGATAA
TCTAAAAAAAGGACCCCTGAAAAAGTGGTTAACATGGAACAAATGAAAGTTACTCCTTCT
GTAATTGTTATGTCTTATGGCCTCATCCCTTTTAGCCGGATACTGAAAAACATCCTTCGA
GAGGGACGGTTACCATGAAGATTTTTTTGGAGAATCTTTATCATTCTGATTGCTATTTCC
TGCCGATAAGAGACAACCAGCAAGTCCTTGTCGGCGTTGAGTTAATTACCCATTTCTCCA
GTGAAGATGGTACGGTTCGTATCCCGACGAGTCGGGTTATAGCGCAACTTACCGAGGAGC
AACATTGGCAATTATTTTCAGAGCAGTTGGAATTACTAAAATCATGCCAACATTTTTTTA
TTCAACATAAACTCTTTGCCTGGCTTAATTTAACGCCACAAGTGGCTACATTATTATTAG
AGAGGGATAATTACGCAGGCGAACTATTAAAATATCCGTTTATTGAACTGTTGATTAATG
AGAATTACCCGCATCTCAATGAAGGAAAAGATAATCGCGGTCTTTTATCCTTATCGCAAG
TGTATCCCCTTGTGTTAGGTAATTTGGGAGCAGGCAATAGCACAATGAAAGCGGTTTTTG
ATGGTCTTTTCACCCGCGTCATGCTGGATAAAAGTTTTATTCAGCAACAAATCACGCACC
GCTCCTTCGAACCGTTTATTCGTGCGATCCAGGCGCAAATTTCCCCTTGTTGCAATTGCA
TCATTGCGGGAGGCATTGATACGGCAGAAATATTGGCACAGATTACCCCCTTCGATTTCC
ATGCTCTCCAGGGATGCCTGTGGCCTGCCGTTCCCATAAATCAGATAACGACGTTGGTTC
AGCGATAACCCTTCTGTTTGCTGGTGTTTAAGACGAGAGTAACCGTCTACACTATCAAAC
AGGAGGATCTATGACCCTGTCTTTTGTTACCCGCTGGCGCGATGAATTGCCAGAAACCTA
TACAGCACTTTCCCCTACGCCTTTAAATAATGCCCGGCTGATTTGGCATAATACCGAACT
GGCTAACACGCTGAGTATTCCATCGTCGCTGTTTAAAAATGGCGCAGGTGTCTGGGGCGG
CGAAGCCCTACTGCCTGGTATGTCACCACTGGCGCAGGTTTACAGTGGTCATCAGTTCGG
CGTCTGGGCGGGCCAACTGGGTGATGGGCGCGGCATTTTACTCGGCGAACAACTGCTTGC
TGATGGCACTACAATGGACTGGCATCTGAAAGGTGCTGGCCTGACGCCTTATTCGCGAAT
GGGTGATGGACGGGCGGTTTTACGTTCGACGATACGAGAAAGTCTCGCCAGTGAGGCGAT
GCATTATCTGGGCATTCCGACGACCCGCGCGTTAAGTATCGTCACCAGCGATTCGCCAGT
GTATCGGGAAACGGCGGAGCCAGGCGCGATGCTGATGCGTGTGGCACCAAGTCATCTGCG
CTTTGGTCATTTCGAACATTTTTACTACCGCCGCGAGTCGGAAAAGGTTCGTCAGTTAGC
TGACTTTGCTATTCGTCATTACTGGTCACATCTTGCAGATGATGAGGACAAATACCGTCT
CTGGTTTAGCGATGTTGTCGCACGTACCGCGTCGTTAATTGCCCAATGGCAGACGGTCGG
CTTTGCTCATGGGGTGATGAATACCGACAACATGTCGCTGCTGGGGCTGACGCTTGATTA
CGGGCCGTTTGGTTTTCTTGATGATTACGAACCCGGTTTTATTTGTAATCACTCGGATCA
TCAAGGGCGTTACAGCTTTGATAATCAACCTGCCGTCGCGTTGTGGAATTTACAGCGTCT
GGCGCAGACATTGTCGCCATTTGTTGCCGTAGATGCCCTGAATGAGGCCCTGGACAGCTA
TCAGCAGGTTTTGTTGACGCATTATGGAGAACGGATGCGGCAGAAACTGGGCTTCATGAC
GGAGCAAAAAGAGGATAACGCGCTACTGAATGAATTATTCAGTCTGATGGCGCGAGAGCG
CAGCGATTATACCCGCACATTCCGCATGCTGAGTCTGACCGAGCAGCACAGCGCGGCGTC
ACCGCTACGTGATGAGTTTATTGATCGTGCGGCATTTGATGACTGGTTTGCCCGTTATCG
GGGGCGTTTGCAACAAGACGAGGTTAGCGATAGTGAGCGTCAGCAACTGATGCAAAGCGT
TAACCCCGCTCTGGTATTGCGCAACTGGTTGGCGCAACGGGCGATTGAAGCGGCAGAAAA
GGGTGATATGACGGAATTGCACCGCCTGCATGAGGCGTTGCGAAATCCTTTCAGCGACAG
AGATGATGACTATGTCAGTCGTCCACCTGACTGGGGTAAACGGCTGGAAGTCAGCTGCTC
GAGTTAAAGGCTACTTGGTCAACAGCAGCTTGCCAGCCTGAGTTTTACGGAGCAGATATT
CTTGCCCGTCATGATCGATAATCAGTTTGCCATCCGGACCTAACAGTGTCTGGCTGGAAA
TTCGCCGAATAGGCTGCGGGGAAGCGGTCTTGTGATTGGCATCCGTTTCAGGCGTGAGTT
TTCTGCTATCCGTATAACGCATAAAAATTAATAATAATTGATATAACAATGATTCTTATT
ATCAATATTATGGCTGACCAGAGCAAGCAGTAATTTGTTGAGAAGACAACAAGTTGCGCA
GAAATGCCCATTCCGTCAGGAATGGGCACGCATTCAGAAGCGGGTATCTACCGCAGAGGC
GAGTTTTTCGACCAGGCGTTCGGTATCCTCCCAGCCCAGACACGGGTCGGTAATGGATTG
ACCGTAAGTGAGCGGCTGACTGCCGACGATTTTTTGCGTTCCTTCGCGCAGGAAACTTTC
CGCCATAATTCCAGCAATCGCCGTAGAGCCATTGCGGATTTGCTGACAAATATCCTCACA
AACTTCTAACTGGCGACGGTGCTGCTTCTGGCAGTTACCGTGGCTGAAATCCACCACCAG
ATGTTCAGGTAAATCAAACTCGTGCAGCGTATCGCAGGCTGCGGCGATATCATCGGCATG
ATAATTCGGTTTTTTGCCGCCACGCATAATAATGTGGCCATACGGGTTGCCGCTGGTCTG
ATAGATGGTCATCTGACCATTTTTGTCTGGCGAGAGGAACATATGGCTGGCGCGGGCTGC
GCGGATAGCATCCACAGCAATCCGCGTATTGCCATCGGTACCATTTTTAAAACCTACCGG
ACAGGAGAGTGCCGAAGCCATTTCGCGGTGGATCTGACTTTCGGTAGTACGTGCGCCAAT
CGCGCCCCAACTGATTAAATCAGCAATAAACTGACCGGTCACCATATCGAGGAACTCGGT
CGCGGTTGGGACGCCCAGCTCATTTACCTGTAAAAGTAATTTGCGCGCCAGCTCCAGACC
GTGATTTACCCGATAGCTGCCGTTTAAATCTGGATCGGAGATTAGTCCTTTCCAGCCGAC
AACAGTTCGTGGTTTTTCAAAATAGGTGCGCATTACGATTTCCAGCCGTGACTGGTACTG
GTTGCGCAGCGACTGCAGACGGGTGGCGTACTCCATTGCAGCGGTGAGATCGTGGATCGA
GCAGGGGCCAATAATGACCAACAGTCGCTTATCTTCACCATTCAGTATTTTTTCAATTCT
GCGGCGGGAGTCGGTGACATGGGTGGCGACGCCAGGCGTTACGGGATACCGTAGCGCGAG
TTCGGCGGGCGTTACCAGGCTCTCAATACGCGCAGTACGGAGTTCGTCAGTTCTGTTCAT
TACAAGTCTCAGAAATTTGTTGCTTCTACGGCAGGACTGCCGGGAAGTGATGCGCATCAC
GATAAACCAATCGCTGCTGATTTCAAGTGCGAGGTGTGTCACACCTCGCCGGGTGGTTAG
CATGATAACAAAAAAATAAGCTAATGCACTAGTTCTCTAGTACATTCGGCGACTAAGGCC
CATGATATCGAGGATCTTGGTGGCAATCTCTTCTACCGAATAATTGGTACTGTTAATCCA
CGGGATCTGATTTTTACGGTACAAGGCTTCCACTTCCGCGACTTCCATCCTGCACTGACG
AAGCGAGGCATAGCGACTGTTCTCCCGACGTTCCTCGCGAATCGCCGCCAGACGTTCCGG
GTCGATAGTCAGGCCGAACAATTTATGCTGAAGCGGTTTGAGCGACGCGGGTAGCACCAG
ATTATCCATATCGTCGGCAATAAAGGGGTAGTTTGCCGCGCGGATACCAAACTGCATTGC
CAGATACAGACTGGTGGGGGTTTTACCACAGCGAGAAACACCGAGCAGGATCACCTGAGC
CTGGTCCAGATTGCGCAACGAAATGCCGTCATCGTGGGCGAGGGTGTAATCAATCGCCGC
AATGCGCGCATCATATTTATTGAGATTATTAGGGTTAAGGCCATGGGTACGATGAGCAAT
CGGCGTTGGATCCAGTTTCATCTCTTGTTGTAGCGGGGCAACCAGCGCCTGAACGATATC
CTGGCAAAAGCCTTCACTTTGCAAGATGATGGCGCGAATCTCCGGCAACACGATGGAGTA
GAAGACCAGCGGGCGCACGCCTGTCTGGTGATAAATTGCGTCAATCTGATCCTTCACTGC
CCGTGCACGGCTCTCATTTTCGACAAACGGCAGCGTGATGCTGCTGATAGTGACGGGAAA
TTGTGACATTACTGCGTGTCCTAATACCTCCGCAGTTATTGCCGTACCATCAGAAATATA
AAAAACGTGGCGATCAACAGCATTATCCATTTTGTTCTTCCCGTGATGCAGACATAATTC
TATGAAAGCATAAATTAAAAACGCACAGAAGCGTAGAACGTTATGTCTGGTTTATAAAAT
GAACCTTCAATTTTATTTTTTATGAAAACAGCATTTCATTTTTATGGTTTCGTTTATACC
GATGGTTTATGTGGAAATTGTCGAAGAGAGCAGATTTGCGCAACGCTGGGATCAGTCTTA
AAAAGTAAAAAAATATATTTGCTTGAACGATTCACCGTTTTTTTCATCCGGTTAAATATG
CAAAGATAAATGCGCAGAAATGTGTTTCTCAAACCGTTCATTTATCACAAAAGGATTGTT
CGATGTCCAACAATGGCTCGTCACCGCTGGTGCTTTGGTATAACCAACTCGGCATGAATG
ATGTAGACAGGGTTGGGGGCAAAAATGCCTCCCTGGGTGAAATGATTACTAATCTTTCCG
GAATGGGTGTTTCCGTTCCGAATGGTTTCGCCACAACCGCCGACGCGTTTAACCAGTTTC
TGGACCAAAGCGGCGTAAACCAGCGCATTTATGAACTGCTGGATAAAACGGATATTGACG
ATGTTACTCAGCTTGCGAAAGCGGGCGCGCAAATCCGCCAGTGGATTATCGACACTCCCT
TCCAGCCTGAGCTGGAAAACGCCATCCGCGAAGCCTATGCACAGCTTTCCGCCGATGACG
AAAACGCCTCTTTTGCGGTGCGCTCCTCCGCCACCGCAGAAGATATGCCGGACGCTTCTT
TTGCCGGTCAGCAGGAAACCTTCCTCAACGTTCAGGGTTTTGACGCCGTTCTCGTGGCAG
TGAAACATGTATTTGCTTCTCTGTTTAACGATCGCGCCATCTCTTATCGTGTGCACCAGG
GTTACGATCACCGTGGTGTGGCGCTCTCCGCCGGTGTTCAACGGATGGTGCGCTCTGACC
TCGCATCATCTGGCGTGATGTTCTCCATTGATACCGAATCCGGCTTTGACCAGGTGGTGT
TTATCACTTCCGCATGGGGCCTTGGTGAGATGGTCGTGCAGGGTGCGGTTAACCCGGATG
AGTTTTACGTGCATAAACCGACACTGGCGGCGAATCGCCCGGCTATCGTGCGCCGCACCA
TGGGGTCGAAAAAAATCCGCATGGTTTACGCGCCGACCCAGGAGCACGGCAAGCAGGTTA
AAATCGAAGACGTACCGCAGGAACAGCGTGACATCTTCTCGCTGACCAACGAAGAAGTGC
AGGAACTGGCAAAACAGGCCGTACAAATTGAGAAACACTACGGTCGCCCGATGGATATTG
AGTGGGCGAAAGATGGCCACACCGGTAAACTGTTCATTGTGCAGGCGCGTCCGGAAACCG
TGCGCTCACGCGGTCAGGTCATGGAGCGTTATACGCTGCATTCACAGGGTAAGATTATCG
CCGAAGGCCGTGCTATCGGTCATCGCATCGGTGCGGGTCCGGTGAAAGTCATCCATGACA
TCAGCGAAATGAACCGCATCGAACCTGGCGACGTGCTGGTTACTGACATGACCGACCCGG
ACTGGGAACCGATCATGAAGAAAGCATCTGCCATCGTCACCAACCGTGGCGGTCGTACCT
GTCACGCGGCGATCATCGCTCGTGAACTGGGCATTCCGGCGGTAGTGGGCTGTGGAGATG
CAACAGAACGGATGAAAGACGGTGAGAACGTCACTGTTTCTTGTGCCGAAGGTGATACCG
GTTACGTCTATGCGGAGTTGCTGGAATTTAGCGTGAAAAGCTCCAGCGTAGAAACGATGC
CGGATCTGCCGTTGAAAGTGATGATGAACGTCGGTAACCCGGACCGTGCTTTCGACTTCG
CCTGCCTACCGAACGAAGGCGTGGGCCTTGCGCGTCTGGAATTTATCATCAACCGTATGA
TTGGCGTCCACCCACGCGCACTGCTTGAGTTTGACGATCAGGAACCGCAGTTGCAAAACG
AAATCCGCGAGATGATGAAAGGTTTTGATTCTCCGCGTGAATTTTACGTTGGTCGTCTGA
CTGAAGGGATCGCGACGCTGGGTGCCGCGTTTTATCCGAAGCGCGTCATTGTCCGTCTCT
CTGATTTTAAATCGAACGAATATGCCAACCTGGTCGGTGGTGAGCGTTACGAGCCAGATG
AAGAGAACCCGATGCTCGGCTTCCGTGGCGCGGGCCGCTATGTTTCCGACAGCTTCCGCG
ACTGTTTCGCGCTGGAGTGTGAAGCAGTGAAACGTGTGCGCAACGACATGGGACTGACCA
ACGTTGAGATCATGATCCCGTTCGTGCGTACCGTAGATCAGGCGAAAGCGGTGGTTGAAG
AACTGGCGCGTCAGGGGCTGAAACGTGGCGAGAACGGGCTGAAAATCATCATGATGTGTG
AAATCCCGTCCAACGCCTTGCTGGCCGAGCAGTTCCTCGAATATTTCGACGGCTTCTCAA
TTGGCTCAAACGATATGACGCAGCTGGCGCTCGGTCTGGACCGTGACTCCGGCGTGGTGT
CTGAATTGTTCGATGAGCGCAACGATGCGGTGAAAGCACTGCTGTCGATGGCTATCCGTG
CCGCGAAGAAACAGGGCAAATATGTCGGGATTTGCGGTCAGGGTCCGTCCGACCACGAAG
ACTTTGCCGCATGGTTGATGGAAGAGGGGATCGATAGCCTGTCTCTGAACCCGGACACCG
TGGTGCAAACCTGGTTAAGCCTGGCTGAACTGAAGAAATAAAATAAATCCCCGGCGGCGT
TTAGTCGCCGGGGTTATGTGATCCCCGAAGATGAAACTTATTCAATCTCTTCACAGACAT
CCTGCGTTAAACGCCGCATAATATCTTTTCTTAACAAAAACTTTTGTATTTTACCTGAGG
TAGTTCGCGGTAGTTTTTCGATTACCACGATATGTTCAGGATATTTATATTTTGCGACCC
GTTTACGGCTAAAAAAAGCCACTACCTCTTCCAGCGATAATGAATGATGCGGCGCTTTCA
GCACGACATAAGCGCATGATCGTTCACCTAAACGTTCATCGGACATTGCAACCACACAGG
CATCGTGAATTTTAGGATGCTGCAATAAAATATCTTCCACTTCACGGCTGCTAATATTTT
CGCCGCCGCGGACAATAATATCTTTTTTGCGTCCGGTAATTTTTATATAGCCAGCCTCAT
CCATACGGCAGAGATCGCCGCTGTAATACCAGCCTTCTTCATCCAGGGCACGGGCGGTTA
ATTCAGGTTCATCAAAATACCCCATAAACACATTGGGGCCACGCGAGGCTTCTTCACCTT
CGCAACCTGGCGGTAAGGTCTTGCGTGCGTCATCGACCACTTTAATCTCTACACCTGCGG
CAGCGTAACCATCGGTGTGCATAAAGCGCGACAAAGGATCATCGAGATTCACCACCGCAT
GCGGCGAACTTTCTGTGGAACCATAAACACTTAATAATTTAATGCCGCGCTGCTGGCATT
CACGCGCCACTTTTTTGGGGATTGTGGTTCCGCCGCAAAGAAAGAAACGCAGCGCTGAAA
GGTCCGCGGGTTGTTTCTCTAGTACATTCAAAAGATCATAGACAAACGGCGTTGCGCCGA
GCATACAGGTGCAACGCTGCTGCTCAAGCAGCGCGAGACACGCATCAGGAGTGAAAATAT
CTAACAACACGCTGCGAGCGCCAATTAAGAATGGTGCCGTTACGCCATGCAGAAAGCCCG
TTGCGTGACCAAGTGGCGCAGGCATCATAAAGACATCCTGCCAGGTCAGATTCAGTCGCG
CGCAATAAGCCCGCTCACTGGCGAGAATATTGTTATGCGTTAGCATCACGCCCTTTGGCA
GACCCTCGGTTCCGGAGGTAAACAGCACCGCAGCTAATTCATCGCCGTGGGTCGTTATCG
CCGTGGTCAGTGAGGTATTGTCGGCGATAATCTGACTTAATGAGAGGGAAGAGGTGGCGG
GAGCCAGTTTGTCCACGCCGACAATTTGTTGTAGTTGTGGAAGCTGATTTTGCAGCGGCA
GGATTAAATCTACCGGACGCGTTTGTTTAAACAACGTCGGTGCAAAGAACATTTTTGCCT
GACACTTATTGAGCACCCACACCAGTTCTGCTTCCCGCCAGGAAGGCAACAGCGGCACGG
AAACTGCACCGATTTTCAGGCAGGCAAGATAGATAACGGTAAATTCACACCAGCCAGGCA
GTTGAAATGCGATGCGATCGCCTGATTCAATACCCTTCGCTAACATCCAGTTTGCCAGAC
AGCTCGCGGCGTGATCGAGCGCGCTATAGGTGTACGATGCACCATGATTATCGACCACGG
CAATTTTGTCTGGCATCGCACGAGCGGTCTGCTGCCAGTAATCGGCCAGCGAAGCATCGC
CCCATAACCCTTGCTGACGATACGCCGCACGACGTTGTTCGTTAAACGTTAATGTCACTT
TCATGTTGGACTCTCGAAACAGAACATCAGGCCCGAGATGCGGGCCTGTGGGATGCATGA
TTAGCCGTAGCGAAAATCAATACCGAAGGTGCCTGCGGGATATTGCCACTGTTCGAGAAT
AGTGTTACCGCACAGCACCCGACAGGTGCCGCACTCCAGACAACCGGCGGAATCAAAATG
AATGTTTCCTGCGTCATCCTGCTTATAAAGTCCGGCAGGGCAGGCTTTCATTAATTTATG
GAATTCATTGATATCGGGATTTTCCGCCAGAATGATATGCGGGTGGCCCTCATCAACATG
GAATTTATTGACGCCTAATTTGATGTCGACGTTAACCGTAGCGTTCTGGCTCATAGCGCG
GTTGCTCCCTTAATGCCATCTTTCAGCAAGTTGATCAGCCCAATTTTCTTCGCATGTCCC
ATGATCATTTTTCGTACCGGCTGGTTTGGTTTGCCGTCGATGGTGAACATCTCGTTCATG
ATGTCGGCTACCATTCGTGGGTATTGGCTAAACAGGCGCGGGTTTTCCATCAGCGCCGGG
ATCTTGCGAAAATGCTGCATATCACGCATGACGCAGCTTTGTTCCAGCTCACGTTTGTAT
TGCGCCAGACTGCTGGCGGAGAAATCCGCGCGTTCTTTGGCGGCGATCACCGTTGTGGCG
GCAGCCTGAGCCGATGCAATGGCTAAATCCATGCCGCGGACCGTAAAACCCAAATTCAGG
CAGAAGCCTGCGGCGTCACCAACGATCATCACGCCCTCGTTAACCAGTTGCGGCACCATT
GCCAGACCGCCTTCCGGCACCATATGCGCGGAATATTCAAGCAGTTTGCCGCCGCTAATC
AGCGGGCGAATGGCGGGGTGTTGTTTAAAATCTTCCAGCATTTGCGGCACGCTTTTTTGC
GCATGGGCGATATCACCCAATCCACAAACCAGCCCCAAGGATATGGAATCCTTGTTGGTA
TAGAGAAATCCCCCGCCCATCAGGCCGTCAGAAGGGGAACCGGCAAACAGCCAGGCGGCA
CCTTCCTCGCCCGTAATATTAAAGCGATCGTTGATCTGTTCTGGTGTGAGGCCAATAACC
TCTTTAACACCAACAGCGTAATGATGCGGATCGGAAGCGGGAACCATTCCCAGCGAGCGG
CCAAGCATCGAGTTAACGCCATCAGCCAGAATCACCACATTCGCTTCGAGAATATCATCC
CCAGCCTGCACGCCAGTGACCTTGTTTCCTTCACGAACCAGCGCGTCGACGCGAACGCCT
GGGATAAACTGCGCGCCCGCCTGCTCGGCTTGTTCCATCAACCACGGGTCCAGACGATTA
CGCAATACGGTATAAGATGCGTGTTGCGGAACATCTGGCTGCTCGCGGTGAAAATCGAGG
GTAACGGCGCTTTCTTCGGTTAAGAAGGAGATTTTCTCGCGTGTGACCTTGCGTTCTACC
GGCGCTGATACTGCAAAGCCTGGAATGATTGCTTCAAGTGTGTGGGCATAAAGACGCCCG
CCGGTCATGTTTTTACATCCGGCACTGTCGCCGCGTTCTATCACCAGGACATCCAGCCCG
GCTCGTGCCATGACCAGTGCGGCAACGCTACCAGCAACGCCCGCACCGACCACAATGGCA
TCAAATTTGTCATCCGACATGCGTTATGCTCCCTTCCCGCTGCGTTTACAGCGGGAGATG
TGGTTGAAAGGGGAATTAGCGGCTCAACTGGCTAATCAGGGCAGGGACGACTTTGTAGAT
ATCGCCCACCAGACCGTAGTCGGCATAGTTGAAGATTGGCGCATTTTTATCTTTATTGAT
GGCGACAATCACTTTTGCGCCGTTGCCGCCAACCATATGCTGGATCTGCCCGGAGATCCC
CAGCGTCAGGTAGAGATCGGATTTCAGCAACACGCCGGAGACACCGATATAACGTTCACG
CTCCATCCAGTTCTCGCCTTCGGCAATTGGACGTGAACAGCCGACTTCAGCATTCAGCAC
CGCCGCCAGTTCGTGGACCATTTTTAGGTCATCCTGCGCCGCCAGTCCACGACCGACGCC
AACCACACGTTTTGCTTTGCTCAGGTCCACGCTGCTTGCGGCTTTCGCACGGCGTTCGCG
ACAGAGAATTTCATGACGCGGAGCAACATAAGGTACCGTTTCTGTCGGGCACTGATGAGA
GGTATCACTGGTGCACGGTTCCTGAACACCGGGTGCAAGGGTAATGATCGCCAGCGGGCT
GTTGATCTTTTCCTGAGCGAACGCTAACCCGCCATACATCCGGTGTTCGGCGCAAATGTG
ACCATCGACAATATCCACCGCCGTGGCATCGTTCACCAGCGCCGCATTCAGTTGCACACT
TAACCGTGCTGCCAGCGCTTTACCACGTTTCGTCGCGGCCAACAGCAACATAGCGGGGTG
TTTATCTTTCAGCAGGGCAGCAATGCTTTCGGCGTAATTTTCAGTGCGTTGCAGCGCGTC
GTTTTGCGCAAGAACATAAAGACATTTTGGACCATAAGGCATAACTGCCTGCGCCTGGTC
GGTATTTTGTACAATGGCATACACCTGTTGGCCCCATTGCTGAGCGCCGCCAAACAGTTC
AGCATAACGTTCAGGATTATCGCTAAAGACCCAGACGCTGTTTAATTGACTCATCGTTTC
TTCTCCGTAGGCTTCAGTTCAGGGCTTTCTTCAGATGTTCCGCCAGCTCGGCAATGGCCT
CCGGCGAATCGTTATCGATAATGATGTGCTTACGTTCTGTTTGCGGCGGTACGCGAATGC
CGACCAGTTCAGCAAGTGGCGCGCTCTGGCTCCAGTCAATATCACTTGCCTGCCACTGAT
TTACCGGTTTTTTACCCGCGCCGAGAATGGCTTTCATCGAAGGAATGCGTGGCACGTTAA
TATCGGAGGTGACGCAGAGCACGGCTGGAACAGAGAGTTCAATAACTTCAACATCATCTT
CAAGCGTGCGTTCAATCACCAGTGTATTGCCCTGACGCTGAATAGCACTCACTGCATTAA
TCACCGGAAGTTGCAGAATTTCTCCGACCAGCAAGCCAACCTGCTGGGCATAAAGGTCGC
CGGAACCTTCACCAAAGATCAGTAAATCGAAGCCGATCTTTTCAATTGCTGCCGCCAGCG
CTTTTGCGGTATCGAGAGGCAGTGCATGTTCAAGTTGCGCATCCTGCACCAAATACAGGC
TGTGCGGCCCGCGGGATAGCACGTCTTTGCGCACTTTCGAGTTCTGCAACAATGAGCCGC
CAACGGTCAGCGCGGCTATCTCATCGTCATCTGTTGCGAGCTGGCTTGCAGCTTCAATGG
CATTGAGATCGAACTGGCTGATTTTGGCGTCGGCATTGTCGAAATTCAGGGTGTATTCTG
GAGTGACAACAATGTCCTGTTCTTCAGGCACCAGCTTAAAGCAGGTTATTATTTTCATGA
TTTCTCCTGTGAGTCGCATACGGAACCATCTCCGATGGAAGGTAAAAATGGCCTGAAAAT
AGTGTGCGATAGCGGTGCGGGGTTTTCGACGGAGCAAGCTGTTTTCCTTGCCAACAATCT
TGCAAAAAAAATGCGATCGCTAAAACAAAAGTGCAATTTGCGGCAATATAGTTATTCCAT
GACCGTACAATCTTGCATTCAGTGTAAATAATCTTGTTTAGCTCTCGCTAAACGCGGTTG
TATAACCGCAATACACGCCGTATTTTATCCGGCATATATTGTTTTTGCTTGCTCATGGAA
TAGGGAGGTTGTCATGTATCAACGCTGTTTTGATAACGCCAGTGAAACGCTGTTTGTCGC
CGGTAAAACGCCACGGCTTTCACGTTTTGCATTTAGCGATGATCCAAAATGGGAGTCCGG
ACATCACGTTCATGACAATGAAACCGAGTTGATTTACGTCAAGAAAGGGGTTGCAAGGTT
TACCATCGATTCTTCGTTATATGTCGCACATGCGGATGACATTGTGGTGATAGAACGCGG
CAGGCTGCATGCGGTGGCCTCTGACGTTAACGATCCGGCAACGACGTGTACCTGTGCGCT
GTACGGCTTTCAGTTTCAGGGGGCTGAGGAAAATCAGCTACTGCAACCGCATTCTTGTCC
GGTAATTGCCGCGGGGCAGGGAAAAGAAGTCATAAAAACCTTATTTAATGAGCTAAGTGT
GATTTTGCCGCAAAGTAAAAATAGCCAAACATCTTCGTTATGGGATGCATTTGCCTATAC
GTTAGCCATTCTTTACTACGAAAATTTTAAAAATGCTTATCGTTCGGAGCAGGGGTATAT
TAAAAAAGATGTTCTGATAAAAGATATTCTTTTCTATCTGAATAATAATTATCGCGAAAA
AATCACTTTAGAACAGTTATCGAAAAAATTTCGTGCCAGCGTCAGTTATATTTGCCATGA
ATTTACCAAAGAGTATCGTATTTCCCCTATTAACTATGTTATTCAACGGCGTATGACGGA
AGCAAAATGGTCACTCACTAATACTGAATTATCACAGGCAGAGATCTCCTGGCGTGTGGG
TTATGAAAATGTCGATCACTTTGCCAAACTGTTTTTGCGCCATGTCGGTTGTTCGCCCAG
CGATTACCGTAGACAATTTAAAAACTGTTTTGCGGAACAAGAAATCCTATCTGAATTTCC
TCAACCGGTAAGTCTTGTTGGATAAATCTGGCGGCGCAGTTTGTTAAGAAGCTGCGCCGC
CTGCAGATTATTTGTTCTGATAGTCTTTCAGGATCTGCCGACCTGCTACGTAAATCATAA
TTTCGTCTGTACCGCCGCCGATACGTTCACAACGGACATCACGCCAGAAGCGGGAGACGC
GCGCCTCATCGGTATAGCCCAGACCGCCCATGATTTGAATCGCATCATCAATGACTTCCA
TTGCGGTACGTGCACAGTACAGTTTTGCCAGCGCCGCGCTGGTGCGCAGTGACTGATGCT
GATCGGCTTGCCATGCCACTTTCAGCACCATGTTGCGCATGTTGTCGATCTTAATCGCCA
TCAGCGCCAGTTTTTCCTGGATCATCTGGTTATGACCAATGGGCTTACCAAAAGCGATAC
GTTGGTTGGCATAGCGGGCGGCATCTTCAAAGGCGCATTCGGCAAAGCCGGTGCTGCGCG
CGGCGTTGATCAGGCGCTCCATCTCAAAGTTGTACATCACATTGAGGAAACCCATTCCTT
CTTCGCCCACCATGTCGCTCTCTTCAACCTCCACGTTGTCGAGATAGACTTCGCAGGTGC
TGAGCATATGCCAGCCGATTTTATGCAGCGGGTTAATCTTAATGCCGGGCTTACTGGAGT
CGACCCACCACAGGGTGAAGGCTTTTTTGGGATCTTTCGGTTGCGGATCGCGCGCCAGCA
CCAGCATATACGGGTACTCTTTCGCACCGGTAATAAAGGTTTTTTGTCCGTTGATGTAGA
CCTTGCCGTTTTTACGCGTGTAAGTGGTAGTGGCACTGTTGTTATCTGAGCCAGCACCTG
GTTCCGTCAACGCCAGGGCATAGGCGGGATCACCCGTTTCCAGGGTGCTCTCTGCCGTTT
TACGTAGCTGCTCTGCAGAACCGAAACGGCGCATACTGTGAATACATTGACCGTTGGTAA
TTAAAAATGCCGGAGCACCGCATTTTGACACTTCCATCAGCGCCAGCATTTGGGTGACGT
AATCCGCAGGGATACCACCAAATTCTTCCGGCACGCCAAGCATGGAAATACCGTTATCCG
CCAGCGCCCGCATAAACTCACGCGGATATGTCCCGTTTTGATCGCAGGTGCGGAAATACT
CTTCCGGAAAGTTAGTCGTAATCAGTTCGCGAATACTGGCCAGCAGCAGTTCTTGTTCTT
CAGTTAAAGAAAAATCCATCATTATACTCCTGTTAATGAGCCGCTTCAGGCAGGACAAAA
CCCATCGCCGCATCGATAAATAATCTTTCGTCCATCAGTTTGAGTTCTGGCGAAATCACT
GGGGTGAAATCCATTTTGTCGAGAATATCTTTTTGTAAATCGACGCCAGGGGCGATTTCG
ATTAAATGCAGGCCGTCTTCTTTCAGCGTGAATACTGCGCGCTCAGTGATATAACGAACA
TCCAGCCCTCGCTCGAGAGCGATTTTTCCGCTGAAAGTAATTTCCGGTAGTTCCCGAATA
AATTTCTTCACCCGTCCTTCCTGGACGATATTTAATTTGCCGTCGGTAATTTCTGTTTTT
AAACTGCCCGCAGTTAATGTGCCGCAGAAAATGATTTTCTTCGAAGTGGCACTGATATCA
ATAAATCCACCGGTGCCCATGATTTTACCATTGAATTTATGCACGCCGACGTTACCGTGC
TGGTCGACTTCAGCAAAACTCAAATAACAAACATCCAGACCGCCACCGTGATAAAAATCA
AACTGGGACGTCATATCCAGAATGGCACGGGTATTCACGTTCGCGCCAAAGGCGATCCCC
TGTGAAGTAATTCCGCCAATCGGACCTGTTTCTACCGTCAGAATAAAGTCATCAGCACAA
CCTTCTTCTCGGGCGACCAGGCCAATGCCGTCAGCAATACCGACGCCGACATTCCCCACC
GCGCCTTTACGCATTTCGAATAATGCGCGCCGCGCAACTAATTTACGTTGGTTTAGGGGC
AGGCTAAGTTTGGTACTGTCATCAAGGGTGAAGTCACCAGAAATAAAGCGGTTAACCGGT
GCACCGCCATACAGTTGGGTTTGATCCGGATCGACCACCACAATATCCACCAGATAACCC
GGAATACGGACAGATTTAGGATGCAGCGTGGCTTTCTTAACCATTTTCTGCACCTGCATC
ATCACAATACCGCCGTTATTGTGCACCGCCTGGGCAATAACCAATGCGTCGAGATACATC
ACCTCATCTTCAAAAGTGGCGTAGCCTTCACTGTCGCAGGTGGTAGCGCGAATGAAGGCA
ATATCTGGCGCAATCGCTTTGTAATAGAGATATTCTTTGTTATCAAACTCGACCAGTTTA
ATCAGGTCTTCTTTAGTGACTTCATTCAGTTTGCCGCCTTGCTGGCGTGGATCGACAAAT
GTCCCGATGCCAATATCACTAATAATACCAGGCTGGTGGGCTGCGGCGGCGCGTAAGGTT
TGTGTAAGTACACCTTGTGGGTAGTTATAAGCAATAATTTTATTTTGTTCTGCGAGTTCA
GAAATACGCGGCGATTGTCCCCAGTGACCACATAATGCCCATTTCACCAGACCTTCTTGC
GCCAGAGGACTAATACCACGGTCGGCGCGATCGCCAAGCCCTGTTGGACTAATAATCGAT
AAATTACGTGGTGTTTGAGTCTGTTTATATTTATCAGCAAGAGCAGTAATTAACGTGGTG
GCTTCCAGAATACCGCCGCCAGCGCCTAACACACAAAGTGTTGCTTCGTCGGGAATATAA
TTCACCGCTTCCTGTGCCGACAGGACCGGCACTCGTCCATTAATACGAGGTGGTTTTACA
GGTTTCATTGTTAATTCCTGATTCAGATGTGATTTTCCCTACGCCAAATGGAGAATTAGC
GCACAGAGACTCACGAAATATTTTTATTAAATACGATTGAATATATTTTTTAGTTCGGCG
GGGAGGGTGTTCCCGCCGAAATATTATTGCTTATGCCTGGTGTAAAATAGTTAATACCGT
GCGCAAATCATTTACCGAGATTTGCCCTGGCGCAGACGCTTTTTTTACCGCACCAAAAGT
TGCCGCCGAGCCAAATACTTCACCAGCCAGACGAGAAATTACGCCAGTTTTTGCCATCGA
CATCGTGATAATTGGACGATCGGCATACTGCTCCTGCATCTCCAGGGTCGCGGCAAGCAA
CGTCAGCACATCGCTGGTACTTTGCGGCATCAGCGCAATCTTAGGAATATCGGCGTCGAA
GGATTGCATTTTGCGCAGACGGGCAATGATTTCTTCGGCTTCCGGCGTTTTATGGAAGTC
ATGGTTGGACATGACTACTTTCACATCATGCGCGTGGGCGTAGGCGACGGTTTCTTTAAC
CTGATCATCACCGGTAAATAACTCCAGATCGATCATATCAACCAGGCCGCTGTCGATGGC
TGCACGATTGAGTGCAATATAAGCCTCGGTGGAAATCGCCTGCTCGCCGCCTTCTTTGGC
ACTGCGGAAGGTAAACAGCAGCGGTTTTTCTGGCATGGTCTCACGGAGAATTTTTGCTGC
CGCCATGACAGACTCCACATTGGAGAGGTCGGCATAGTGGTCCACACGCCATTCCAGAAT
ATCAAAGTCCGCTTCACGATAGGCGAGAGCTTCGGATTTCACGCTGGCGATATCTTTCGC
CATCAGCGAGACGATGATTTTAGGTGCGCCCGTACCAATGACGAGATCTTTTACAGTTAC
GGTTTTCATTTTTTACCCTTTCTGCACGCGGTCAGCCTGTCAGGCACCGAACCCCATGAC
CTGTTTAACATATTCCAGAGGGAAATCTTTGCCAGTCCATAATGTGAACTGTTCAGCCCC
TTGCCACAACAACATGCCGTATCCATCAATCGTTTTGCAACCAGCTTGTTGCGCCTGCTG
CAATAACTTCGTCATATGCGGGTTATACACGCATTCAGTGACCAGAAGTCCCGGATGTAA
CAGACTGATATCATTAACCAATGATTCATTCTCAAGGGGTTTCATACCCACTTTTGTGCC
ATTGGTTAAAATGTCGGCGGAAGCCAGGGCTTCAGCAAAGGCTTGCTGATCGGCGAGATC
GGTGACCGTGACGACACAATCGGTGTTTTCATTAACCCGCTGCGCGAAGGCGAGGGCTTT
ATCGAAGAACTCATCCCGACGGTTAAAGAGTTTAATTTCTTTTAAACCTTCAATTGCCCC
CTGCGCGCCAATTGCCGTTGAGGCACCACCGGCCCCTAACAGCACCATCGTTTTGCCTTT
GATATCAAAACCGCTCTCTTTAATGGCGCGAATATGGCCCGTGCCGTCGGTGTTATAGCC
ACGCAGATAGCCATCATCATTAACGATGGTGTTGATGGCCCCCACCAGTTTGGCAGCTGG
TGTTAATTCATCAACATATTCACACGCCAGTTGTTTGTTCGGCATCGATACACCAGTTCC
GCGCATTTTGAGGGCTTTTAATCCTTCAATTGCTCCAGGAAAGCTATCGTTATCCACTTC
GAAGGCCATATAGGTAAATGGCAATCCCGCTTTTTCTAAGGCTTTATTCTGCATTTCGGG
CGATAAACTGTGGCGGATAGGATAGGCCATCAACCCAATCAATTCGTATTTTGCGGTAAC
ATCCATAATTAACTCCTTTAACCTCTATGCTTAATTGTGTTTAACCGGGTGCAAAATTTA
CGCTCGCCAAACCGCACATCATTTTCAGGAATAATGAAAACGCGGTAATAGCGGATAAAA
ACAATAATTGCGGTAATCAGGGCCAGCAGCGCGAAAGTAAAATCGAGAACAATGATATAT
TGCAGGCCGATGTTCGACAGATAACCGGTAATCAGTGGAATAACAAAGTTAGCCAGTCCA
CCCATCATCATATAAATACTGGTGACTTTGGCTTTGCTTTTGGGAAAAAACTCTGACATG
ACCGAAACGCCGAGCTGTAAAATGCCGCCAGCTGCTGAGAAACCGATAACAAAGGCTCCG
GCATTGCACACCAGTGGAGAAGGGTACAGGTAGATAATGGCTGCTGTTATTGTTGCCAGT
GCAGAGTTAAATACATTAGCCCAGATGGGCCGGACCATTTTTTTCAGTAGTGCGGCAAAA
ATAAAGACACAGACCAACGAGCCCATACTGTAATAAGAGATGGTTTTTAATGCCTCAGCT
TCTGACATACCAGCAAAAGCCATCGCATATTTGGGCATCCACACCACAATCACATAAAAG
GTCGAGAATGCGGCTACACCGAACAGTACCGATGAAACACCTTCCAGCCAGACTAACGGT
TTGCTGTTCATTTGCGGTAATTCATTAGTTACGCTGGCGTCCACCAACTGGCTGGGGAAT
TTGCTTTTCAACAGCATCAGCGTGATCAGTACAAATAGAATACCCGGAATAATCAGCCCA
TAGCCGTACCAGATATTATTGAGCAACATATAGCTCACCAGCATTGGGTAGAACATTTGC
CCAAATGACACCATCGCTTTAACCAGTATGACCGCCGAACCAGAGGCTTTCGGAAAGCAT
TCCATGAGCGCGGGGTAGCCACCCGTATCCAGCGCTGAGTTAGCGATACCTACGCACACT
GCCAGACCGTAGGCGAGAGTTAAATTCGGGCAAGCGGGAATACCAAAGAAGAATAGCAGA
TACATTATTACTGCCATTAATATCACCGCCCGACGACCAAACTTATCGGAGATCACACCG
AAGAATAAAATACTGATCAATCGCCCCAAACCGATACCGGAAATTAAGTAGGCAATGCCC
GCGTTGTCAGTGGAAAACTTTTCCGCCAGAGATGACATATTTTGGGCAAGCGTAATAACA
CTAATGCCGTGCAGGAAGTAGCTGAAGTAAATACAAAGAACAGCCAGGATAAATGGCGTG
CTGAAAGCCTTATTTTGAGACATTTTCACAGCTCCTTGCTGAAAGATAATTTCGTTACCG
TACGTATTGTTCTCCGACGGTTTACATAATTACTATACTGAAGATGATTTTCCCTGGGTA
CATGGCATAAAGTTTATGTTTCCAGGAATATTGCATGTCATAGTTTGTTTTTGATCGCGA
TTTTCCTTAGTTAGCGCAGAAAGAGTTATTTATCCGTAAGATCTTGCATGACCTGAAAAG
AATATTGCATTACCCACCCGGAGCGACATTTTCCTTTAGCGAGTGATGCCGCGTTTTTTT
GCGGCTGCGTAAGCCGATAAACAGTGCCAGTAAAAAACCGATGGCAGCGATGGCGGTATC
GAACCACATAATATCGGCAATACTTCTTTGGGACAGATGAGCCGTAATCAACGGAATAGT
AAAGGTCGCAATACTGCCCGCACTGTAATAGATCCCTGTAGCTTTACCTTTAGCGTAAGG
GAAACGTTCAGCCATTAACGTCAGGCCAATTTGCACAACACCTCCAGCAGAGGTAAAACC
AATGACAAAAGCAAATATTATCACCACATAAAATGTGGGATGCAGGCAGACGGTAAACAG
AGCAATAAATGAGATAAAGGTGTACAGCATCAGTAATGTTGTTGGGCGAACGGTATTACG
AATGAGTGGAGCGGTAATAAATACACAAAGCAGCGAACCCACGGTGTAGATACTGAGTAG
TTTGATCGACATAGTGTATGACATGCCTGCAACAAATTGTCCGTACTGTGCCAGCCACTG
GCTAACCAGATAAAACGTTGCCATTGAGATATAGCCATATAAGGTATAACTGGCTAAATC
GATAATTGAACAGCGATGTTCCGTAGAGCTGGTGGTTTTCTTTATGACAGGTAAGCGACG
ACCCGGATGGGGTGGGAACGTACAACGGTATAAAAACAGAGCGTTAATAAACATAATGCC
TGCAGCAATCATAAAGGACCAACCGAACCACAGTTCAGCCCACACTAACAGGCTAATGAT
TAGCGGTAATAAAAATTGTCCGCTGGAAACAAATGCTTTAATTAAAATATTGGCTGTCCC
AGGTGAGCGTGGAAAAGCTTCCATCAAACTGGGATAAGTGCCTGCATCGAGAAAACTGTT
TGCCATTCCCGCCAGAAAGCCAAAAACATAAGCGATAATGATGTTATTGGTCTGCAGGAT
GCCAAAAAAGAAGGCCATATAGCAGCACATCCCGAGCATGATAAAAGGGCGGCGACCAAA
GCGATCGGATAATAATCCTGCAAAAAGCAAGACACTTAATCGACCAATGCCCAGCGATGA
GATAACTATCGAGACACCCGCGGCATTAGTCTGCCAAAGTGTCTCCAGCGAGGCCATATT
CAGGCTCATCAAAAGGACGCCCATACCATGCACCAGGTAATTAAAATACAACCCAAGTGC
GGTAGGGAAATAGGGATTTTTCATAGGTTCTACTTAGCAAAGGTGCTTTAAAAAGTGAAG
CGATGTTGTGTCAGCATCCGTTCATTATTGTTGTAACAACGACAATTCCTTTCTGTGGAA
AAATTAACAAAGCCGCTCCAGATCGTGTGCATATAATTCAGCAGCTACCGATTGATAGAT
CTTCCAGTCAATAAAATTGCCATCAGGGTAGACTCGTTGAAATGCGGTTAAGTCGGGGAA
AAAACGCATGGTGTTGTTGCCGATGCGGTTATTTATTTTCTCTATGATGGCATGAAGATG
TTTTTTTCTTTGCTGACGCATAGCCAACAGTTGCTCGACTACACGATCAGGAATGGCACA
CTTGCCATTTTCCCACTGACGCCAGCTTTCACTGTCACCGGTCTGGGCAATCCAGGTCGC
GCATTCATCAATAGTCATGGCAAAAATATGGCGGAGTGCCTGGAGTTCATAAGCGTTCAT
CGTGTAATGGCTGCATGAAATAAACAATAAAATATAAATAACATTATCAGCCTGCTGACG
GCTTGAAGAGAGTCACAGTATCTTGTGCAACATTATTGGAAAGAGTGAGGGGCGAGGTAG
CGAAGCGGAAAAATGTTAAAAAAAAGCCCATCGTGGGAGATGGGCAAAGACTACACACAG
CAATTCGTTGTTTCACTCAGGGGATTTCCATGCTTATAAATCAATATGTTGATTTATAAC
CGTGAGCTAATAGTAGGCATACGGACTTTTTGCGTCGATCAGATTCGTCTCATTAGTTTA
AAAACTGTAAAGAATTTGCGACAGGTACTACCAGCTGAATGGCGGTAAGCAGGAAAATAT
GGGGAAGAGCAAGCAAATATCAATTAGCGGTGGTTAACAATCAGGCGGCAGAGCCGCCTG
ATGAGAAATTACTTATTCGGTTTCTCGATTTCGCCAAGTTCTTCGAGAATTTCTTCCGGT
TGGTCCGTCGGCGGCGGGACTTCTTCCACCCACGCGGCAAACAGACGCCAGGAAACGGCT
AACAGAACCGGACCAATAAACAGACCGATCATCCCGAAAGCAATCAAACCACCAATAACG
CCAGAGAGAATCAGGATCAGCGGTAAATCGGCACCCATGCGAATTAACATTGGGCGGATG
ACGTTATCCAGCGTGCCAACCACACCGCTCCACACTAACAATACCGTTCCCCAGGTGGTA
TCGCCAGTCCAGTAGAGCCAGATAATCGCCGGAATCAGTACCGGCAACGGGCCAAGCTGG
ACAAGGCAGGAGAGGATCATTAACACCGTTAGCAACGTTGCATAAGGTACGCCGGATACG
GCGAGGCCGATACCGCCAAGCACTGCCTGTACTAACGCCGTCACCACCACACCCAGCGCC
ACCGCGCGGATAGCCTGTGCCGCCAGCAGCACGGCGGCATCTCCGCGAACGCCTGCCAGA
CGGGTTGCAAAATGGCGAATGCCTTGTGCCACCTGTTCACCGCGCCAGTACAGCAGGGCA
CTGAAGAGAAGCATCAGCGCACAATGCACCATAAAGCGCCCGATATGCGCCGCCTGCCCA
ACGAACCAGGTGGTGGTGGTGCCAATATAAGGGCGGACTTTCGCCATGATCGCCGTCCCC
CCCATATCCAGCAAGTTGTGCCAGCCTGCATACAGCTTCGCGCCAATCACCGGAATGGTA
TTAAGCCACGCCAGATCGGGTAACGTCATGTCACCGCTGGAAATGGCTTTAATTAGCGGG
CCGCTGCCGTCGACGATACTGTTAACCAGCAAAGCAATAGGGATGATAAACACCATCACT
AATAACAGCGTCATCACCAGAACGGCGAGAGAGCGGCGGCCAAACATGATCTTTTGCAAA
CGTAACAATACCGGCCAGGTGGCGATAACCACCGTACCGGCCCATGCAAAGCCGAGAATA
AAGGGTTGAACAATCCACAGACATGCCACAATCATGATGGCTAAAAACAGCACCGAAAGC
AGAATTTGTGCGACATCCCTGGGCTGACGAACATTTACCATAACTACTTTTCACCTTTTT
TGTGCGTCAAATCGTCGACGCGACGTGAACACGCGAAACTCACCTGCATAATGATGAGCA
ATTTCAGCGGTTTTTAACAGGCCGATTCTGCCCTTAATTCTGATGGGCGTGTTAGAAAAA
AATGTGGTACAACAACTCAGGCAACACGCAAACGATTTACTCGTCGTATTTCAAGTTGCA
TGTGCTGCGGCTACGTTCGTTCACCCCAGTCACTTACTATTGTAAGCTCCTGGAGTTCAC
TCGCTTGCCGCCTTCCTGCAACACGAAATCCATAGAGTAAACAAACATCACCTTTCAGTG
CGCTATTGCAGCAGCCTGAAAGAATAGTGTATCGACCTACATCACAGACCGCAGGAAAGG
GTCAATATAATGATTCCACAGATTTCCCAGGCACCCGGCGTCGTTCAACTGGTGCTTAAT
TTTTTGCAAGAGCTGGAGCAACAAGGTTTTACCGGCGATACGGCGACAAGTTATGCCGAT
CGTCTGACAATGTCGACCGACAACAGTATTTACCAACTTCTCCCCGATGCGGTGGTATTT
CCGCGTTCAACCGCAGATGTGGCGCTGATCGCCCGTCTTGCCGCGCAGGAACGCTATTCA
TCGCTGATCTTTACCCCCCGCGGCGGCGGCACCGGCACTAACGGTCAGGCGCTCAACCAG
GGGATTATTGTTGATATGTCCCGCCATATGAACCGCATCATCGAAATTAACCCTGAAGAG
GGCTGGGTGCGCGTTGAGGCCGGGGTGATAAAAGATCAACTCAATCAGTACCTGAAACCG
TTCGGCTACTTTTTTGCGCCGGAACTTTCGACCAGCAACCGGGCAACGCTCGGTGGGATG
ATCAATACCGATGCATCCGGTCAGGGATCGCTGGTCTATGGCAAAACGTCAGATCACGTA
CTTGGCGTACGCGCGGTGTTGTTGGGGGGCGATATTCTCGATACGCAACCTTTACCCGTC
GAATTGGCGGAAACGCTGGGTAAATCCAATACCACAATCGGGCGAATTTATAACACGGTT
TATCAACGTTGCCGTCAGCAACGCCAGTTAATTATCGACAACTTCCCCAAACTTAACCGC
TTTCTTACCGGTTACGATCTGCGTCATGTCTTTAACGATGAGATGACCGAGTTCGACCTG
ACGCGCATTCTGACGGGTTCAGAAGGGACGCTGGCCTTTATTACCGAAGCGCGGCTGGAT
ATTACACGCTTGCCTAAAGTGCGCCGTCTGGTGAACGTCAAATATGACTCTTTTGACTCT
GCGCTGCGTAACGCGCCGTTTATGGTTGAGGCGCGGGCGCTTTCGGTAGAGACGGTGGAC
TCAAAAGTGCTGAATCTGGCGCGGGAAGATATTGTCTGGCATTCCGTCAGCGAGTTGATT
ACCGATGTGCCTGACCAAGAGATGCTCGGGCTGAACATTGTGGAATTTGCTGGTGATGAT
GAGGCGCTGATTGATGAGCGGGTAAATGCACTCTGTGCGCGGTTGGATGAGCTGATCGCC
AGTCATCAAGCAGGTGTCATCGGCTGGCAGGTGTGCCGTGAGCTGGCGGGGGTTGAACGT
ATCTATGCAATGCGCAAAAAAGCCGTTGGTCTGCTTGGCAATGCCAAAGGTGCCGCTAAG
CCAATTCCGTTTGCTGAGGATACCTGCGTACCGCCGGAACACCTGGCGGATTATATTGCT
GAATTTCGCGCGCTGCTCGACAGCCACGGCTTAAGCTACGGTATGTTCGGTCACGTCGAC
GCAGGTGTCTTGCACGTCCGTCCAGCGCTGGATATGTGCGATCCTCAACAAGAGATTTTG
ATGAAGCAAATCTCTGATGACGTGGTGGCGCTGACTGCGAAATACGGTGGTTTGTTGTGG
GGCGAGCACGGCAAAGGTTTTCGCGCTGAATACAGCCCGGCGTTTTTCGGTGAGGAACTT
TTTGCAGAACTGCGCAAAGTGAAAGCGGCATTTGACCCGCATAACCGACTCAACCCAGGG
AAGATTTGCCCGCCAGAAGGTCTCGATGCGCCGATGATGAAAGTGGACGCGGTGAAGCGC
GGTACATTCGATCGGCAGATCCCCATTGCGGTACGCCAGCAGTGGCGCGGTGCGATGGAG
TGTAACGGCAACGGTTTATGCTTCAACTTTGATGCCCGTAGTCCGATGTGTCCGTCGATG
AAGATCACCCAGAACCGGATTCATTCACCGAAAGGGCGCGCAACGCTGGTGCGTGAATGG
CTGCGTTTGTTGGCGGATCGCGGCGTTGATCCACTCAAACTGGAACAAGAACTGCCTGAA
TCCGGCGTCAGTTTGCGGACGTTAATTGCCCGCACGCGCAATAGCTGGCATGCGAATAAA
GGCGAATATGACTTCTCACACGAAGTCAAAGAGGCGATGTCGGGCTGTCTGGCCTGTAAA
GCGTGTTCGACCCAGTGCCCCATCAAAATTGATGTGCCGGAGTTTCGCTCTCGTTTTCTG
CAGCTCTATCACACCCGTTATTTACGCCCGCTGCGCGACCACCTCGTCGCTACGGTCGAG
AGCTACGCGCCGCTGATGGCACGCGCGCCGAAAACCTTTAACTTCTTCATTAACCAGCCG
CTGGTGCGCAAACTCTCGGAAAAACATATCGGCATGGTTGATTTGCCGCTGCTGTCGGTC
CCCTCGCTACAACAACAAATGGTGGGGCATCGCTCGGCAAACATGACGCTGGAACAGCTT
GAATCTCTCAATGCAGAGCAGAAAGCGCGCACAGTGTTGGTGGTGCAGGACCCCTTTACC
AGCTATTACGATGCGCAAGTGGTGGCGGATTTTGTCCGTCTGGTCGAAAAATTAGGTTTC
CAGCCTGTGTTACTGCCATTTTCGCCAAATGGCAAAGCCCAGCATATTAAAGGTTTTCTT
AATCGTTTTGCGAAGACGGCGAAAAAGACGGCGGATTTCCTCAACCGTATGGCGAAGCTG
GGTATGCCAATGGTGGGCGTCGATCCGGCGCTGGTACTTTGTTATCGCGATGAATATAAA
CTGGCGCTGGGCGAGGAGCGTGGCGAGTTTAACGTCTTACTGGCGAATGAATGGCTGGCA
AGCGCACTTGAGTCACAGCCAGTGGCTACAGTCAGCGGTGAATCATGGTATTTCTTTGGT
CACTGTACCGAAGTTACCGCCTTGCCGGGTGCGCCAGCACAATGGGCCGCGATATTTGCC
CGTTTTGGCGCGAAACTGGAAAATGTCAGCGTGGGTTGCTGCGGCATGGCAGGGACTTAC
GGACATGAAGCGAAAAACCATGAAAATTCGCTCGGGATCTATGAGTTATCCTGGCATCAG
GCTATGCAGCGACTGCCGCGTAACCGCTGTCTGGCGACCGGATATTCCTGCCGTAGCCAG
GTAAAACGGGTTGAAGGCACGGGGGTACGCCATCCTGTGCAGGCTTTACTGGAGATTATT
AAATGATATGGAAACGGAAAATCACCCTGGAAGCACTGAATGCTATGGGTGAAGGAAACA
TGGTGGGGTTCCTGGATATTCGCTTTGAACATATTGGTGATGACACCCTTGAAGCGACAA
TGCCAGTAGACTCGCGGACAAAGCAGCCTTTCGGGTTGCTGCATGGAGGAGCATCCGTGG
TACTGGCCGAAAGTATCGGTTCCGTTGCCGGTTATTTATGTACCGAAGGTGAGCAAAAAG
TGGTTGGTCTGGAAATCAATGCTAACCACGTCCGCTCGGCACGAGAAGGGCGGGTGCGCG
GCGTATGCAAACCGTTGCATCTCGGTTCGCGTCACCAGGTCTGGCAGATTGAAATCTTCG
ATGAGAAAGGGCGTTTGTGCTGTTCGTCACGATTGACGACCGCCATTTTGTGACGTTGTC
ACCAGAAAAGTGTGACGCATATTGCTTTTGGTCATTATCTGCACAGTAAACGGTGGTATA
CTGTGCAGGTCTTGTCTAAAAGCGAGGATGCTATGTCTACTCAACTTGATCCCACCCAGC
TGGCCATTGAATTTTTACGCCGTGACCAGAGCAATCTTTCACCTGCCCAATATCTCAAAC
GTCTGAAACAACTAGAACTTGAATTTGCTGACCTGCTTACTCTCTCTTCTGCTGAATTAA
AAGAAGAAATCTACTTTGCCTGGCGTCTGGGCGTGCATTGATCCTGACTTAATGCCGCAA
GTTCGCCAAATCGACCTGGATTAACCTCCGTCCAGGTTCGATGACCTTCTTAATACTGCT
TATCTACCGCCTGATATTGTTCAAAAATAATACTAATCGCAGTTTGTGTTAAAACGGCGG
GTTAGCTTTATGAGATTATTCTTATCGCCCCTTCAAGAGCTAAGCCACTGAGAGTGCCGG
AGATAAGCGCCGGATGGGGTAGAAACCCTTAAGCCTGTGTCGCACAGACTTAAGGGTTTT
CTTATTTCTGAACGCTGCACTTTTTTACCTATCTCTTAAATAGTCATTTTCAATACAACT
TTTTCTTTTTCATCACAGCCTTAATGCTCCTTAGATAATAACCATTATCTAACAATGAGA
TACCTAATTCTTAGCGTGCCTGTTAACCCACACATCAGGGTCTATGCTTATTAAAAGCAG
GCAAAAAGCATGTTTTACGGTAAAGCCCCTGCGTTTGCTGGGTTGAACTGATAATCATTA
TCACTAACATGCTGTTATACGCTGAAAGCGATGAAGTGAGGTAAATCGATGGACATGCAT
TCAGGAACCTTTAACCCACAAGATTTCGCCTGGCAAGGCTTAACGCTGACACCCGCAGCG
GCGATACACATCCGTGAGCTGGTGGCAAAGCAGCCGGGTATGGTCGGCGTGCGCTTAGGC
GTGAAGCAAACGGGCTGCGCGGGCTTTGGCTATGTGCTCGACAGTGTTAGCGAGCCGGAC
AAAGACGATCTGCTGTTTGAACACGACGGCGCGAAGCTGTTTGTCCCGCTGCAAGCGATG
CCGTTTATTGATGGCACGGAAGTCGATTTCGTTCGTGAAGGACTTAATCAGATATTCAAA
TTTCACAACCCTAAAGCCCAGAATGAATGTGGCTGTGGCGAAAGCTTTGGGGTATAGGCG
GTACTATGTCTCGTAATACTGAAGCAACTGACGATGTCAAAACCTGGACCGGCGGCCCGC
TGAATTATAAAGAAGGATTCTTCACCCAGTTAGCCACCGATGAGCTGGCAAAGGGGATAA
ACGAAGAGGTGGTGCGCGCAATTTCGGCGAAGCGTAATGAGCCGGAGTGGATGCTGGAGT
TTCGTCTAAACGCCTATCGCGCATGGCTGGAGATGGAAGAACCGCACTGGTTGAAAGCGC
ACTACGACAAGCTGAATTATCAGGATTACAGCTACTACTCAGCACCATCGTGCGGTAATT
GTGACGACACTTGCGCGTCTGAACCTGGCGCGGTGCAGCAAACTGGCGCGAACGCCTTTT
TAAGTAAAGAGGTGGAGGCGGCGTTTGAGCAGTTGGGCGTTCCCGTGCGGGAAGGCAAAG
AGGTGGCGGTGGATGCCATTTTCGACTCAGTTTCGGTTGCCACTACTTATCGCGAAAAAC
TGGCGGAGCAGGGAATTATTTTCTGTTCCTTTGGTGAGGCGATCCACGATCACCCGGAAC
TGGTGCGTAAATATCTCGGCACCGTGGTGCCGGGGAATGACAACTTCTTTGCCGCGCTTA
ATGCGGCGGTAGCCTCTGATGGTACGTTTATTTATGTGCCTAAAGGCGTGCGCTGCCCGA
TGGAACTTTCCACCTATTTTCGCATTAACGCAGAAAAAACCGGGCAGTTTGAGCGCACCA
TTCTGGTGGCCGACGAAGACAGCTACGTCAGCTACATTGAAGGCTGTTCCGCTCCGGTGC
GTGACAGCTATCAGTTACACGCGGCAGTGGTGGAAGTCATCATCCATAAAAACGCCGAGG
TGAAATATTCCACGGTACAAAACTGGTTTCCTGGCGATAACAACACCGGCGGTATTCTCA
ACTTCGTCACCAAGCGTGCTTTGTGCGAAGGCGAAAACAGCAAAATGTCATGGACGCAAT
CAGAAACCGGGTCAGCGATTACGTGGAAATATCCCAGCTGCATTTTGCGCGGCGATAACT
CCATTGGTGAGTTTTACTCAGTGGCGCTGACCAGCGGTCATCAGCAAGCGGATACCGGCA
CCAAGATGATCCACATCGGTAAAAACACCAAATCGACCATTATCTCGAAAGGGATCTCTG
CCGGACATAGTCAGAACAGTTATCGCGGCTTAGTGAAAATCATGCCGACGGCAACCAATG
CGCGCAATTTCACTCAGTGCGACTCAATGCTGATTGGCGCTAATTGTGGGGCGCATACCT
TCCCGTATGTTGAGTGTCGTAACAATAGTGCGCAACTGGAACACGAGGCAACGACATCAC
GTATTGGTGAAGATCAACTGTTTTACTGCCTGCAACGCGGGATCAGCGAAGAAGACGCCA
TCTCGATGATTGTTAACGGTTTCTGCAAAGACGTGTTCTCGGAGCTGCCGTTGGAATTTG
CCGTTGAAGCACAAAAACTCCTCGCCATCAGTCTTGAACACAGCGTCGGATAAGGAATAA
ACATGTTAAGTATTAAAGATTTACACGTCAGCGTGGAAGATAAAGCTATCCTGCGCGGAT
TAAGCCTCGACGTTCATCCCGGCGAAGTTCACGCCATTATGGGGCCAAACGGTTCGGGCA
AAAGTACCTTATCGGCAACGCTTGCCGGGCGAGAAGATTATGAAGTGACGGGCGGCACGG
TTGAGTTCAAAGGCAAAGATTTGCTTGCGCTGTCGCCGGAAGATCGCGCGGGCGAAGGCA
TCTTTATGGCCTTCCAGTATCCGGTGGAGATTCCAGGTGTCAGTAACCAGTTTTTCCTGC
AAACGGCACTTAATGCGGTGCGCAGCTATCGCGGCCAGGAAACGCTCGACCGCTTTGATT
TTCAGGATTTGATGGAAGAGAAAATCGCTCTCCTGAAGATGCCGGAAGATTTATTAACCC
GTTCGGTAAACGTTGGTTTTTCCGGCGGCGAGAAAAAGCGCAACGATATTTTGCAAATGG
CGGTGCTGGAACCGGAGTTATGCATTCTTGATGAGTCGGACTCCGGGCTGGATATTGACG
CATTAAAAGTGGTCGCCGATGGCGTGAACTCGCTGCGTGATGGCAAGCGCTCATTCATCA
TTGTTACGCACTACCAACGCATTCTCGACTACATCAAGCCTGATTACGTTCATGTGCTAT
ATCAGGGACGAATTGTGAAATCCGGCGATTTCACGTTGGTCAAACAACTGGAGGAGCAGG
GTTATGGCTGGCTTACCGAACAGCAGTAACGCGCTGCAACAGTGGCATCACTTGTTTGAA
GCTGAAGGGACAAAACGCTCCCCGCAAGCACAGCAGCATTTACAACAATTGCTGCGTACC
GGACTGCCGACACGTAAACATGAAAACTGGAAATATACGCCGCTGGAAGGGCTGATCAAT
AGCCAGTTTGTCAGCATTGCGGGAGAGATATCCCCACAGCAGCGTGATGCCTTAGCGTTA
ACGTTAGACTCCGTGCGGCTGGTGTTTGTCGATGGGCGTTACGTGCCCGCACTGAGCGAT
GCAACTGAAGGCAGCGGATATGAAGTGAGCATTAACGACGACCGTCAGGGTTTACCCGAC
GCTATTCAGGCGGAAGTGTTTCTGCATTTGACGGAAAGCCTGGCACAAAGCGTGACGCAT
ATCGCCGTGAAGCGCGGTCAACGGCCGGCAAAGCCATTGCTGTTAATGCATATCACCCAG
GGCGTGGCAGGTGAAGAGGTGAACACTGCCCATTACCGACATCATCTGGATCTGGCGGAA
GGTGCCGAAGCAACGGTGATCGAACATTTTGTCAGCCTGAATGATGCTCGTCATTTTACC
GGGGCACGGTTCACTATCAACGTCGCAGCGAATGCCCACTTGCAGCATATCAAGCTGGCG
TTTGAAAACCCGCTCAGTCACCACTTTGCTCATAACGATTTGTTGCTGGCTGAGGATGCC
ACCGCATTTAGCCACAGTTTCCTGCTGGGTGGCGCAGTGTTACGACACAACACCAGTACG
CAACTCAATGGCGAAAACAGCACGCTGCGGATCAATAGCCTGGCGATGCCGGTGAAAAAC
GAGGTGTGTGATACCCGTACCTGGCTGGAACACAATAAAGGTTTTTGTAACAGCCGACAG
TTGCACAAAACTATCGTCAGCGACAAAGGCCGCGCGGTATTTAACGGTTTGATCAACGTC
GCGCAGCACGCCATCAAAACGGATGGTCAGATGACCAACAACAATCTGCTGATGGGCAAA
CTGGCGGAAGTGGATACGAAACCGCAGCTGGAAATCTATGCAGATGATGTGAAATGCAGC
CACGGCGCGACGGTGGGGCGTATTGATGATGAACAGATATTCTATCTGCGCTCGCGCGGG
ATCAATCAGCAGGATGCCCAGCAGATGATCATTTACGCCTTCGCTGCCGAACTGACGGAA
GCACTGCGTGATGAGGGGCTTAAACAGCAGGTGCTGGCCCGAATCGGTCAACGGCTGCCA
GGAGGTGCAAGATGATTTTTTCCGTCGACAAAGTGCGGGCCGACTTTCCGGTGCTTTCGC
GTGAGGTAAACGGTTTGCCGCTGGCTTATCTCGACAGCGCCGCCAGTGCGCAGAAACCGA
GCCAGGTGATTGACGCCGAGGCCGAGTTTTATCGTCATGGCTACGCGGCGGTGCATCGTG
GTATTCATACCTTAAGCGCCCAGGCGACCGAGAAAATGGAGAACGTGCGCAAGCGGGCAT
CGCTGTTTATTAATGCCCGTTCGGCGGAAGAGCTGGTGTTCGTCCGCGGCACGACGGAAG
GGATCAATCTGGTCGCCAATAGCTGGGGCAACAGCAACGTGCGGGCGGGCGATAACATCA
TCATCAGTCAGATGGAGCACCACGCTAACATTGTTCCCTGGCAGATGCTTTGCGCACGCG
TTGGCGCAGAGCTGCGTGTGATCCCGCTCAATCCCGATGGTACGTTGCAACTGGAGACGC
TGCCTACGCTGTTTGATGAGAAAACTCGCCTGCTGGCAATTACTCATGTCTCCAACGTGC
TTGGCACAGAAAATCCACTGGCGGAAATGATCACGCTTGCGCACCAGCATGGCGCAAAAG
TGCTGGTGGATGGCGCTCAGGCGGTGATGCATCATCCGGTGGATGTTCAGGCGCTGGATT
GCGACTTTTACGTGTTCTCCGGGCATAAACTGTATGGCCCCACCGGAATTGGCATTCTTT
ATGTGAAAGAAGCCTTGTTGCAGGAGATGCCGCCGTGGGAAGGGGGCGGTTCTATGATCG
CCACCGTCAGCCTGAGTGAAGGCACTACCTGGACCAAAGCACCATGGCGGTTTGAAGCCG
GTACACCCAATACCGGGGGCATCATTGGTCTTGGCGCGGCGCTGGAGTATGTTTCGGCGC
TGGGGCTTAATAACATAGCCGAGTATGAACAGAATCTGATGCATTATGCGCTATCACAGC
TGGAATCTGTACCGGATCTCACTCTCTATGGCCCACAAAACAGGCTTGGCGTTATTGCTT
TTAATCTCGGTAAACACCACGCCTATGATGTTGGCAGTTTTCTCGATAATTACGGCATTG
CTGTGCGTACCGGACATCACTGCGCAATGCCATTGATGGCCTATTACAACGTCCCTGCGA
TGTGTCGGGCGTCGCTGGCCATGTATAACACCCATGAAGAAGTGGATCGTCTGGTGACCG
GCCTGCAACGTATTCACCGTTTGCTGGGATAACAGGGAGGCACTATGGCTTTATTGCCGG
ATAAAGAAAAGTTGCTGCGTAATTTTTTACGCTGCGCCAACTGGGAAGAGAAATATCTCT
ACATTATTGAGCTGGGCCAGCGTCTGCCAGAATTACGCGACGAAGACAGAAGTCCACAAA
ATAGCATTCAGGGCTGTCAGAGTCAGGTGTGGATTGTCATGCGCCAGAATGCCCAGGGAA
TTATTGAATTACAGGGCGACAGCGATGCGGCGATTGTGAAAGGGCTTATTGCGGTCGTCT
TTATTCTCTACGATCAGATGACGCCGCAGGATATTGTCAATTTCGATGTGCGTCCGTGGT
TTGAAAAAATGGCGCTCACCCAACATCTCACCCCATCTCGTTCACAAGGTCTGGAAGCGA
TGATTCGCGCAATTCGCGCCAAAGCCGCTGCACTTAGCTAAACTAAAAGGACAGCTTTCA
TCCGGTTGGCTCACATTGCCGGATGGTCAATGTTTACACTGACCTGCACAGGAGTGTTTT
GGTTTCAGGTGAACATAAGCGCCATCCGACGTTTCAGCGTGAGTCTCCGGCAAATACAGG
AGGTTTACAATGAAACGCGCGTCTTTGCTTACACTCACGCTTATCGGCGCTTTTAGCGCC
ATCCAGGCTGCCTGGGCGGTTGATTATCCGCTACCACCAACCGGAAGCCGACTGGTTGGG
CAAAATCAAACGTATACGGTGCAAGAAGGGGATAAAAACCTTCAGGCTATTGCCCGACGT
TTTGATACTGCGGCAATGTTGATCCTTGAAGCCAATAACACTATCGCCCCGGTGCCAAAA
CCTGGTACGACGATAACTATTCCTTCACAACTGTTATTACCTGATGCACCGCGTCAGGGG
ATTATCGTTAACCTTGCAGAGCTGCGCCTTTATTATTATCCGCCGGGAGAAAATATTGTG
CAGGTTTATCCAATAGGTATTGGATTGCAGGGGCTGGAAACGCCGGTGATGGAAACGCGT
GTTGGGCAGAAAATCCCTAACCCAACCTGGACGCCTACGGCAGGCATTCGTCAGCGTTCG
CTGGAGCGTGGCATTAAATTACCGCCAGTCGTTCCTGCCGGACCAAATAACCCGCTAGGA
CGTTACGCACTGCGCCTCGCGCATGGTAATGGCGAATACCTCATTCATGGTACCAGTGCG
CCGGACAGCGTCGGTTTGCGCGTCAGTTCAGGGTGTATTCGCATGAATGCACCGGATATT
AAAGCCTTGTTCTCCAGCGTGCGGACGGGAACGCCGGTGAAAGTGATCAACGAACCGGTG
AAATATTCCGTGGAGCCTAACGGGATGCGTTATGTTGAAGTACATCGACCACTATCGGCA
GAAGAACAGCAGAACGTTCAGACAATGCCATACACACTGCCAGCAGGCTTTACGCAATTT
AAAGACAATAAGGCTGTAGATCAGAAGTTAGTCGATAAAGCGTTGTATCGTCGGGCAGGG
TATCCGGTTTCGGTGAGCAGTGGAGCAACTCCCGCAGCCAGCAATGCGCCTTCAGTAGAG
TCAGCGCAGAATGGTGAACCAGAGCAAGGGAATATGTTACGCGTGACGCAGTAGCGGTAA
ACGGCAGACAAAAAAAATGGCGCACAATGTGCGCCATTTTTCACTTCACAGGTACTATTA
CTTGCGGTATTTAGTAGCCATGTTGTCCAGACGCTGGTTAGCACGAGCTGCGTCATCTTT
AGCAGCCTGAACGTCGGAACGCATTGCGTTCACGTCGTTGCTCAGCTGGTCAACTTTAGC
GTTCAGAGTCTGAACGTCAGAAGACAGCTGATCGATTTTAGCGTTGCTGGAGCAACCTGC
CAGCAGAGTAGAACCCAGGATTACCGCGCCCAGTACCAGTTTAGTAGCTTTCATTATTAA
TACCCTCTAGATTGAGTTAATCTCCATGTAGCGTTACAAGTATTACACAAAGTTTTTTAT
GTTGAGAATATTTTTTTGATGGGAAGGCACTTATTTTTGATCGTTCGCTCAAAGAAGCAT
CGAACGCTGGGTTTTAGATAAAAAAATTGAGAGAAAACAGGATGCTTCCATCGGATTCAT
CTTAGATAAAGTGAGATTATATAGTGAAATCCGATTTGATTTTTTATTGCTTCTGGTTAT
CGATTAAATAAAAAAAGCGCCCATCAGGGCGCTTCGATATACAAATTAATTCACAAAAGC
AATATTACAGGACGTGAACAGATGCGGTGTTAGTAGTGCCGCTCGGTACCAGTGCACCAG
AAACCATAACTACAACGTCACCTTTGTGTGCCAGACCGCTCTGCAGAGCCAGTTCTTTAC
CCAGACGGTAGAAATCATCAGTAGAAGTGATCTCTTTAACAAGCTGCGGCACAACGCCTT
TGCTCAGTACCAACTGATGAGCCGTTTTTTCGTTGGTGGTCAGTGCCAGGATGGTGGCAT
CCGGGAAGTATTTACGTACTGCGCGAGCAGATTTACCGCCCTGAGTAGCAACCACGATCA
GCGGAGCATCCAGTTTTTCAGCAGTTTCAACGGCACCACGGCATACCGCTTCGGTAATGC
GCAGTTTACGGTTGTCATTGTTGAACTCGAGACGGCTGTTCATCACGCGGTCGGTACGTT
CGCAGATGGTCGCCATGATAGAAACCGCTTCCAGCGGGTATTTACCTTTTGCGGATTCAC
CAGACAGCATCACTGCGTCAGTACCGTCGAGGATGGCGTTTGCAACGTCACCGGCTTCTG
CGCGAGTCGGGCGTGGGTTTTTGATCATGGAATCCAGCATCTGGGTCGCAGTGATAACGA
CTTTACGTGCACGGATACATTTTTCGATCATCATCTTCTGGGCGAAGATAACTTCTTCTA
CCGGGATTTCTACACCCAGGTCGCCACGCGCAACCATGATGCCGTCAGAGGCTTCGAGGA
TTTCGTCGAAGTTGTTGAGGCCTTCCTGGTTTTCGATTTTGGAGATGATGTGGATGTTTT
CGCCGCCGTGCGCTTTCAGGTGCTCACGGATTTCGATAACGTCAGAACGCTTACGAATAA
AGGAAGCAGCAACAAAGTCTACGCCTTGTTCGCAACCAAAGATCAGGTCCTGTTTGTCTT
TTTCAGCCAGTGCTGGCAGAGCAATGGAAACGCCAGGCAGGTTCACACCTTTGTTTTCGC
CCAGGTCACCGTTGTTCAGCACTTTACAGATAACTTTGTTACCTTCAATGGCGGTAACTT
CCATACCGATCAGACCATCGTCAACCAGTACGGTGTTGCCAACAGACAGGTCAGTAGTGA
AACCTTCATACGTTACCGCAACCATTTCGCTGTTGCCGATAACAGATTTATCAGTGGTGA
AAGTAAAGGTCTGACCAGCTTTCAGAGAAACGTCGTTACCGCCTTCCAGTTTCATGGTGC
GGATTTCCGGACCTTTGGTATCAAGCAGGATAGCGGCGGTTTTACCAGTTTTGCTCATCA
CGTTGCGCAGATTCTGAATGCGCTGACCGTGTTCTGCATAGTCACCATGAGAGAAGTTCA
GACGCATAACGTTCATGCCAGCGTCCAGCATTTTAGCTAACATCTCTTCAGATTCGGTTT
TCGGTCCGATGGTGCAAACAATTTTGGTCTTTTTCATGACAGTCTTAGTCTTTAAGTTGA
GAAGGATGGGAGAAACTTGCTTTCTGGGCGCACTGCCGGAAAGCGAATCCGGTATTACGA
AAGTGGTGGTGCCTCGCTCTAAGGATAGGTGACATCGAAAAAGCGTGCAGAGGAATGTGT
GCTTGTGTCTCAGCCCAACGTGAGTGCCTGTTTTTGAGTCGTTGAGTTCTACAGTCCAAA
GTGCTGAAACCATTCAAGAGTCAATTGGCGCGCATTATACGCTGAAATTAATCCAAAAGG
AAAACAAAAACAGCGTTTCAAAAAATATACAACTTGTTAGACAATAAATTGTTATCAAAG
ATTTAACGTTCCAGGGAAAAGGTTACGCAAAAACTTCACTGTTTGCGCAACGTCTGGTGC
CGAAGTTGTCAGTGTGAGGATAAGTGAAAGTTCATCCGGTGTATAAATATATCATCGCTC
AATTGCTACAGTTAAAATAATTTATCGCGTTATTTGTCTGATTTTGTTTGATTTTTGTTT
AATTGGTTAGATTGATATATGCTGATAGTTGGCATGATAAATAGGTATAAAGAATGGGAA
ATCGGACAAAAGAGGATGAACTGTACCGAGAAATGTGCAGAGTTGTCGGTAAAGTTGTGC
TGGAAATGCGCGATCTGGGGCAGGAACCAAAGCATATTGTTATCGCAGGCGTATTACGTA
CAGCATTAGCCAATAAACGCATTCAGCGCAGTGAGCTGGAAAAGCAGGCGATGGAAACCG
TCATTAACGCACTGGTAAAATGACCATTCAGGATGAGGCGGTAAGCTTCATCCTGATATT
CTTGCTTCAGTTGCGGTCCAGTTAATCATTCTAAATAACAACTGCTGAAATTATACGAAT
TTCGGTATGTATTTTAATTTATAGCGATAATGTTATTTTTATTTTCTGCAATGAAAGTCA
CAAATAATTGTCGCTTAAGTTAAATTTATTTCAAATGATAATAAATATCAGTTCACTTAT
AATTTCTTGCTTTGTAATTTTAATTGATAACGATCAATGTTAAGGGCTCAGAATAATCAC
ATTATTTTTTCTCCTAACCATAAAGGATTAGTTTATCGGCGTTAATCTTTTCTCATACAC
TATCGGGTTAGGGAAAATATCTGGTGTTGGGGACAGAGTCAGCAGCGTATTAGTTGAATG
CTTAATATCAGGCTGCTGAATTGTCAGCACTGTGTTTGCGAAGAGGATGCGAAATAAATG
AACCCGGTTGATCGTCCACTATTAGATATTGGCTTAACGCGATTAGAATTCTTGCGTATA
TCAGGAAAAGGCCTTGCTGGTCTAACAATTGCCCCTGCGTTACTGTCACTTTTGGGTTGC
AAACAGGAAGATATTGATAGCGGCACAGTAGGGTTGATAAATACCCCCAAAGGGGTGCTG
GTGACCCAGCGAGCGCGATGCACGGGTTGCCACCGCTGTGAAATCTCTTGTACCAACTTC
AACGATGGCTCAGTAGGGACATTCTTCTCCCGTATCAAAATCCATCGCAATTATTTCTTT
GGCGACAACGGGGTTGGCTCTGGCGGCGGCCTGTATGGCGATCTCAACTATACCGCGGAC
ACCTGCCGTCAATGCAAAGAGCCGCAATGCATGAACGTCTGCCCGATTGGTGCGATTACC
TGGCAGCAGAAAGAAGGCTGTATTACCGTCGATCATAAACGCTGTATTGGCTGTAGCGCC
TGTACTACGGCATGCCCGTGGATGATGGCCACCGTAAATACCGAAAGTAAAAAATCCTCG
AAATGTGTGTTATGCGGTGAATGCGCAAACGCCTGCCCAACAGGGGCGTTAAAAATTATC
GAGTGGAAAGATATTACTGTGTGAATCTTGCAAAGGAAAAAATCATGGCTAACGGTTGGA
CAGGTAATATATTAAGAGTCAATCTCACGACAGGAAATATTACCCTCGAAGATTCCAGTA
AGTTTAAAAGTTTTGTCGGTGGCATGGGCTTCGGCTACAAAATTATGTATGACGAAGTAC
CGCCAGGCACGAAACCTTTCGATGAAGCGAATAAATTAGTCTTTGCTACCGGCCCATTAA
CTGGATCTGGTGCCCCCTGTAGTTCTCGCGTAAATATCACCTCACTTTCTACTTTTACCA
AAGGAAATTTAGTCGTCGATGCCCATATGGGTGGCTTTTTTGCAGCGCAAATGAAATTCG
CTGGATACGACGTCATTATTATCGAAGGGAAGGCGAAATCACCGGTATGGCTGAAGATTA
AAGATGACAAAGTTAGCCTGGAAAAAGCCGATTTCTTATGGGGAAAAGGGACGCGCGCAA
CGACGGAAGAAATTTGTCGATTGACCAGTCCGGAAACCTGTGTGGCGGCTATTGGTCAGG
CTGGGGAAAACCTTGTTCCTCTCTCTGGCATGTTGAATAGCCGTAACCACAGCGGCGGTG
CGGGAACTGGCGCAATAATGGGTTCGAAAAACCTGAAAGCGATTGCGGTTGAAGGGACGA
AAGGGGTCAACATTGCCGATCGTCAGGAGATGAAGCGTCTCAATGATTACATGATGACTG
AACTTATTGGTGCGAATAACAACCATGTCGTGCCAAGTACGCCACAATCGTGGGCAGAGT
ATTCAGATCCCAAGTCACGCTGGACAGCACGTAAAGGGCTGTTTTGGGGCGCGGCTGAAG
GTGGTCCGATTGAAACGGGTGAAATTCCGCCAGGCAATCAGAATACGGTCGGCTTTCGTA
CCTATAAATCCGTTTTTGACTTAGGACCGGCGGCAGAGAAATACACAGTAAAAATGAGCG
GCTGCCACTCTTGCCCGATCCGTTGTATGACCCAAATGAATATTCCTCGGGTGAAAGAGT
TTGGCGTGCCCAGCACAGGTGGTAACACTTGTGTAGCAAACTTTGTCCATACCACCATCT
TCCCGAACGGGCCGAAAGATTTTGAAGATAAAGACGATGGTCGTGTGATTGGTAACCTGG
TGGGTCTGAATTTGTTCGATGACTACGGCCTATGGTGTAACTACGGGCAGTTGCATCGCG
ACTTTACTTATTGTTACAGCAAAGGTGTGTTCAAGCGTGTTCTGCCAGCTGAAGAGTATG
CAGAAATTCGCTGGGATCAACTGGAAGCGGGTGACGTTAACTTCATTAAAGATTTTTACT
ACCGTCTGGCGCATCGTGTGGGTGAGCTGAGTCACCTGGCTGATGGTTCATATGCCATCG
CAGAACGCTGGAATTTGGGTGAAGAGTACTGGGGCTACGCGAAAAATAAACTCTGGTCGC
CGTTTGGCTATCCGGTTCACCATGCCAATGAAGCGTCAGCGCAGGTCGGTTCCATTGTTA
ACTGTATGTTCAACCGTGACTGCATGACGCATACCCATATCAACTTTATTGGTTCCGGCT
TGCCATTGAAACTGCAACGTGAAGTGGCGAAAGAACTTTTTGGTTCTGAAGATGCTTACG
ATGAAACCAAAAACTACACGCCAATCAATGACGCAAAAATTAAATATGCAAAGTGGTCGC
TGTTGCGGGTCTGTTTGCATAACGCCGTCACCCTGTGCAACTGGGTCTGGCCAATGACCG
TTTCGCCGCTGAAAAGCCGTAATTACCGGGGCGATCTGGCGCTTGAAGCCAAATTCTTCA
AAGCGATCACCGGCGAAGAGATGACTCAGGAAAAATTAGATTTAGCTGCAGAGCGTATTT
TTACGTTGCATCGTGCCTACACGGTAAAACTGATGCAAACCAAAGATATGCGTAATGAAC
ACGATCTTATCTGTTCCTGGGTATTCGACAAGGATCCGCAGATCCCGGTCTTTACTGAAG
GTACTGACAAAATGGATCGTGACGATATGCATGCTTCGCTCACGATGTTCTACAAAGAAA
TGGGCTGGGACCCACAGCTTGGTTGTCCAACCCGCGAAACATTGCAGCGTCTGGGGCTGG
AAGATATTGCCGCCGATCTGGCAGCACACAATCTACTGCCTGCGTAAGGAATGGGTAAGA
TGAACCATCAGGATGAATTGCCGTTAGCGAAAGTCAGCGAAGTTGACGAGGCGAAGCGGC
AATGGTTGCAGGGGATGCGTCACCCCGTTGATACGGTAACCGAACCAGAACCTGCTGAAA
TCCTGGCTGAGTTCATTCGCCAGCATTCTGCGGCTGGGCAGCTGGTGGCGCGCGCCGTGT
TTCTCTCGCCACCCTATTTGGTTGCAGAAGAGGAACTGTCAGTTTTGCTGGAAAGCATTA
AGCAGAACGGAGACTACGCGGATATCGCTTGTTTGACGGGAAGCAAGGATGATTACTATT
ACTCAACGCAGGCCATGAGTGAAAACTACGCGGCGATGTCTTTGCAAGTTGTGGAGCAGG
ACATTTGTCGCGCCATTGCACACGCCGTTCGTTTTGAGTGCCAGACGTATCCTCGTCCTT
ACAAAGTCGCCATGCTGATGCAAGCGCCATATTACTTCCAGGAAGCGCAGATTGAAGCCG
CGATCGCCGCGATGGATGTTGCACCTGAATATGCCGATATACGGCAGGTGGAGTCATCGA
CGGCGGTGTTGTACTTGTTTAGCGAGCGATTTATGACCTATGGCAAGGCTTATGGCTTAT
GCGAATGGTTCGAGGTAGAGCAGTTTCAGAACCCCTGAAATTTCAGGGAGATGTCATGGA
TAGGGTGGACAGTTGCAGCCACTGCATTAGGGGATAATCAGATGTCCTTCACTCGACGCA
AATTTGTTCTGGGGATGGGAACAGTAATCTTTTTTACTGGTTCTGCGTCTTCTCTGTTAG
CGAACACGAGGCAAGAAAAGGAAGTTCGGTATGCCATGATTCATGACGAGTCACGGTGCA
ATGGCTGTAATATTTGCGCCCGCGCATGCCGTAAAACTAACCACGTCCCCGCTCAGGGAA
GCCGTTTATCGATAGCACACATTCCAGTCACCGATAACGACAACGAAACGCAGTATCACT
TTTTTCGCCAGTCATGTCAGCACTGCGAAGATGCTCCGTGCATCGACGTTTGCCCGACGG
GGGCGTCGTGGCGTGATGAGCAGGGGATCGTGCGGGTAGAAAAATCGCAGTGCATCGGCT
GCAGTTATTGCATTGGCGCTTGTCCGTACCAGGTTCGCTACCTTAACCCTGTCACTAAAG
TGGCAGATAAATGTGATTTCTGCGCTGAGTCCCGACTGGCAAAAGGCTTTCCGCCCATTT
GCGTCAGCGCCTGCCCGGAACACGCATTGATCTTTGGTCGCGAAGATAGCCCAGAAATTC
AGGCGTGGTTGCAGCAAAATAAATACTATCAATATCAGCTACCTGGTGCCGGGAAACCGC
ATCTGTATCGCCGGTTCGGTCAACATTTGATTAAAAAGGAAAATGTATGAACCCGTCGCA
ACATGCTGAACAGTTTCAGAGCCAGTTAGCGAACTATGTGCCACAGTTCACTCCCGAATT
TTGGCCGGTGTGGTTGATCATTGCCGGAGTATTGCTGGTTGGGATGTGGTTGGTGCTGGG
GCTGCATGCCTTGCTTCGTGCTCGTGGCGTGAAGAAATCAGCCACCGATCATGGTGAGAA
GATTTATCTTTACAGCAAAGCGGTCAGATTATGGCACTGGTCGAATGCGTTACTCTTTGT
ATTGTTGCTGGCCAGTGGGCTGATAAATCACTTTGCGATGGTGGGCGCAACTGCGGTTAA
AAGTCTGGTTGCGGTGCATGAAGTTTGCGGATTTTTGTTACTGGCATGCTGGCTCGGCTT
TGTGCTGATCAATGCCGTTGGGGATAATGGTCACCACTATCGCATTCGTCGTCAGGGGTG
GCTGGAACGAGCGGCAAAACAAACGCGATTTTATTTGTTTGGCATTATGCAGGGGGAAGA
ACATCCTTTCCCGGCAACAACCCAGTCTAAATTTAATCCCTTACAGCAGGTCGCCTATGT
TGGTGTCATGTATGGATTGCTGCCGTTGTTACTATTGACGGGGCTGCTGTGTCTCTATCC
GCAAGCCGTGGGAGATGTGTTTCCTGGCGTAAGATACTGGTTATTGCAGACACATTTTGC
TCTGGCATTTATAAGCCTCTTTTTTATCTTCGGTCATCTTTATCTTTGCACCACGGGGCG
TACGCCACACGAAACCTTTAAAAGCATGGTCGATGGCTATCACCGGCACTAACGAATGAT
CATTACACAAGCAGACCTGCGAGAATGGCGTATCGGAGCGGTGATGTATCGCTGGTTCCT
GCGCCATTTCCCACGCGGCGGTAGTTATGCCGATATTCATCATGCACTGATTGAGGAAGG
ATATACGGACTGGGCGGAGAGTCTGGTTGAGTATGCGTGGAAAAAATGGCTGGCGGATGA
AAACTTCGCGCATCAGGAAGTTTCCTCTATGCAAAAACTGGCCACAGACCCCGGAGAGAG
ACCATTTTGCAGTCAGTTTGCCCGCAGCGACGATCATGCTCGCATCGGCTGTTGTGAGGA
TAACGCCAGAATCGCAACCGCTGGGTATGCCGCGCAAATTGCCAGTATGGGTTATAGCGT
GCGGATTGGAAGTGTCGGCTTTAACAGTCACATTGGCAGCTCCGGTGAACGCGCACGGGT
TGCTGTAACCGGTAATTCTTCGCGGATAAGCAGCGCTGGAGATAGCAGTCGGATTGCGAA
TACCGGAATGCGAGTACGCGTTTGTACATTGGGTGAACGGTGTCATGTCGCCAGTAATGG
TGACCTGGTGCAAATCGCCAGCTTTGGCGCAAACGCCAGAATTGCCAACAGCGGCGACAA
TGTACACATCATTGCCAGCGGTGAAAATTCAACGGTAGTGAGCACGGGCGTGGTCGACTC
AATTATTCTCGGGCCAGGAGGAAGCGCCGCACTGGCATATCATGACGGCGAAAGAGTTCG
CTTCGCCGTCGCCATTGAAGGTGAAAACAATATTCGAGCCGGAGTCCGCTATCGTCTTAA
TGAACAGCATCAGTTTGTTGAGTGCTGATAGCTTTACCTTTAATCAAACGAAAGACGCCG
ACGAGCACGGGATGCAGGCTTTACGACCGCCCGAGCCATCGCCTCACCAATTTCTGCACA
TGCCGTAAGTCCCTGAACGAAAGGCTGGTCGTGCATCAACCAGGGCAACGCGCCGAACGC
TACGCGCCCACGAATATCTTCGGGTTGCTGTAACGTATAATCTTCGCCAACATCAGGGAT
TTCATCCCCTGTTTTCTGTAATTGCTCGCGTAGCCCAGGGAAAGGGATATCTTTCACTTT
AAGCGGACGTTGTCCGCGGGCATCAATAAAAACGTCAAACGAGTAGCTGTTGTCTTCCGT
TTTCAGGACGGTGCGCGACTCATTAATTTCCATTTTGTAGTCTTCACCGAGGGCGAGAAT
ATGAATGATTCCCGCTTCACGTAAGGCAAGTAGGCGACGAATAGACTCTGAAGGGATTGC
CGCATAATTATCGATGAAAACCCGGGCAAGGCCTTTACTGAACCGTTTATGGTCGTGTTC
ATTCAGATGTGGAACAATTTCCTGTACGGCTTCATGCAGGCGCAGAATGACATAACGCCA
GGGAACAGTATGTTTTTCTCGTTTATTGCGTTCGACTTCCTGGAGATTTTTTTCTGCCCA
GTCAAATGGGTCGCGTTGTTTGCGCTCGGCAAACCAGGCTTGAGCAAAGGAATCGACATT
CAGGCTCTCTAAGGCTATGCGTTGACTCCAGTCTGGATCAGCAAACTTGATTTCCTCTAC
TATCAATCTAAATACCCGATCCAAAAGGCCCTCTTCGCCTTTTTGAATCTCAGCATTTAA
TGCCTGATCGGTGACGATGTGTAAGGGCTCGTAGGGAATAGGGCAATAGAAATCGGCTTC
GGGTAAAATACCCGTGCGCGACAACAACGTGATATTTAGCTTTTCACTTGCGTTATCGCG
GTGAAAAACGACGTGTTGTTTATCATCTTCAATGAACGAACCATGCTGAATAGCCACTGC
CATTGCCGCATCCAGTCCGCTCAAGGATGTTCCCATAATACCCACGTTACACGCATCGAC
CTTTGCTTCCATCAGGCCTGACCACGGGCTGGGAAAATACGTTCGGGTTGCTTCTTCTTC
ATCAGGCCAGACGTGACCCGTGGCGATCACCGCTAAATCAAACGTCTCGCTGGGTAAATC
CTGATTTGTAGCGAGCATGACGCCAGCATTTGTAATTTGCAGATCGGTAACCTGGCATGA
TTCATAAACAGCCACTGCAAATTTTTGCTGTCGTGCCTGGTCTACTAGTCGTAAAAATTG
ATCGCGGAAATATTCGCCCAGCAGAATTCGCGGTAAAAACTGACGATCGTGCAAGGTTTC
TTTTTTAACGCCATAACGCTGGAGATGGCTGTCTTCTTGCTTTTGTAGCCATTCGAGATA
CGTACAATAAATCGGCGGTATTTCAATACTGGCAATATTTGCCAGCATCATTTTTGAGTT
TTCCTCATCACTGTATGGCATCCCGACACCGGCCTCGTCAGCCTGCTCGAAGATAGAAAT
AGAAAGTGGAGTTTGTTGCTGTAGAAGCGAGAATAAGGTGTAGATCCCCGTAGGCCCGGC
ACCCACAATAGCAATTTTTTTCATTGTTACTTACCTGTACGCATTCTTTCGAATTTAGTG
TTATCAGATAAGTTTGGTTGAGATTTTTAGAATTTGAGAAATTTCAGACAGGGATGAAAA
GGGCGCTAACCGCCCTTGATTAAATTCTGTCAGGCGAGTTTTGCCTGATTGATTTGACTA
AGTGGCTCATTGACATCGAAAACTTTGGCGACAACTTCCTCAACGCCGAGATTTTTCAGT
CGGGCAGTATGTTTTTCCAGATAGGCAAGGGCGCTTTTTTCATCAGTGAAAAGGTAGATC
CCACCGGCTTCGTGGTTCTTTTCACTTTCTGTCCATACCTTCCACAGAAAACCAGGTTCC
TGATTAATCGACTCAGCAAGTGGTTTAAGCTGCTCAGCCATTGCGTCGCCAAATGGGCCA
TTAAAAGCAAAATGAAGTTGTAACAAAGTTGCCATAGCGATTCTCCTTCTGATAACGCAT
ACGAAGACAGTGTAAATCTTTTAACGTATTGGATACAGAGAAGAAACAGAGGGAAAAAGG
AGAAGACCAGATTAAGAAAATCTGGTGCGTCCGAGTGGACTCGAACCACCGACCCCCACC
ATGTCAAGGTGGTGCTCTAACCAACTGAGCTACGGACGCAGGATGGTGCGTTCAATTGGA
CTCGAACCAACGACCCCCACCATGTCAAGGTGGTGCTCTAACCAACTGAGCTATGAACGC
AACGTTGTAGGTGACAACGGGGACGAATATTAGCGGCAGAGTGGGAAGGTGGCAAGAGGC
AAAACGTAATTTTCTGCGCTATTTCGACCGTTTGCAGAGCTTTTAAGCAAATTGGCTATA
TTTTGTTGATTTGCAAGGGTGATTTTTATTCAGGATCGCATTTACATCTGATACAACCCA
ATAATTCGTGTATCAGAGTTTAAACAGAGTTGTTTGCCACCATCTCAAATCTGTCGTGGA
TAAATCCTCCGTAGCCTTTACACTTAGGTAGCAATAAAGGCACACAGATGCAGCAAAGGA
ATAAATCATGGGATCTGATGCGAAAAACTTGATGAGCGACGGGAACGTGCAAATTGTTAA
GACCGGCGAGGTCATTGGCGCGACGCAACTTACTGAAGGCGAGTTGATTGTTGAAGCTGG
CGGAAGAGCCGAAAATACCGTGGTCACGGGGGCTGGCTGGTTGAAAGTGGCAACCGGTGG
GATCGCCAAATGCACACAGTACGGTAACAATGGCACGCTATCGGTCAGCGATGGTGCCAT
TGCCACAGATATTGTTCAGTCCGAGGGAGGCGCAATTAGTCTCTCTACGCTCGCTACGGT
TAATGGCCGCCATCCCGAAGGTGAATTCAGCGTTGATAAAGGTTATGCCTGCGGTTTGTT
GCTGGAAAATGGCGGTAACCTGCGTGTACTGGAAGGACATCGCGCGGAAAAAATCATTCT
CGATCAAGAGGGCGGCCTGTTGGTTAATGGGACAACCTCAGCGGTCGTGGTAGATGAAGG
TGGTGAATTGTTGGTGTATCCAGGTGGGGAAGCCAGCAATTGTGAGATTAATCAGGGCGG
CGTTTTTATGCTGGCCGGGAAAGCCAGTGATACGTTGCTTGCTGGTGGCACCATGAATAA
TCTCGGTGGTGAAGACTCTGACACTATTGTTGAGAATGGATCCATTTATCGTCTGGGGAC
GGATGGCCTTCAGCTCTACAGTTCCGGTAAGACGCAAAACCTGTCCGTGAATGTGGGTGG
TCGGGCTGAAGTGCATGCCGGTACGCTGGAAAACGCGGTAATACAAGGTGGGACAGTGAT
CCTGTTGTCACCCACCAGCGCGGACGAAAATTTTGTCGTAGAGGAAGATCGCGCACCGGT
TGAACTGACCGGGAGTGTTGCATTACTGGACGGCGCTTCAATGATTATTGGTTATGGCGC
AGAGCTGCAACAATCAACGATTACTGTACAGCAGGGCGGTGTGTTGATTCTAGACGGCAG
TACGGTAAAAGGTGACAGTGTCACTTTCATTGTTGGTAACATCAATCTGAATGGTGGAAA
ACTGTGGCTGATCACTGATGCGGCAACGCATGTGCAACTGAAAGTGAAACGCCTGCGCGG
AGAGGGAGCGATTTGCCTGCAAACCAGTGCAAAAGAAATTTCACCTGACTTCATCAATGT
GAAAGGGGAAGTTACCGGGGATATACACGTTGAGATAACAGATGCCAGTCGGCAAACTCT
GTGTAACGCTCTGAAATTACAGCCAGACGAAGACGGGATTGGCGCAACGCTCCAGCCTGC
GTAAAAATACAGGCGCAACCCGTGAAGGTTGCGCCTTGTCTTTATTAGCGGGATGCTCGT
TGCAGAATGATGGCTGACGGCAGACGTTGCAGGAACCGCATACGCAACATCATCATAATG
GCTGCCGACGTCAGGCCAATAATAAAGCCTATCCAGAAGCCTGCTGGCCCCATAGGTTCA
ACGACCAGATCGGTCAGTGCCAGAATATAGCCGCTTGGCAAGCCCAGCACCCAGTAAGCC
GTAAAGGTAATATAGAAAATGGAACGCGTATCTTTATAACCACGCAAAATCCCACTGCCA
ATCACCTGGATTGAGTCAGAAATCTGATATACCGCCGCCAGCAACATCAAATGCGCAGCC
AGCGTTACAACCTCGGGATTGTCGTTGTACAACAGGGCGATTTGCTCCCGCAGTGAAACC
GTGAAAATGGCCGTCAGGGTTGCCATACAGACACCCACCATAAGCCCGGTCCGCGCAGCG
GTTTGCGCATCCAGCGTTGAGCCCTGACCCAGACGATAACCTACGCGGATAGTTACCGCT
GCCGCCAGCGACATTGGAAGCACGAACATTAGTGAACTAAAGTTCAGGGCAATCTGGTGT
CCTGCGACATCAACAATACCGAGCGGAGACACTAACAGAGCCACGACGGCAAACAGTGTC
ACTTCAAAGAACAGTGCCAGCGCAATCGGCAAACCGAGTTGAATCAGTCGTTTCATAACC
GCAGGATCGGGTTTTGCGGTGCCTTTTTCGTTACGAATATCGCGCATGGAGCGGGCGCGT
TTAATGTAAGAAACCATGGCAAGGAACATGACCCAATACACCGCCGCAGTAGCCACGCCA
CAACCAACGCCACCGAGCTCAGGCATACCGAAATGACCATAAATAAAGATATAGTTCACC
GGGATGTTCACCAGCAGGCCGATAAAGCCCATTACCATACCCGGCTTGGTTTTTGCCAGA
CCTTCACACTGGTTACGGGCAACCTGGAAGAACAGATATCCCGGCGCGCCCCACAACAAC
GCACGCAGATAACCCACGGCTTTGTCCGCCAGAGCCGGATCGATGTTTTCCATGGAGCGG
ATAATGTAACCTGCATTCCACAGCACCAGCATAATGAGAACGGAAACAAAACCTGCCAGC
CAGAAACCTTGTCGCACCTGATGCGCAATGCGCTCACGTCGACCGGAACCATTTAATTGC
GCGATAACCGGCGTTAATGCCAGCAGCAGTCCGTGACCAAAGAGGATCGCCGGAAGCCAG
ATAGAAGTACCGATAGCGACCGCCGCCATGTCGGTGGCACTATAGCCGCCCGCCATCACG
GTATCGACAAAACCCATCGCAGTTTGGGCGATTTGCGCGAGAATCACCGGGATTGCTAAT
GCTAATAACAGACGCGCTTCACTGATATACTTCTGCACGTGAACACCTTTTATTTGTAGT
TATATGAGAGACTAAAAAGCCGCCTGAATGGGCAGCAAAAAGAAGAAGCAGGGGAAATTC
AGTCTATTGTAGCGAGGATTTATTAATTCTCCAGTGAAAAAATAGCCATTCTTACCCCTT
CACTGGTAAGGGCGTTTTCCACCTGCTATTGTGCTGAACAGAATGTCTTAACTGATTTCA
GGAGTTGTAAGTATGTTTACGGGGATTGTACAGGGCACCGCAAAACTGGTGTCGATTGAC
GAGAAACCAAATTTTCGTACGCATGTGGTGGAGTTACCCGACCACATGCTGGACGGCCTG
GAAACCGGTGCTTCCGTGGCGCATAACGGTTGCTGCCTGACCGTGACGGAAATTAACGGC
AACCATGTCAGTTTTGACCTGATGAAAGAAACGTTACGCATTACCAATCTTGGCGATTTA
AAAGTGGGGGATTGGGTAAACGTTGAGCGTGCGGCGAAATTCAGTGATGAAATTGGCGGA
CACTTAATGTCAGGTCATATTATGACCACTGCTGAAGTGGCGAAAATATTAACCTCAGAA
AATAATCGCCAGATCTGGTTTAAAGTCCAGGATAGTCAGTTGATGAAATATATTCTGTAC
AAAGGATTTATTGGCATCGACGGTATTAGCCTGACCGTCGGCGAAGTCACGCCAACGCGT
TTTTGCGTCCATTTAATTCCGGAAACACTGGAACGCACGACTCTTGGGAAGAAAAAACTT
GGCGCACGCGTCAACATTGAAATCGATCCACAAACTCAGGCAGTGGTAGATACGGTAGAA
CGTGTGCTGGCGGCACGAGAAAATGCCATGAATCAACCAGGCACAGAAGCCTGATCTGAA
ATCGCCCCCGGAGAGGGGGCGATAGAATAGCCTTTAGCGAGCCACTCGAAGGCCGTTTTC
AACACCGCGTGAGAACACGACCTGCCAGAGCTGAATATCACGGGCGCGGAAAGCACCTGC
ACAGGCATTCAGATAATAGGTAAACATTCGTTTAAAGCGTTCACTATAGTTATCCGCAAT
TTCTGGCCATGCGGCGAGGAATCGTTCATACCACGCCATCAACGTAGTATCGTAATCAGC
ACCGAAGTTATGCCAGTCTTCCATCACAAAGTGGGGTTCGCTGGACTGAGCAATCTGGCG
TACAGAGGGCAGGCAACCGTTCGGAAAAATATATTTATTAATCCAGGGATCAACATTCAG
ATCGGTTTTTTTCGAACCGATAGTATGGAGCAGGAATATGCCTTCCGGTTTCAAATTACG
ATCCACCACCGCAAAATAGGTATCGTAATTTTTCGGTCCGACGTGCTCGAACATCCCCAC
AGAAACAATACGATCAAACTGGTCGTTCAGGTCACGATAATCTTGCAGCAAAATGGTGAC
ATCCAGGCCTTCACAGCGTTCCTGAGCCATTTTTTGCTGTTCGGCAGAAATGGTGACGCC
CACCACGCTTACGTCATAATTAGATGCCATGTAGTGTGCCAGTCCGCCCCAGCCGCAGCC
AATATCCAGTACGCGCATCCCTGGTTTTAACTGCAATTTTTCACAAATCATTTTGAGCTT
CGCCTGCTGGGCAGATTCCAGATTATCGGCATCTTTCCAGTAAGCGCAGGAATATTGCAT
GAAGGGATCAAGCATGCGGCTGAACAAGTCATTACCCAAATCGTAATGCTCTTTGCCGAC
TATCCAGGCACGTTTTTTACTCTGCAGATTGAAGAGACGAGCGCCGGCAATACGCAGCGT
GTCTTTGAAATGATGGGGGAGTTGGTTCTCGAGACCTGCGCGTAAGACTTTGCTAAAAAA
CATATCCAGTCGGTCACATTCCCACCAGCCATCCATATAACTTTCGCCTAACCCCAAAGA
GCCTTCTTGCAGAACGCGTTTAAAAAAATCGGGGTTTTTCACACGAATATCCGCCGGGGC
AGAACCGTTAATGGCTATACCGGCACGGCTAAGTAATTCGTTGGCGATACGGTACCAGTT
GTCATCCGGTACACTGACTTCTTCTATACACGATGAACTCATAGTTTCTCCATCACTGGT
CGGTGATCAGAACCTTAAAACAGCGTAGACGCTTTTTGGGCTTTGTGAGAAATCTCGCAG
AAAAAACCGCGAGTCTATAATCCGACGTAGAACAGAGGGAAAGGAGGAACCCTTGCCGAA
ATGACTATCCATAGTGAGTCGGGAACGATCCTGTCCCCGTAAAAACATAATATTTATCGT
AGCTTTAACAACTCGAAATTAGTATAGGCCGCTAATTTCAATCATACAACAAAATTTTGT
TAGCAGCCTAAGTATAAGTATATCGATATAGATCAGTGTGATTCGCTATGAGCGACTTCG
GCATTGCCATGATTCTGGCAGCCAACTTCTTCACAACGTTGCATCATGTAACCCAGCGCG
ACCAGCACTACTGTTGATAACATCACGCTGGTGGTGGTGAGCAATGGCGTGCTGATACTG
ATCAGCCAGGAAACTACCAGACTTGCGAGGAAGCACAGACCCAGTTGAAGAGTGTTCTGC
AACGCTGCGGCGCGACCAGTTGCGTGTGGGAAGGGACGCAGCGCCTGGGCGACAACAATA
GGGTAGATCGCGCCATTGGCAATCGCCATCACACAGAATGGGATCAGGATTTCGACCAGC
GACACATGGCTAATGAAGCCCGCAGCCCAGGTCGCAATGACGCTGACAGCAAACAGCACC
AGCAACCACGGTAATAACTGCTTGCCTTGCCATTTCTGCAGCGCGGCGCGACAGCCATAA
CCACCAATCAGAAACGCGATAGTTTGCGGGACATAACTTAAACCAATAACTGCCGGGCTG
TAGCCCATTTCACTAAGGATGAACGGTGAACCGGTCAGCCATGCAAAAAAACTGGCTGAA
CAGGCTGCGTATATCAGCACGTTGCCGCGATAGGTTTTAGAACGTAGCAGGTCGGTAAAG
GTCAGACCATCCTGACTATTGTTACGGGCCTTCGTCGTGGGTTTGAGCCAGAAAATAGGC
AGAATCAGCACCACGGTAATGGCAAACAGGGTGGCGAAAATCGCCTGCCAGGAAAAATGG
ACCAGCAGCCAGCTTCCTAACAGAGGAGCCAGTGCCGGAGATAGACCCACCAGCGGCATG
ATGGCCGCAAAAATACGGTTAACTTTCTGTGAAGGATAATAATCTGTCACTAATGCTTGC
CAGATAACCGCCGCGGCGCAGACACCCACAGCCTGTACAAAACGCAATACCAGCAGCGTA
GCGGCGTTTTCTACCCACAGCATCCCCAGACTACCTAACGCAAAAATTGTCAGGCCGATT
AATAATACCGGTTTACGACCATAACGGTCGGAGAGCGGCCCCCACAGAAGCTGGGCTGCG
GCAAAACCGGCAAGGAACAGACTAAGGCTGGCACTGACAGCAGACGCAGGCGTTTGCAGG
TCGGCCTGTATGGCGGCGAAAGCAGGCAGATACATATCGGTTGCCAGAAAACCGAGTACG
CTCAAACCCGCCAGCCAGACTAAAAATCTTTTCCCAGGTTGCATGTATATTCTCTAAATC
TCTCAATTAAACACCGCCGCAAAGTGTAGGGAGTGAAATTAGTGTTGTGAAACGGTAATA
TTTGATGACTGGTTTCAAAAATTTTGCAGGCAGACTATGTGGTCAGAATATTCACTCGAA
GTTGTTGATGCGGTAGCGCGTAATGGTAGTTTTAGCGCTGCGGCACAGGAGCTGCATCGC
GTTCCTTCTGCGGTCAGCTATACCGTGCGTCAGCTGGAAGAGTGGCTGGCGGTGCCGCTC
TTTGAACGACGGCACCGTGATGTGGAGCTGACCGCTGCTGGAGCGTGGTTTCTCAAAGAA
GGGCGCTCTGTTGTCAAAAAAATGCAGATCACCCGCCAGCAATGTCAGCAGATAGCGAAC
GGCTGGCGCGGTCAGTTAGCTATCGCAGTGGATAATATTGTCAGGCCAGAACGTACACGG
CAGATGATCGTTGATTTTTATCGCCATTTTGATGATGTCGAACTTCTTGTCTTTCAGGAA
GTGTTCAACGGTGTCTGGGATGCGCTTTCCGACGGGCGCGTGGAACTGGCGATTGGCGCA
ACACGCGCGATTCCGGTAGGCGGTCGTTATGCCTTCCGGGATATGGGGATGCTAAGCTGG
AGTTGCGTTGTTGCCAGTCACCACCCGCTGGCGTTGATGGATGGCCCGTTCAGCGATGAT
ACGTTGCGCAACTGGCCGTCGTTGGTGCGCGAAGACACCTCGCGAACGCTACCTAAACGT
ATTACCTGGTTGCTGGATAACCAAAAAAGAGTTGTCGTGCCTGACTGGGAATCATCGGCA
ACCTGTATCTCGGCAGGATTATGCATAGGGATGGTGCCAACACATTTCGCCAAACCGTGG
CTTAATGAGGGGAAGTGGGTAGCATTAGAACTGGAAAACCCCTTTCCGGATTCGGCATGT
TGTCTGACATGGCAGCAAAATGATATGTCGCCTGCGTTAACCTGGTTGCTTGAGTATCTC
GGCGATAGTGAGACGCTGAATAAGGAGTGGCTGCGGGAGCCGGAAGAGACTCCCGCAACG
GGTGATTAACGACGATAGTCGCGGAACGGGCCGTCAGCCACGGAGCGGCGTTCAATCAAG
CGCGGATGCACTTCAATAGACTGCGGTTCTTCACGTTTGTTGACGATACGATCCAACAGC
ATGTTGAACGCTGTTTCACCCAGCGAATCTTTTGGCTGATGGATCGTGGTCAGCGCCGGC
GTAAAATAGCGCGCGTTGCGCACGTTATCATAACCGATCAGCGAAACATCCTGCGGGACG
CGCAGGCCCATTTCATCAGCAGCACAAAGTGCGCCCATTGCCATGATATCGCCACCACAG
AAGACGGCAGTAGGGCGATGCGGCTGCGACAGGATTTGCTGCATGGCGCGATAACCGGAT
TCAGGTTCAAAGTCACCCTGCACAATCCAGCTTTCCGGCACCTTGATCATCGCTTCTTCC
ATCGCCTTCATAAAACCGGCAAGGCGGCCTGCGCCGGTGTTACGTTCCAGCGGGCCGGGG
ATGACGCCGATTTCGCGGTGACCGCGTTCAATCAGATAACGCCCGGCCATGTAGCCGCCT
TCGAACGCGTTATCAATGACCGCATCGGTGAAGTCAGCTTTTGCTTCACCCCAGTCCATG
ACCACCATTGGGATATGGCGATACTCTTCCAGCATCGCCAGCAACGGCTCTGGGTACTCA
GAACACATCACCAGCAGACCATCGACGCGTTTTTGCGCCATCATCGACAGATAAGCCCGC
TGTTTCTCAAGATTGTTCCACGCATTGCCCAGAATCAGGGTGTAACCTTTCTGGAAGCAA
TTTTTTTCAACTGCTTCAATGATCTCGGCAAAATAGGCCGCTTCGCTGCTGGTCGCCAGC
AAACCGATAGACTTGGTGTGGTTAACCTTCAGGCTACGCGCCACCGCGCTAGGGGAGTAG
TGTAATTCTTTAATCGCTGCCCACACGGCGTTGCGCGTTTCTTCAGCGACGAAACGTGTT
TTGTTGATCACGTGTGACACAGTTGTAGTGGAAACGTTTGCTCGTTTCGCTACATCTTTT
ATTGTTGCCATTCCATTTCACTCCAGACCCTAACTTCAGCTCCTGCAAAATCGCAAGGTA
AACGTTTGCCTTTACACACCTTACGCACAACAAAAGTGTTGCGGTACGCCGGAAAAACGA
CACGGAGCGTCAGGAAGGGGTCAATGGCCAGTACGCAAATAGTGTAAGCGTGGAATTTTG
GCCGATCTTGACGAAAAGGGGAAGTGGTAAAAACACTTATCATTATAAATGACGGGAGAT
TTTTTCATCACAGTGTGTAAAAATGCGTAATATCACTTTTTGTGTGGTAATAAAAAAGGA
GAAAACTTGATGAGCACCGACCTTAAATTTTCACTGGTAACAACGATTATCGTCCTCGGT
TTGATCGTAGCCGTGGGTTTGACTGCCGCGCTGCACTGATTTCCTCTCGAGGGAGCGCGT
TCTCCCTCGCATCTCCTTCCTGTTTGTTAGCAAAATGGCAAAAGTGTTTTCTCTTTTTGT
TATTTTCATTTTTTTGTGATTGCTGTCATGCTTTCGCCACTTTAATGAATATCGCGTAAT
GACGCGAAGAGGTGGAGATAAGGCATGAAAATTAACTATCCGTTGCTGGCGCTGGCGATT
GGCGCGTTTGGTATCGGGACAACGGAGTTCTCGCCAATGGGCTTGTTGCCCGTCATTGCG
CGCGGTGTGGATGTCTCGATTCCCGCTGCCGGAATGTTAATCAGTGCCTATGCAGTTGGC
GTAATGGTTGGCGCGCCGCTGATGACGCTTCTACTTTCTCATCGTGCCCGCCGCAGTGCG
TTGATTTTCCTGATGGCAATTTTCACGCTCGGCAACGTACTTTCCGCCATCGCGCCGGAT
TATATGACCCTGATGCTTTCACGCATTTTGACCAGCCTGAATCACGGAGCATTTTTTGGT
TTGGGTTCAGTCGTGGCCGCAAGCGTGGTGCCAAAACATAAACAGGCCAGCGCAGTTGCC
ACTATGTTTATGGGGTTAACCCTGGCAAATATCGGTGGCGTGCCGGCGGCGACCTGGTTG
GGTGAAACCATCGGCTGGCGGATGTCATTTCTGGCAACGGCGGGGCTGGGAGTGATTTCA
ATGGTAAGTCTGTTCTTCTCATTACCTAAAGGTGGTGCAGGGGCACGACCTGAAGTGAAA
AAAGAGCTGGCGGTATTAATGCGTCCGCAGGTGCTGTCTGCATTGCTGACGACGGTACTG
GGAGCTGGTGCAATGTTTACTCTCTACACCTATATCTCTCCGGTACTGCAAAGTATTACC
CACGCAACACCGGTGTTCGTCACGGCAATGCTGGTGCTGATTGGTGTCGGATTCTCTATC
GGTAACTATCTCGGCGGCAAACTGGCAGATCGTTCAGTTAACGGCACGTTGAAAGGCTTT
TTGTTGTTGTTGATGGTGATTATGCTGGCAATCCCGTTCCTGGCCCGCAATGAGTTCGGC
GCAGCTATTAGCATGGTGGTGTGGGGCGCAGCAACCTTTGCGGTCGTACCGCCGTTACAG
ATGCGCGTGATGCGTGTCGCCAGTGAAGCGCCAGGTCTGTCTTCATCAGTCAATATTGGT
GCCTTTAATCTTGGAAATGCGCTGGGAGCAGCTGCTGGTGGTGCGGTAATTTCCGCTGGG
CTGGGATACAGCTTTGTGCCGGTGATGGGAGCGATTGTCGCGGGACTGGCATTATTGCTG
GTGTTTATGTCAGCCAGAAAACAACCTGAAACAGTTTGCGTTGCTAACAGCTAATTAAAC
AAAAACGCAGAAGGATAACCTTCTGCGTTACAGTTGCTGACAACGTGCGATTTATCTTGC
CGGATGCGGCGAGTGCCTTATCCGACCTACATCGATGATCCGCGTAGGCCTGATAAGCGT
AGCGCTTCAGGCAATGCTGCATTTGCCATCAGTTATTATGCAGCGAGATTTTTCGCTACG
AATTCCCAGTTCACCAGCGCCCAGAAGTGCTCCAGATAGCCAGGACGTGCATTGCGATAG
TCGATGTAATAAGCGTGTTCCCAGACATCAACGGTCAGCAGCGGAGTCGCATCGGTGGTC
AGCGGAGTACCCGCGTTAGAGGTTGAAACGATAGCCAGTTTGCCATCGCTGTTTTTCACC
AGCCAGGTCCAGCCAGAACCAAAGTTTTTGATCGCTGCATCAGTAAACTGCGCTTTGAAA
TCGGCAAAGCTGCCAAAAGATGCGGCGATAGCTTCAGCGACTTTTCCAGTCGGTTCGCCA
CCGGCGTTCGGTGCCAGGCAGTTCCAGTAGAAAGTATGGTTCCAGACCTGAGCTGCGTTG
TTGAATACGCCACCTTCAGAGCTGCGAATAATCTCTTCCAGTGATTTACCTTCAAACGCG
GTACCTTTAATCAGGTTGTTCAGGTTAGTGACATAAGTCTGATGGTGCTTGCCGTAGTGA
TACTCGATGGTTTCCGCAGAAATGTGCGGTGCCAGAGCATCTTTAGCATATGGTAGTGCA
GGTAATTCGAATGACATTGCTACTCTCCTTTATTATTAATTTGCATACGTACAATAGCCT
TATTGTGCGTATGGATAGGGTAGCAAATTAAAAGGTGAGACAAAAGATGAACTTACCCTG
TTGCCGTAACAACAGGGTAAAGTTTTAGCGAAGTGTTTTTGGGGTCATTACCCGACGAGC
GCCAACATAGTGGCGCTGCCAGTAGTCTTCACTGAGAGAAGTGATTTGAATTTCCTGACC
TGTGCGCGGTGACTGAATAAATTTGCCGTTGCCGACATACACGCCGACATGATCGGCTGT
GCCGCGTCCCTGAGTACGGAAAAAGACCAGGTCGCCGTTTTTCAGTTCACTACGTTCGAT
TGGCGCTGCATCACGCAGGTGATACATTTCATTCGCCGTACGCGGAATACGAATTTTCAC
CAAATCTTTATAAGCGTAATAAACCAGGCCGCTGCAATCAAAACCGGTACGCGGTGAGCT
GCCACCCCAACGATATGGCTTACCAATTTGCTGCATCAGTTTATTCATTGCCACTTTCGT
AGCTTTTTGCACCTTCGCTTTGTGCGCGTCGGCAAGAGTTCCTGACGCGGCATTTTTGAC
TTTCACACAATGCGATTTATAGCCCTTACGTTTGGTACACTTTTCGGTAAAGCTGGCTGA
GGCCGTTTTATTGACGGCGTGTTTGCTGCGAGTTTTGGCGTTTTTAGAAGCGGTAATGGA
AGATTTTTTAACGGAAGAAGCGGTTTTGCTTTTGGTCGTACTTTTACTGGCGGCTTTTTT
CGCTGTTTTCTGGGTCTTTTTGGTGGTTGCCGTGCTTTTCTTTTTATCTGCTTTTTTGGT
GATATGAGTGGTAGCAGAACTCTCCCTGGCTTGCTTTGAAGCATGGGCCATAGGCGTTAA
AGGCAGGGTGGTAAAAAGTAAAGCACAGAGCGTGATCGAAATACGGTTTATCCGCGCCAC
TGAGCGTCCCTCTGTAAAGGCAGGTCTATCATGCCTGCGTCTGATTTACAAAACTTGATG
ATTCTAATGCATAGAAGAAGAGAAAGTTAATAGCTTTTATTGTTAAAAAATACGTTTCGT
TGGCGAGCGCAAAAAAATGCAGCAGTGAAAGCTAAAAATGGTTATAAATACGCCAGTTTG
CCGGCATCAGAGAAGAAACGAATATTTGAAATGCAACAAATAGAGCAAAGGGATAAAATA
GCAAAAGCGTGATGAAAATGTTATTTTCCGATGCCGCACTGACCCGCTACAATGTCAGAT
TACTGCCGTAAAGAAGTTTGAGGAAGCAAGACAATGAGCACCACTATCGAAAAAATCCAA
CGCCAGATTGCTGAAAACCCGATCCTGCTGTACATGAAAGGTTCACCGAAACTGCCGAGC
TGCGGTTTCTCTGCCCAGGCAGTCCAGGCGCTTGCCGCATGTGGCGAACGTTTTGCCTAT
GTTGATATTCTGCAGAATCCGGACATTCGTGCGGAACTGCCGAAATATGCTAACTGGCCG
ACCTTCCCGCAACTGTGGGTTGACGGCGAGCTGGTCGGCGGTTGTGATATCGTGATCGAA
ATGTATCAGCGTGGCGAACTGCAGCAGCTGATCAAAGAAACTGCCGCTAAATACAAGTCT
GAAGAGCCGGACGCGGAATAATCCGTCCTGCAATACTGACGGATGCGAACGGGCATCCGT
CAGTCCTTTCTCTATCCCCAATCCAGCCCTTGTGGCGAACTTGAAAATCCCGCCTCACGC
AGCAGCGTAAACATCGGCGTTTGCCGGACCGGTAGATCATTCACTTCTGTTAGCGTAAAG
CGCAGCCGTGGTTCGCGACGCAGTGCGGTAGTCAGCGCGTGGAAAACCTCTGGGGCGAGT
AATTCCTCTTTTTCCTGCCAGACCAGCATTTTTTTGCCACCTTGCGCCAGATAGAGTAAC
AATTTGCCGCCAGAAACGACCACCAGCGCACCCGCCCGACGCGTTGGAACCAGCGTTGCC
GGATGTGCAGGCCAGGGCAGAAGATTTCCCCACACATTAGCCGGATCGTTGGCAGAGAGC
GCCACTGGTGTATAGTGGCGCGTTTGCGTGGCTTGTGTCGCCAGATCGCGCAATCGGTCA
ATAGTCAGACGTTCAGCGAATTGCGCGCCACCCAGACCTTCTACAAAACGACCTCGCATA
ATTCGCCCGGAGTCTTCCATACTTCGACAAAGCGTTTGCATCGATGGAAACCCGCCAGGG
ATATTTTCGGCTATCACCGCCTGACGACTGATGATGCCGTAGCGGTCGAGCATATTTTCC
GCCAGCGCCAGCATCCTTTCGGTATCGTTTAGTGGCTCCACCTGCAATAACGACCAGCGT
CCAGCCAGATTTGGTGTGTTGTAAGATACCCGCGGCGAGACGGGTTGCGCATAGACAGGA
CGTCCACGACGAGCCCGGTGACTGCGGCGAGTTGAGGTGCGTGCGTTGGAACTGCTGCGG
GTGAGGGCGCGTAACGGTGCCCAAATGTCGCTGGTGATGACGCCTTGCCAGACCAGCGCC
CATAACGCCTCTTGCAGGGCAGAGAGATCAACCGATTCGCCGATTTTGTCGCGTATCCGT
TGGCTGATTTGTTGTGCAAACCAGGCTCCTCCGTCAGCCAGAACAGCGACTATCGCTTGT
TGCAGCGCCGAACGATTCGCCTGATCCGCTTCGGCGGGAGTGAACGATTCTGCAGCATAT
TCCTGTAGATGCAGTGCCACCAGGCCGTCATCTTCACCCAGTTTTTTTTGCCCCGACCAG
ATAACCGCACCGGTTGCCAGTAATTCATCGAGCATTTCTGACGAATAGTCGCGTACGCGG
GCAGGCAGGATCTGGCTTTCCCAGAGTGAGGCGGGTAAACCGACTCCGGCAAGCTGTTCG
ATCACCCGCATCACGCCATCTACGCCCTCATAAACGCCTGGCGATGTTGAGGCAAAGAGC
GCCGGGCTACCATCGGTGGCGGGTAATACGCCCTGACGTTCCAGCAGCAATCGCGCATAG
GTCGTGGCTGCAACGGGACGCGTCGCTTCTCTGGCGGCTTGCAGCGAGCGCAAACGCAGA
CGACGAAATACTTCATCGCTCACCCAGATGTCTTGTTGCAGATTCATCACCAGACCCTGT
TCACGCAGTTGCTGAAGCTGCTCTTCGACAATGGCAATACCGAGACTAAACTCATGAGCC
AGTTGTTCAGCCGTGACCAGAGCATGAGCCCGGAGATAGCGCAGAAAGAGGTCGCGAAGC
GGGTAACTGACTCTATGTAAATAAATCTCTGGCAATGACTCTGGTAGTCGTACGCCGAGG
GCATCACGCAGCCTGGCGGCATCATCCATACAGGCAAGACGCTCCTGTCCGCTAATCATC
GCTGGGAAGATTCGTTTTACTGCAAGAAGATTTTCCAGATACGACGCAACCTCTTCACTG
CTGCCTGTATGCCGTTGCGCCAGGTCTTCAACGGTCATTGGCCCCAGTTCGCGCAGCAGG
TCGAACAATCCTTCTTCACCTTTCGCTCTTCTGCCAGGAGCCAGTCGTTGCAACTCTTCT
TCCACCTGGCGAATGACCTGCGGGTCGAGTAATTCCCCCGGATCGACCTGTCCGAGTAGA
TTGCGCAGTAACTCGCTGTCCAGCGACAGTACGGATGCCCGGCGCTCTGCCAGCGGGGCG
TCGCTCTGGTACATAAATTCCGCGACATAGCCGAACAATAAACTTGTGGCGAAAGGCGAG
GGCGTAGTGGTCGTTACATCGGATATTTGAATTTCGCCACCGTTCAGGCGACGCATCAAA
CGTTCCAGTGCGGGAAGATCATAAACATCTTGCAGACATTCGCGTAGGGTTTCGAGAATG
ACCGGAAAATCCGGATATCCCTGAGCGATTTCCAGCAACTGACTGGCGCGCAGCCGTTGT
TGCCAAAGCGGGGTGCGATGGCCCGGAGTGCGCCCCGGCATTAATAATGCCCGCGCGGCG
CATTCGCGAAAACGGGCGGCGAAAAGTGCCGAGCTGCCTACCGCCTCGCGGACAATTTGC
AGCAACTTTTCTGGTTCAAACAAAAAAATCGCGGCATCGGGCAATTTACCATCGGTGTCA
GGAATACGTGCAACAATGCCGTCATCACTGGCGACCACCGACGCGTCAGCGCCCCATAGC
GCATGTATTCGCCCGGCAATCGCCACCGCCCAGGGTTCATGCACCCGTCTTCCATAGGGA
GAGTGCAAAATAATACGCCAGTCACCAATTTCATCACGGCACCGTTCGAGGACCAGATGG
CGACTCCCCGGAACGATGCCCGTCGCGTTGCGCTGCTCCTCAATCAACCCCTGAATATTG
GCGATCGTATTTTCTTCTGCCAGCCACGGGGGAATAGTCCCGGAAAAGAACGCGCCATCC
GCCAGCAAATGAAGAAAATCGCCGATCATCTCGCCTAATTCAGCCGGACGTCCGTTACCT
TCACCACGCCAGAAGGGGAGCCGGGCAGAACGACCCGGAGCAGGAGTCACAATCACCTGA
TCGCGGGTGATTTGCTGGATCCGCCATGAGGTAGCGCCGAGAGTGATAATGTCGTTCACC
CGCGACTCATATACCATCTCCTCATCCAGTTCACCCACCCGCCGCGAACCGGCCTTTTCT
TCACCTTCGGGTAATAACACGCTATACATGCCACGATCCGGAATGGTGCCGCCGCTGGTA
ACCGCCAACAATTGAGCGCCAGGTCGGGCGGTCAATATCCCGGTCTCCCTGTTCCAGACC
AGTTTGGGGCGAAAAGCAGAAAAATCGCCAGAGGGATAGCGCCCGGAAAGCATATCCAGC
GTGGCGTCAAAAACACGTCTTGGCAGATCTTTCCACGGTGCGGCACGGCGTACGCGGGAG
TACCATTCGTCTACCTGTAATGCATCCATCGCCGCGGCGGCAACGGTTTGCTGCGCAAGG
ACGTCGAGAGGATTATGCGGTGGTGTCAGGTTTTCCAGCCTGCCTGCGAACATACACTCT
ACAATGACTGCGGAATCGACTAAATCACGCCGGGTACGGGGGAAAAACAGCCCTTTAGAT
ACACCGCCAACCTGATGTCCGGCGCGACCAATGCGTTGTAACCCACTGGCAACAGAAAGC
GGCGTTGCCACCTGAATCACCAGATCCACCGCGCCCATATCAATCCCCAGTTCAAGACTG
GAGGTTGCGACCACGCAGCGTAATTCACCCGATTTCAGCGCCTGTTCGGTGATTGCTCGT
TGTTCTTTAGAGACGGAGCCGTGGTGTGAGCGGGCAATAAAAACGTCGCTACTTTGTACA
CGGTTAGAGGTTGCGCCGGAGGTCGACTCGAAATGGGCCGCATCAACGGCGATAGACGGG
GAACGCTGTAAGCGTGCGGCGTAAAGCTCATTTAATCGTGCCGTCAGTTTTTCCGCCAGC
CCCCGCGAATTAGTAAAGACAATGGTCGAGCGATGGCGCAACACTTCATCAAGGATACCC
GTTTCAATATATGGCCAGATGGAGCCTTCCCGGCCGGCATGGCTGTCTTCGCCGGTGCCG
CTGGCGACCGATGAGACATCATCCATATTGGCGACCGGTACGACAATTCGTATCTGCGGA
TGGCGCATTGCGGGCGGGTTGACTACCGTAACCGGGCGATCGCCACCAAGAAATGCTGCC
ACATCGCTGGCTGAGCGCACAGTGGCAGAAAGGCCAATTCGCTGTGCTGAGGTGTGGAGC
AGCGCATCGAGCCGCTCCAGACTTAACGCCAGATGCGCACCACGTTTACTGCCCGCTACC
GCGTGGACTTCATCAATAATTACCGTTTCGACGCCGCGTAGCGTTTCGCGCGCGCGGGAG
GTCAGCATCAGATAGAGTGATTCGGGTGTGGTGATCAGAATATCCGGCGGATTACGGGTG
AGTTTGCTGCGTTCCTGTGCAGGCGTATCGCCAGTACGGATCCCTACGCGAAGATTGACT
TCCGTTTCGCCGCGCCGCCGCCGTTCATCGGCAATACCCTTCAACGGGATCTGCAAGTTG
CGCTGAACGTCGGTGCCCAGGGCTTTTATCGGTGAAATATAGAGGATGCGTGAGGTTTTA
CGCTTATGCGCCTCGCGGGTATCTTCGCCGCCTTCGCGGAAGAGCCGATCGAGGGCGTAG
AGAAATGCTGCCAGCGTTTTCCCGGAGCCGGTCGGTGCAATCACCAGCGCATGTTCGCTT
CGCGCCGCCACATGCCAGGTTTGCGGCTGGACAGCGGTCGGCTGTTTAAAGGCGCGAAGA
AACCAGTCGCGGGTCGCCGGTGAAAACACGTCCGGCAGGAGCGATGAAGGGTCTGGATTA
TCTGCCATTAACGCTATTCCCCGTGAATATCATGCAGGATGCGTGGAATAGCCTCACTAT
AGATGCCTGAATCATTGCATGTCATCAGGCATCGACTCGATTACACCTCTTCGGCGGCAG
ATAGCGGCCAGCCTCCCAGACGTTTCCAGCGGTTGACGATTTCACAAAACAGCACAGCAG
TGCGTTCGGTGTCGTACAGCGCGGAGTGCGCCTGGGTGCTGTCGAAGTCCATGCCAGCGG
TCTGGCAAGCCTTTGACAATACGGTTTGTCCGAGTGCCAGCCCGGCCAGTGCAGCAGTGT
CAAAAGTGGCGAAAGGGTGGAACGGGTTACGTTTCAGTGAGGCGCGTTCTGCGGCGGCCA
TCATAAAGCTGTGATCAAAATTGGCATTGTGCGCCACCATAATGGCGCGGTTACAGCCGC
TCGCTTTAATACCTTTACGTACAACTTTAAAAATTTCGTGCAGCGCCTCGTATTCGCTGA
CCGCGCCGCGATCGGGATCGTTCGGGTCAATGCCGTTGAAGGCGAGGGCTTCTGGTTGCA
AATTTGCGCCGACAAATGGTTCGACGTGGAAATGTAATGTGGTGTCCGGCATCAGCCAGC
CTTGTTCATCCATTTTCAGGGTGATGGCGGCAATCTCAAGCAGCGCATCGGTTTTGGCGT
TAAATCCGGCTGTTTCAACATCGATCACAACAGGATAAAAACCACGAAAACGGTCGCACA
GACCGGTAAGTTGAGCGTTATCGGACATCTGATTCTCTTAATACGGATAAATTGCAGCGC
GCATTATGACAAATATTACTTGTCGATGCAGTAAAGATGCGGGCGCGATGAGTTCACGCC
CGGCAGGAGATTAGTTGCCCAGACCGCGACCGGCGTCTTTCTCTTCGATTAACTCAATTT
TGTAACCGTCCGGATCTTCCACAAACGCGATAACCGTAGTACCGCCTTTTACCGGACCCG
CTTCACGGGTCACGTTACCCCCGTTTTGACGGATTTTTTCGCACGCTTCAGCGGCGTTAT
CTACGCTAAGCGCGATGTGACCATAAGCAGTGCCGAGTTCGTATTTATCCACGCCCCAGT
TGTAGGTCAGTTCAATCACCGCTTCTTCGGTTTCCGGGCCGTAGCCAACAAACGCCAGTG
AGTATTTGTATTCCGGGTTTTCGCTGGTACGCAGCAGTTTCATGCCCAGCACTTTGGTAT
AAAAATCGATGGAGCGTTGCAAATCGCCAACGCGCAGCATGGTATGAAGAAGACGCATCT
TTTTATCCTCAAAATGGCTAACAGATTCAAAATGTTGTTTTAGTATAGCGGCGGCTTTAC
GCCGCTCGCAATGTTGGATTACAACGTCGGGTAATCGGTATAGCCTTCCGCGCCGCCACC
GTAGAAACTTTCGGCACGCTGTGGGTTAAGCTCAGCTTTGCGCTGCAAGCGGGCGACCAG
ATCCGGGTTCGCAATCCAGTCACGACCAAATGCCACCGCATCAATTAACCCTTTGCCGAT
CAGCGTTTCAGCTTTTTCTACTGTGTATGCACCTGCGCCGATAATCGGACCGTGGAAACG
GGCGCGTACTTTTTCGCGGAACGCATCAGTATACGGTTCACCCCCCGCCCAATCTGGTTC
TGACATATGCAGATAAGCAATGCCGCGTTTACCCAGTTGTTCAATCAGATACAGTGCATC
GGCTTCTTCATTCGGGCCGTTATCTGTGTTCTGGAAAGTACCGATTGGTGAAACGCGAAT
GCCAATGCGATCGGCACCCCATTCTTCAATCCCGGCATCGACCACTTCCAGTACCAAACG
TGCGCGATTTTCCACGCTGCCGCCGTACTGATCGGTACGATGGTTTGAAGAAGGAGAAAG
GAACTGATGCAGCAAATAACCGTGAGCAGAGTGGAGCTCTACCAGATCAAAACCGGCTTC
ACGCGCGTTAGCAATGGCCTGACGGAAATCATTGACGATACCTGGAATCTCTTCCAGTTC
AAGCGCACGCGGCATGGATGTTTCAACACGGATCGCCTGACCATTTTCATCGCGCAGAGA
AGTACGTGTTCCCGCGCTAAGTGCTGAAGGCGCTACCGGTGCCTGACCGCCAGGTTGCAG
GCTGGCGTGAGAAATGCGTCCGGTGTGCCACAGCTGCACGGCCATATGACCATTTTCAGC
ATGAACGCCAGCGGTGATTTTTTTCCATGCGGCAATTTGCTCCGGACTATGGATGCCAGG
CGCACCTGCATATCCTTTTGCCTGGGCAGAAATTTGCGTGGCTTCACTAATAATCAAACC
GGCACTGGCACGTTGGCGATAGTATTCCGCCATCAACGGGGTAGGAATGTCACCCGGTTC
AATACTGCGCAGACGCGTCAGCGGTGCCATAAAAATACGGTTTGCCGCCGTGATCGCGCC
CACTTTCAGTGGGGAATACAGTTTTTCAGATGACATAAAGGCTCCCGGTCGTCTGGTGAT
AAAAAATGCCTGCTAAACGGCAGGCGTCGCAATAATGTTTTTTACATGGGCCAGCGCGTT
TTCCAGTGGCTCGAAACTGCGCGAAATTTTGGCCTGCAGATTCGCGCCAAGCCACAGTGC
GTAAAGCACTTGTGCCTGTTGCAGCGGTTCGCCACAAAAGGTTAAACAATGGTTCTCACG
GCCATTTTCCAGCGCCTGAGAGAGCAGGGCGATCACGCCGCGAGCACCTTTATCCATCGC
GCTGCGCATATCTTCTGACAGATCGCACACTTCGGCAGAGAGTTTTACTGTCAGGCAACC
ACTGATGGTTCCATGTTGGCAAAACTGGTTCAGTGTTTGCTGGTAATAAGCCAGTATGCG
GTCGCGGTAGTTACCTTCGCCGGATTGCAGCAACTCAGTCAGTCGCTGGTGATATGCGGC
GTAATGACGCTCAAGCATGGCAACGCCAAACGCTTCTTTAGAGCGAAAGTAGTGATAGAA
GGACCCTTTCGGCACTTCAGCGGTTTTTAGTAATTCGCTTAGCCCCATCCCGGTGAATCC
ACGTTGCAGGCAAAGTTGCTCGCCCGTCGCCAGGAGATGTTCGCGAGTATCATGTTCGGT
GTGTTTGTTCATGCGTTGGAGTGTAGTAGACCAGTCGGTCTAGTGCAAGCAAAGTTGCTA
CTTTGGACATTAACAGCTTCAATAATGGTAATAATCTTATCTGAGGAGGGCGAAGTGGCG
GAGCAATTAGAGTTCTTTCCCGTCCAGAGCCCGTGCCGGGGAATTTGCCAGTCTGACGAA
CGCGGGTTTTGTCGCGGCTGTTTTCGTAGTCGTGATGAGCGTTTTAACTGGAATAAAATG
AGCGATGGCGAAAAACAAGAGGTGCTGCGCCTTTGTCGGCAGCGATTAATGCGCAAATTA
CGCGCAAATAAGCCAGCGTCATCAGACGAACCGGAGCAACCATCACTCTTTTGAACCTAA
TCTTGCGTATACTCCTCTCATATCTGATAAGAGGAAGCGATTATGGTTCAGCGTATTACT
ATTGCGCCGCAAGGCCCGGAGTTTTCCCGTTTTGTGATGGGCTACTGGCGATTGATGGAC
TGGAATATGTCCGCCCGCCAGCTGGTCAGTTTTATTGAAGAGCATCTGGATCTCGGCGTG
ACCACCGTGGACCATGCTGATATTTATGGTGGCTATCAGTGCGAAGCGGCGTTTGGCGAG
GCACTGAAACTGGCACCTCACCTGCGTGAACGGATGGAAATCGTCAGTAAATGCGGTATC
GCGACGACCGCGCGTGAAGAAAACGTCATTGGTCATTACATCACTGACCGCGATCACATC
ATTAAGAGCGCCGAACAGTCGCTAATTAATCTCGCGACCGATCATCTGGATTTGCTGTTA
ATCCACCGACCAGACCCGTTAATGGATGCCGATGAAGTGGCGGACGCGTTCAAACATCTG
CATCAGAGCGGCAAAGTGCGTCATTTTGGCGTATCGAACTTTACGCCTGCGCAATTTGCC
CTGTTGCAATCACGTCTGCCGTTTACCCTTGCCACTAATCAGGTGGAAATATCCCCGGTG
CATCAGCCGTTACTGCTGGATGGCACGCTCGACCAACTACAACAACTGCGTGTTCGTCCG
ATGGCGTGGTCCTGCCTTGGTGGTGGTCGTCTGTTTAATGATGATTATTTCCAGCCGCTG
CGTGATGAACTGGCTGTGGTGGCAGAGGAGTTAAACGCGGGCTCGATTGAACAGGTGGTT
TACGCCTGGGTATTACGTTTACCATCGCAGCCGCTGCCAATTATCGGTTCAGGTAAAATT
GAGCGCGTACGGGCAGCTGTCGAAGCAGAAACACTGAAAATGACCCGTCAACAATGGTTT
CGTATCCGTAAAGCGGCACTGGGGTACGACGTACCGTAAGCACTTTTAGGAATAGCCGCC
GTTCAAAAATGTGTCACTGGTTTACACTTATTCAGGAATGCACAATGAACGGAGGTCCTA
TGAAACGTTTTAGTCTGGCTATTCTGGCGCTGGTTGTTGCAACCGGCGCACAAGCTGCCA
GTGAAAAAGTCGAGATGAACCTCGTCACGTCGCAAGGGGTAGGGCAGTCAATTGGTAGCG
TCACCATTACTGAAACCGATAAAGGTCTGGAGTTTTCGCCCGATCTGAAAGCATTACCCC
CCGGTGAACATGGCTTCCATATTCATGCCAAAGGAAGCTGCCAGCCAGCCACCAAAGATG
GCAAAGCCAGCGCCGCGGAATCCGCAGGCGGGCATCTTGATCCACAAAATACCGGTAAAC
ATGAAGGGCCAGAAGGTGCCGGGCATTTAGGCGATCTGCCTGCACTGGTCGTCAATAATG
ACGGCAAAGCTACCGATGCCGTCATCGCGCCTCGTCTGAAATCACTGGATGAAATCAAAG
ACAAAGCGCTGATGGTCCACGTTGGCGGCGATAATATGTCCGATCAACCTAAACCGCTGG
GCGGTGGCGGTGAACGCTATGCCTGTGGTGTAATTAAGTAATTAAGAGGCCAGCGTACCT
TGCGGTGGTGCTTGCTCAAGTTGCGAAAGCGAGCAGTACAGCCGCCAGACAATTGCCGCC
AGCTCACGGGCGGCAGGTTGATGATGACGGGCAAGGCTGTCGCAAATCCGCTGTAATTCT
TCAAGTGTGGCCGCCAGTGATTTTTGCTGAACGCCACGCTCACTCATCACTCCCCGCAAC
AGTGAAATACAGTTATCCCGTACTCGCGATAACGGATCGGAACGCGATTCCCAGTCGCGC
AATTGCCAGACAACATGAGAACAGTTCAGCAGCACTACACCCCAGCGTAATAACCAACGG
CGAGCCAGCGCATCCTGGCTGTTACTCAACTGACTGACGTGATGATAAGTGAGCGATTCA
AATTCGCTTTCACTCAGTGTTGGATGGCGGCTTAGCTGATCGACAAAATCCCGGCGCAGC
GCGCGAATATGGCGGCGGCTTTTACGAGCATCCGATCCTGGACGCAGAATGGCGAACGCT
AACCACGCCAACGCGACGCCAACGATTTTTGCCAGATTATCGTTAAGAAAATCAGCAAAA
TCATACACCGGGGGATTAGTGACAGCGATAAAAGAACCCATAAAAACAATCAGTTGCCCC
CACAATGCGGCAAATTTTGGCATCTGCAATTTAAGAAGCTGCATTGTCGCCAGCAGTGGA
AAGAGAAACAGTAAAAATTGCCACAGATCGCTAATCTGGACCATCAGACCAAATTTGACC
ACAAAGCTGAATAGCGAAAGTAACACCAGCGTGCGCATCAGAAGTGACAACGACTTAAAC
GGTGCTGCGACGGCGGAGTAGAGTACGCAGCTAATTGCTGCCAGCGTTAATGCATTGGCA
CCGGCATCCCATTGCGAAGCAATACTCCATGCGCCAATCATCATCAACGTACAAAATGTA
CGCAGCCCGCTCCACATAGCTTCGGCGTTATCGGTATGACGAGCCAGGCCGGATGTCCGT
GGGAGTCTGGTATGATCATCTACACCGCTTTGCAGACGATGTAATTCCTGACTACTTTGC
AGATAAAGGCGGCAAAAATAACGTAGTCGCTGCCAGAAGGCGACGTGCCGATAGTCGGCG
ACGTTGGTCGGGCGTAGCGGGGCGATAATACGTGCGACGGTGTAAACATCTGTTTGCGAA
CTGGCGAGCGCCGTCAGCAACTGTTCGAGAATTTCTCGTGTGGCACCTGGCGGTGAGGGC
CAGTTGAGCAACATACGTCGCAGGCTGGAGATGACACTGGTCATACGTAATTGCTGGTGG
AGCAGCGCATTAAGGCGCGCGTTTTGCTGGCGAAAACGATAGTGGCTCCAGAAAGCCTGG
ATACGCAGCAAATTCATGGTCAGTATCTGCCCAATCACCCCTTCATGTGCTGCACGAATG
GCATCGGTTGTTTCAGGCTGCCAGAGTAAACTGGCATGTTCCAGTAATCGGGCGTGCATG
TTTTTCAATGCGGTTAAAAGGGCAGTAGCATCGGAACTGCTCGGCAGGATCATCATCATC
ATGCCGCCGCACAAAATACCGACTATTACCTCGCAAACGCGCGCCTGAGCGATATCCCAC
AGCTGGCTGGCCTCAGTAATATTAACCATCGGAAAGGCGATGATGGCAGCCGTGTAGCCC
GCCAGTTGAAATGCATACGCGACGTTATTCGTGAAGTGCGCACAGGCCCAGGTACAAAAG
CCAAGCCACGCCGACATGCTCAATAGAAAAAACCACGGCTCATTGAGCGTATGCCCGGCA
AGAAGCAGTGCCGCAATGGCTCCGAGCAAACTGCCAGCGATGCGTCCGAGGCTTTTGCTG
ATAACACCGCCAACGGTGGGAAAGCTAACCACTGCAGCCGAGGTCATCGCCCAATAGGGT
TCATCCAGATTTAAATAATAGGCAACCGTCAGCGCCAGACACATGGCAATGGTATTGCGT
AACGCATAACGCCATTGCGCCAGCGTGGCCCTGAACCAGGGCAAATTGCGCAAGGACCAT
GACGATGCGTTCATTATTGACCTACGGCAATGCTACAGGTGGTGCCCGACACCAACGTGA
CATCGCCTGGGACTTTATCCAGCGCAAAGCGGACGGGAACGCGTTGGGCGAGTCGAACCC
AGGGGACGTTAGGTTTAACATCCGGAATAAGGCTTGAGTCACTTTCAACGCTCTGATCAT
AAATCGCCCGACCGATACTGGAAACGTGACCCTGTAACGTTTTGTTATCACTATAGAGGG
TAATTTGTGCTGGTGCACCTTCGCGGATATGGCGCAACTTGGTTTCTTCAAAATAACCAA
TGACGTAAAACGAGTGGCTGTCGACAAGGGCAAACAGCGGTTTCCCGGTATCAGCGTAAT
CGCCGATGCGGGTAGTAAGGTTAGTCACCCATCCACTCACCGGGGCGCGAATTTCCGTTT
GCGCCAGTTGCCATTGTGCCTGTTTCAGCGTCGCCTGTGCGGCATCAACACTGGCCTGCA
TCGCTTTAACATTGAGGTTAGCGGTATCGAGTTCTTCGGCAGAAATAAAATTTTGTGAGA
GATGACGACGACGATTCGCTTCGTTATTGGCTTTTGCGAGGTCAGATTGCGCTTTCGCCA
GCTGAGCCTGTGCGTTCAGCTCGGCGATCTGAAAGGGCGTTTTATCGATCGTGAGCAGAA
GATCCCCCGCGTTAACCAGCTGGTTGTCTTTTATATTCAGCTCAACAATACGTCCCGACA
CCTGTGGGGTGATAGAAACCTGTTCTGCGCGTATTTTCCCGTCGCGTGTCCACGGAGATT
GCATGTAATAATTCCACAGCCACCATCCGGCAAGAACCGCAACTACCGCTACAATGATTG
TTGAGAAATACTTAATTGTTTTAATTGACATAGTTACCACGCAATCAGTATTGCCAGAGC
AAGGCAAACGCAAATCGCAAACAGCGATAAATCCATTAACAAGGGATGCCAGATGTCACC
GGCGTAGATCCAGCCACGAAGCAGGCGGTGTACGACAAGCCAGATGACGAATCCAAACGC
GAATGCTTTGAAAAACGGAGGAAAGTAGACGGACGCACCGAACACCAGATCTTGTAAGGG
CAATCCTGTTGCATTGAGCATAAACTTCACAAAGTAGATTCCTTTACGACCGAATATATT
GCGTTAGATTAATAAATATTCTTTAAGTGCGAAAAATTTACGCGCAATTTCTGAAAAATA
TGTCTGACGGTAACCAAATGCAGCAATACATTTGTTTTAGCAATACAATTGCTGCACACT
ATTCTAAAAGCCGCATAATATCTTAGCAAGCTAATTATAAGGAGATGAAATTGGAATCGC
CACTAGGTTCTGATCTGGCACGGTTGGTGCGCATATGGCGTGCTCTGATAGACCATCGCC
TGAAACCGCTGGAGTTAACACAAACCCATTGGGTTACGTTACACAATATCCATCAGTTAC
CTCCAGACCAGTCGCAAATTCAACTGGCAAAAGCGATTGGCATCGAGCAGCCATCACTGG
TCCGTACTCTGGACCAACTGGAAGAAAAAGGGTTAATTTCGCGTCAAACTTGTGCCAGCG
ATCGTCGGGCTAAACGTATTAAACTGACGGAAAAGGCAGAGCCGCTGATCAGCGAAATGG
AAGCTGTTATTAACAAAACCCGCGCGGAAATATTACATGGCATCTCCGCAGAGGAACTGG
AGCAACTGATTACGCTCATCGCAAAACTTGAGCATAATATCATTGAGTTACAGGCCAAAG
GGTGAAATGAAGGGGGCGTGTGGTCAGTAACCTGACCACACGCAAACTTATTTAGCGCGG
AGAAACGGTCACCTGACTGCCATTGCTGGCCAGTACGACACGTTGGCCCGGAGAGAAACG
AGTGTTGCCTTGTTTCTGTACCACCATGATGGTATTACCATCGTCTTTACGAATTTCCAG
CTCGACACCCTGCGTTTTGTTCATTGCACTCTGTACGCCCTGACCAGCTACGCCACCTGC
AACAGCGCCTGCTGCAGTAGCCAGAGAACGCCCGGTTCCGCCACCAACAGTATTCCCCAG
GAAACCACCAAGAACAGCACCGCCAATTGCACCGATAACGTTGGAATCATCACCGCCCTG
AATCTGTACCGGACGTACGTTAACGATGGTGCCATAGCTGACATTCTGTACTTGTTTCGC
TTCAGAAGCGGTATAAACATCCCCTGACAGGGTGTCGTTATTAACACAACCGACAAGAGA
CAGACCTACCATTGAAACAACCAATACGCGTTTAATCATTGAAAAATCTCCTGTTCACCA
TGAAACGCCACGCAAGCATCCCTCATGGTCAAAGTATATGGCATATGTGAATCCATGGTT
ACATGTTCTACCAAATATGAGCAAATCATAATGAAAGTAGGATCAACCAATTATAAACAA
AACATTCATGATGATTATTGATTTGAAGATAATGTTTTACTACCAACGGTAAAAATCGGT
CATTCCGCATGGTATTCACGAAAAGTTTATGTTTGAGTGGTGCGCAAACGTCAGATTGAA
AAAGGATGAACTATGAAATCGGGCCGCTTTATTGGCGTTATGTCAGGCACCAGCCTTGAT
GGTGTTGATGTTGTGTTGGCGACAATTGATGAACACCGGGTCGCACAGCTGGCAAGTTTG
AGTTGGCCGATCCCGGTATCTCTGAAACAGGCTGTACTGGATATTTGCCAGGGCCAGCAG
CTTACACTTTCGCAGTTTGGACAGCTTGATACTCAACTCGGGCAACTTTTTGCTGATGCG
GTCAATGCCTTGCTTAAGGAACAAAATCTGCAGGCAAGAGATATAGTTGCGATCGGTTGT
CACGGTCAAACCGTCTGGCATGAACCGACGGGCGTGGCACCACACACTTTACAGATTGGC
GATAACAATCAAATTGTGGCACGCACCGGAATTACGGTTGTCGGTGATTTTCGCCGTCGC
GATATTGCCTTGGGAGGACAAGGCGCACCGCTGGTACCTGCGTTCCATCATGCGCTGCTG
GCTCACCCAACCGAGCGACGAATGGTGCTCAATATTGGCGGCATCGCCAATCTGTCACTG
CTCATTCCTGGGCAGCCGGTTGGGGGCTACGATACCGGTCCTGGTAACATGCTGATGGAT
GCCTGGATCTGGCGTCAGGCCGGTAAACCTTACGATAAAGATGCCGAGTGGGCACGGGCG
GGTAAAGTTATTCTCCCACTGCTGCAAAATATGCTCAGCGACCCGTATTTCTCGCAACCT
GCACCGAAAAGCACCGGACGCGAATACTTTAACTATGGTTGGCTGGAGCGCCATTTGCGC
CATTTTCCGGGTGTTGATCCCCGAGATGTGCAGGCGACACTGGCAGAACTCACCGCCGTG
ACCATTTCTGAACAAGTTTTGTTGAGCGGTGGCTGCGAACGATTGATGGTATGTGGTGGA
GGTAGTCGTAATCCGCTACTCATGGCGCGTCTGGCGGCATTACTGCCAGGCACAGAAGTC
ACCACCACCGATGCCGTTGGCATTAGTGGCGATGACATGGAAGCATTGGCTTTCGCCTGG
CTTGCCTGGCGGACGCTGGCGGGATTACCAGGAAATCTGCCTTCCGTCACTGGCGCAAGC
CAGGAGACGGTACTGGGGGCTATTTTCCCCGCTAACCCGTGATATCAGAGTTAACTGAAT
TTTTCTTACCGCGTCTGCCGTTACACTTGGAACGTTAGGGAGGGCGTATTGCCCTCCAGA
CCAGGAAAGTCTTCGGGATATGACTATGAAAAAACTGTTAATTATCATTTTGCCGGTCCT
TCTCTCCGGCTGTAGCGCCTTTAATCAGCTGGTTGAGCGCATGCAAACCGATACGCTGGA
ATACCAGTGTGATGAAAAACCGTTGACGGTCAAACTGAATAATCCGCGCCAGGAGGTCAG
TTTTGTTTACGATAATCAACTACTGCATCTCAAACAGGGCATTTCAGCCTCTGGCGCGCG
TTACACTGACGGAATCTATGTTTTCTGGTCGAAAGGCGATGAAGCGACTGTCTATAAACG
CGACCGCATCGTCTTGAATAACTGTCAGTTACAAAATCCACAGCGTTGAGATTTTTCCAG
GGGCGGCGCACAATAGCGTCACCCACTGACAATCCGTAAAGAAAACCATGTCTGATAACG
ACGAATTGCAGCAAATCGCGCATCTGCGCCGTGAATACACCAAAGGCGGGTTACGCCGCC
GCGATCTTCCCGCCGATCCATTAACCCTTTTTGAACGTTGGCTCTCTCAGGCTTGTGAAG
CCAAACTGGCGGACCCTACCGCGATGGTGGTCGCTACCGTGGATGAACATGGTCAGCCTT
ATCAGCGCATCGTTTTACTCAAACATTACGACGAAAAAGGCATGGTGTTTTACACCAACC
TCGGCAGCCGTAAAGCACATCAAATCGAAAATAATCCGCGCGTTAGCCTGCTGTTCCCGT
GGCATACCCTTGAGCGCCAGGTGATGGTGATCGGTAAAGCAGAACGACTTTCGACTCTCG
AAGTGATGAAATATTTTCATAGCCGCCCGCGTGATAGCCAGATTGGTGCATGGGTTTCGA
AGCAGTCCAGTCGCATTTCTGCCCGCGGTATCCTTGAAAGTAAATTCCTGGAGCTGAAGC
AGAAGTTTCAACAGGGCGAAGTGCCATTGCCGAGCTTTTGGGGCGGTTTTCGCGTCAGCC
TTGAACAGATTGAGTTCTGGCAGGGTGGTGAGCATCGCCTGCATGACCGCTTTTTGTACC
AGCGTGAAAATGATGCGTGGAAGATTGATCGTCTTGCACCCTGAAAAGATGCAAAAATCT
TGCTTTAATCGCTGGTACTCCTGATTCTGGCACTTTATTCTATGTCTCTTTCGCATCTGG
CGAAAAGTCGTGTACCGGCAAAGGTGCAGTCGTTATATACATGGAGATTTTGATGGCAAG
CAGTAACTTGATTAAACAATTGCAAGAGCGGGGGCTGGTAGCCCAGGTGACGGACGAGGA
AGCGTTAGCAGAGCGACTGGCGCAAGGCCCGATCGCGCTCTATTGCGGCTTCGATCCTAC
CGCTGACAGCTTGCATTTGGGGCATCTTGTTCCATTGTTATGCCTGAAACGCTTCCAGCA
GGCGGGCCACAAGCCGGTTGCGCTGGTAGGCGGCGCGACGGGTCTGATTGGCGACCCGAG
CTTCAAAGCTGCCGAGCGTAAGCTGAACACCGAAGAAACTGTTCAGGAGTGGGTGGACAA
AATCCGTAAGCAGGTTGCCCCGTTCCTCGATTTCGACTGTGGAGAAAACTCTGCTATCGC
GGCGAACAACTATGACTGGTTCGGCAATATGAATGTGCTGACCTTCCTGCGCGATATTGG
CAAACACTTCTCCGTTAACCAGATGATCAACAAAGAAGCGGTTAAGCAGCGTCTCAACCG
TGAAGATCAGGGGATTTCGTTCACTGAGTTTTCCTACAACCTGTTGCAGGGTTATGACTT
CGCCTGTCTGAACAAACAGTACGGTGTGGTGCTGCAAATTGGTGGTTCTGACCAGTGGGG
TAACATCACTTCTGGTATCGACCTGACCCGTCGTCTGCATCAGAATCAGGTGTTTGGCCT
GACCGTTCCGCTGATCACTAAAGCAGATGGCACCAAATTTGGTAAAACTGAAGGCGGCGC
AGTCTGGTTGGATCCGAAGAAAACCAGCCCGTACAAATTCTACCAGTTCTGGATCAACAC
TGCGGATGCCGACGTTTACCGCTTCCTGAAGTTCTTCACCTTTATGAGCATTGAAGAGAT
CAACGCCCTGGAAGAAGAAGATAAAAACAGCGGTAAAGCACCGCGCGCCCAGTATGTACT
GGCGGAGCAGGTGACTCGTCTGGTTCACGGTGAAGAAGGTTTACAGGCGGCAAAACGTAT
TACCGAATGCCTGTTCAGCGGTTCTTTGAGTGCGCTGAGTGAAGCGGACTTCGAACAGCT
GGCGCAGGACGGCGTACCGATGGTTGAGATGGAAAAGGGCGCAGACCTGATGCAGGCACT
GGTCGATTCTGAACTGCAACCTTCCCGTGGTCAGGCACGTAAAACTATCGCCTCCAATGC
CATCACCATTAACGGTGAAAAACAGTCCGATCCTGAATACTTCTTTAAAGAAGAAGATCG
TCTGTTTGGTCGTTTTACCTTACTGCGTCGCGGTAAAAAGAATTACTGTCTGATTTGCTG
GAAATAATGCATTAAGTGGAAAGGGGGAGTGAGAAATCACTCCCCCTGGTTTTTATACAG
GGAACATGATGAAAAATATTCTCGCTATCCAGTCTCACGTTGTTTATGGTCATGCGGGTA
ACAGTGCGGCAGAGTTTCCGATGCGCCGCCTGGGCGCGAACGTCTGGCCGCTGAACACCG
TTCAATTTTCTAATCACACCCAATACGGCAAATGGACTGGCTGCGTGATGCCGCCCAGCC
ATTTAACCGAAATTGTGCAAGGCATTGCCGCCATTGATAAATTACACACCTGTGATGCCG
TATTAAGTGGCTATCTGGGATCGGCGGAGCAGGGTGAACATATCCTCGGTATCGTCCGTC
AGGTGAAAGCCGCGAATCCGCAGGCGAAATATTTTTGCGATCCGGTAATGGGTCATCCGG
AAAAAGGCTGTATCGTTGCACCGGGTGTCGCAGAGTTTCATGTGCGGCACGGTTTGCCTG
CCAGCGATATCATTGCGCCAAATCTGGTTGAGCTGGAAATACTCTGTGAGCATGCGGTAA
ATAACGTCGAAGAAGCGGTTCTGGCAGCGCGCGAACTCATTGCGCAAGGGCCACAAATTG
TGTTGGTTAAACACCTGGCGCGAGCTGGCTACAGCCGTGACCGTTTTGAAATGCTGCTGG
TCACCGCCGATGAAGCCTGGCATATCAGCCGTCCGCTGGTGGATTTTGGTATGCGCCAGC
CGGTAGGTGTTGGTGATGTGACGAGCGGTTTACTGCTGGTGAAACTGCTTCAGGGGGCAA
CGCTGCAGGAGGCGCTGGAACATGTGACCGCTGCAGTCTACGAAATCATGGTGACCACCA
AAGCAATGCAGGAATATGAGCTGCAAGTGGTGGCTGCTCAGGATCGTATTGCCAAACCAG
AACATTACTTCAGCGCAACAAAGCTCTGAAATATCTCATTTCGGCCCACAACGACCTGTG
GGCCGATGGCTATTACTTTAAGCCTTCCGCTGACAGCGCGTCTTGTACTTCCGGACGTTC
AGCCATACGTTGCATAAATGCTGCAATGTGCTCTAACCCTTCCAGATTCAGTTTCACCGC
GTATGCCCAGCGCAGAACCGTAAACAGATAGGCATCAGCAATTGTAAATCTTTGCCCGCA
GATCCAGTGCTCATCCTTCAGTGCCTCGTTCACATATTGCAGCTTCTTCTCCAGCTGCGC
GCGAACTGTCGGTTTGTACTCTTCCGGTGTATCAGGGCGAAACAGAGGTGTGAAACCTTT
ATGCAGCTCGGTGGCGATGTAATTCAGCCATTCGATGGTTTTATAGCGGGAAATACTGTT
TACCGGTGCCAGCAACTGGCGGTCGGGGACGCTGTCGGCAAGATACTGCATAATCGCTAC
GCCTTCCGTCAGCAAAGTACCGTCATCCAGCAGCAATGCAGGCACCTGCCCCTTAGGGTT
AACGGCAAAGTAATCGTCACCGTTTTCGAGACGTTTTTTCATTAAATCCACACTGACGAG
GGTAAAATCCTTTCCGCTCTCACGCAGGGTGATATGGGAAGCGAGAGAGCAGGCACCCGG
TTTGTAGAACAATTTCATCGGTAACTCCTTTTGTCTGTGGTTTAAAGTATGGTAGTGCGT
TGCTGAACAAAAAAAAAGCCGCTAACGAAAAGTTAGCGGCTTGTAAAAGAGTTTCCCTGA
ATTTTACGCTACGGCTGCTTTCGCCGCTTTGTCTGCAGCGTCATCCTGCGTCATGCGGTG
CAGTTTCGGCGCGGTCAGCAGCATCAGTACTGCAATAACGGCAGTAGCGACACCAATCTG
CAAGAATACGCGACCATAGACTTCCAGTGACATCAGCGGATCGGTAACGTTATCCGGCAC
AGCCATCATACCCGCAACATAACCACCAATCAGGTTTGCACCGGCAGTGGTCAGGAACCA
GCTACCCATAATGAAGCCCATCAGACGCTGCGGAACGAGTTGAGCAACCATTGCCAGACC
CAGACCAGAGATCATCAGTTCCCCGATGCTCTGCAGGCCATAGCTTGCGACCAGCCAGCT
TACAGACACGATACCAGCGTCAGACGCGAATTTCGCACCCAGCGGCAGAATCAGGAACGC
ACCAGAACACATCACCATGCCGATTGCAAACTTGGTTGGCATCGGCAGGGTATCGCCCAT
CTTGTTATAGATAGCGGCCAGAATCGGACTACCGATGATGATCCAGAACGGGTTCAGTGC
CTGATACTGCTCAGGTTCTACGGCCAGACCCAGAATGGAGTGCTCAACGTTACGAATCGC
AAAGAAGTTCAGTGACGTTGGCATCTGGCTGTACAGCACGAAGAAGATAATGGCTTCGAG
CATCAGGATGAAGGCAACGATCATTTTACGACGCGCAGCACCTTTCATCGCGAAGGCTTC
TTTACCGAAGATAACCACGATACCGAAGGCAACAACGCCCAGCGCCATACGCGCAACTTC
CTGATTGTGCAGCAGCCAGGTGGCGATAGCGATCAGTGCCACAACACCAATAATGGTCAG
CAGCAGGTTACGGTAGTTGATAGGCTCGAAGTCTGGTTTTGAACCGTACTGTTTAACCCA
GCGTTGGCAGAAGGCGAAGTTAACGATAGTGATCAGCAGGCCTACAACGCTCAACGCAAA
CGCAACACTCCAGCCGTATTTCGCGGCCAGCCACGGCGTAGCAATCATAGAGAAGAAAGA
GCCGATGTTGACGGACATGTAGTACATGGTGAATGCACCGTCCAGACGCGGGTCGTTTTT
CTCATAGCATGTAGAAAGCAGAGAAGACGGGTTAGCTTTAAACAGGCCGTTACCGACCGC
AATAGCCGCCATACCCATATAAACGATACCGGCGTCGTGACCAGACCAGGCAACCAGAGC
ATAACCAATCGCCAGCACAATAGCGCCGAGCATAATTACGCGTTTAGTACCCAGTACCTT
GTCACCTAACCAGCCGCCGATAGCGACCAGACCATAAACCAGGGCACTAAAGGAAGAGAA
AAGGGTGATTGAATCCGCTTCAGACATACCCAGTTGTTTAACCAGGTAAACAGCCATAAT
TCCTTGTAGGCCGTAATAACCAAAACGTTCCCATAACTCAATCGAGAAGATGAGATAGAA
CGCCTTCGGTTGTTTGAAAGCGTTCAAACTGACGCTTTCAGTTGGTTTTTGGTTTGCAGT
GGACACTTTTACCTCTTTTTTTACATCCCATATTAACGGGGGTGCTTTCTCGCGTTATGT
ATAAAAAACATACGCGCAATTGTTATAGTGGGAGGGGAAACGGCAGGTAATGTTCACTAT
CTTGCACTTTCAGACAAGTCCTTTGTAATAATCTGTTACATATAACTGAGGCGGGGAATT
CAACCATTCCGGGAAATGTTATCCAGCGTTAAATTTTTCAAAAAACGTAACGGCAGATTT
TTTCACTGCACTGAGAGGGGGGTGATGGCTTAACGGCGATATGTTCTGCTATTTAGCGTT
TTTACTAGTGAGATAGTCCAGTTTCTGAAAAATAGCCAGTGTAATGTTTTGTAGGTCAAT
ATTTGTTGCGTGTGTAAATTTAAATGATTTTAACCTGATTCTTGCAATGTTTTTACATTG
CGACAGCATCGTGATCTTGATCACGAATGAATAGAAAATTTCGCTATTAAAAAAACAATT
AACCTGCATTTTTGGTTATCCGCAAACGGATTACCTGATGATAACGCTAAGCAATGGCAT
CATTGACGTTAAAAAGATGTTTTAAAAGAGGATAAAGAAAGGTTATCAATGGGGTAATCG
GTGTTACCCCTTTTCTTCAGATGTCAACTTTCTCTTTGTATTCACAAAGATCTTCAATAA
TACAAGAGCCACAGCGGGGCTTGCGGGCAATGCAGGTATAACGCCCGTGCAGGATCAACC
AATGGTGGCAGTCGACTTTAAACTCTGCTGGAACCACTTTCAGTAGCTTTTCTTCTACCT
GTTCGACGTTTTTCCCCGGCGCAAATTGAGTACGATTACAAACGCGGAAAATGTGCGTGT
CGACAGCAATAGTCGGCCAGCCGAATGCAGTGTTTAATACGACGTTGGCTGTTTTACGAC
CTACGCCGGGCAGGGCTTCAAGCGCAGCACGATCTTCCGGAACCTCGCCATTATGCTGCT
CCAGCAAGATACGGCAGGTTTTGATGATATTTTCTGCTTTGCTGTTATAAAGCCCAATCG
TTTTGATATAGGTTTTCACCCCTTCAACGCCCAGTTCAAGCATCGCTGCAGGCGTATTCG
CCACCGGGTAGAGTTTCGCCGTCGCCTTATTAACACTGACATCGGTCGCCTGAGCGGAAA
GCAGTACGGCAATCAGCAATTCAAAAGGCGAACTGAAATTAAGCTCGGTGGTGGGATGAG
GATTGTTCTCACGCAGGCGAGTGAGGATCTCCAGGCGTTTTGCTTTATTCATCAGACATT
CCCTGTTTCACCGTTTGGCAATGCACGTTCTGCAGCTGCTTCAGCACGGCGCTTTTTCAT
TCTTTCATCAATCAGGTATTTTCCTGCCAGCATCAGTCCCAGGCCAATAAATGCACCTGG
TGGCAGCATCGCCAGCAGGAAAGGGGAGTCGGTGTGGAAAATCTCCACGCGTAATACTTT
TGCCCAGCTACCTAACAGCGCATCTGCACCGTCAAACAATGTGCCATTGCCGATAATTTC
GCGTAGTGAACCCAGCACGAACATGGCGCAGGTTGCGCCCATACCAATTGAAAAGCCGTC
CAGTGCCGAAAGCGCCGGACCTTTTTTGGCGGCGAAGGCTTCAGCGCGGCCCACAACGAT
ACAGTTAGTGACAATCAGCGGAATAAAAATCCCTAATGATTGATACAGGCCAAAGGCGTA
GGCGTTGATCAGCATCTGTACAGCGCTGACCACCGAGGCGATGATCATCACGTAAATGGG
AATGCGGATCTCGGCTGGCGTCCAGTGACGCAGCGTCGAAATGGTCAGGTTGGTCAGCGT
CAGTACCAGCGTAGTCGCAAGTCCTAAACCCAGAGCGTTAGTGGCAGTGGACGTGACCGC
CAACAGAGGACAAAGGCCGAGCAACTGGACCAGCGCAGAGTTGTTTTTCCACAACCCCTG
AACAATAACGTCTTTAATTTCGCTCACGCTTTATTCTCCACAGGCAGGAAGTTGAGAAAG
TTGTGCCGGTAACGTCTGAGCGTACAATCCGGCGCGTTTTACCGCATTAACCACCGCGCG
GGGAGTAATCGTCGCGCCGGTGAACTGGTCGAAATCACCACCATCTTTCTTCACCGCCCA
GTGCGCATCATCTGCACCACTGATTTTTTTACCCGCAAAATGGGTGATCCAGTCAGAAAG
GCGCAGTTCGATTTTATCGCCAAGCCCTGGCGTTTCGTGGTGCTCTGTCACGCGCGTGCC
AAGTACCGTGCCGTTAAAATCGGCTCCCACCAGCAGCTGAATCGCACCGGAATAGCCATC
TGGCGCGGTTGCTTCCAGAACGGCGGCTACCGGTTTGTCATCCTGTTTGGCGATGTAAAC
CCGATGCTCACCTTTACCTAACTCTGGCGCAGTTACCAGATAGCAACTCTGTGCCAGCGC
ATTGTTATAGCGTTCGGCTGGCAGCACCTGATCAAATAACGCCTTTTGTTGCAGACTGGC
CTGTTCAGCAATCGTCGTTTTGGTCATCTGGTTGATGGCCGCAGTTAACCCTGTTGAACC
CGCTGCAAATAGCGCCAACGTAATGCCGTGTTTTCGGATAGTTTTCAGCATGGTTTACCC
TTTGCGATGGCCGTAGACGCGCGGACGCGTGTAGTAATCGATCAGAGGAACCGTGATGTT
CGCCAGCAGGACGGCAAAAGCCACGCCGTCAGGATAGCCGCCGAAACTGCGGATCAACCA
GACTAATAAGCCCGCAAGCGCGCCGAAAATAAGACGACCACGATTGGTCGTAGAAGCGGT
AACCGGGTCAGTCAAAATAAAGAATGCGCCGAGCATGGTCGCTCCAGACAGCAGATGAAT
TTGCGGTGCTGCCAGTGTTTCTGGTGAGAACAACCAGCCCAACATTGCGCATAACGCCAG
CGTTACTAAGAAGCTGAGGGGAATATGCCAGCGAATCGCTTTCTGCCATAGCAACCATAC
GCCGCCAGCCAGCCAGGCGAGATTTACCCATTGCCAACCAGCGCCCGCCAGAATACCGCT
GTAGATCGGATATTGCATAATCTGTTCAACCGAATGACCGGCACGGACAGAGGTTTTAAA
TGTATCCAGCGGTGTCGCCTGACTAATGCCATCAATACCTAAGCGTAGTGTGTTCATATC
ACCACCACTGGCGGTATGACCGCTAAAAATAACCTGGATGGCGTCGATAAAACCAGGGAT
GTTGACCGCAATTTCATGTGGCGGTAACCAGCTGGTCATCTGCACGGGGAAGGAGATCAG
TAAGACCACATAACCAATCATTGCCGGATTAAACGGGTTTTGTCCCAGACCGCCATACAA
CTGTTTAGCGATGATCACCGCAAACACCGTACCCAGCACGACCATCCACCATGGCGCGAG
GGGGGGAATACTTACCGCCAGCAATAAGCCTGTCAGCAATGCTGAGTTATCTTTCAACGT
TGCGGCTACCGACTGCTTGCGTAGTTTGAGTACGAGAGCTTCGGCTAACAGAGCACTAAC
CGATGCCAACAGGATCTGAACGAGAGTACCCCAACCAAAAAACCACAGTTGCGCTGCGAT
TCCTGGCACGGCTGCGAGCAACACCAACAGCATAATGCGCGATGTCTGGCGCTGGTTATG
GGTATAAGGGGAGCTAGCTATTCTGAATACCATTTAGTCCTCGTTTACAACCTTCTGCTG
GGCGGCTTTTTTGGCCTGAGCGCGGGCAATAGCCGCGGCAACTGCCGCTTTGCGCGGATC
AACCTGTTCTTCTGGTACCGCATTAGCCTGTTGCTGTTCCAGCTTGCGTGCTTTGGCGCG
TGCAATAGCCGCTTCGACGGCAGCTTTGCGCGGATCAACCTGTTCTTCTGGCTCCGCATT
AGCCGGTTGCTGTTCCCGTTTGCGCGCTTTGGCTCGGGCAATAGCGGCTTCGACGGCGGC
TTTGCGCGGATCGACCTGTTGTTCTGGCTCGGCATTAGCCTGTTGCTGTTCCAGCTTGCG
TGCTTTGGCACGGGCAATAGCGGCTTCGACGGCGGCTTTGCGCGGATCGACCTGTTCTTC
TGGTTCCGCATTAGCCTGTTGCTGTTCCAGCTTGCGCGCTTTGGCACGGGCAATAGCGGC
TTCGACGGCGGCTTTGCGCGGATCGACCTGTTCTTCTGGTTCCGCATTAGCCTGTTGCTG
TTCCAGCTTGCGCGCTTTGGCGCGGGCGATAGCTGCTTCAACGGCAGTTTTACGTGGATC
AGCAACGGTTGCTGCGTCGTTAGTTTGCTGCAGTTCTGCCTGTTTCGCTCTGGCTTGCGC
TTTACGGGCTTCCCGTGCTGCAATAATTGCACTGTTATCCGGGCGTTCGCCCGCTTTAAT
CACAATAGGCTGTGTAGCCTGGGCCTGTTTCTCTTTCACCCGCGCCAGAGCGGCAGCAAT
CGCATCTTTATCTTTGGCTGCAGGTTGAACGGCTGCGCTCTTATGTCGTTCAAGGCGAGC
CGCTTTTTCGCGCTCCAGACGAGCCTGGCGCGCTTCGAAACGCGCTTTGGCTTCTGCGGC
GCGCTTTTCTTCCTGACGAATAGCCGCAATTTCAGCTTTTTCCTGACGGAAATATTGCAC
CAGGGGAATATTGCTCGGGCAAACCCACGCGCAAGCCCCACATTCAATGCAATCAGCAAT
GTTATGCGTGGTAGCTTTATCGTGTTGCTGACCTTTGCTGAACCAGTACAACTGTTGCGG
CAAAAGATCCGCAGGGCAGGCGTCAGCACAGGCGCTACACCGGATGCAGCTTTGTTCTTC
CTGTGGTTCGCCAAGTTCATTGGCAGAGGGAGCCAACAGACAGTTGGTAATCTTTACGAC
CGGGACATCCAGCCATGGCAAGGTAAAGCCCATTAGCGGGCCACCCATAATCACCATTTG
ATCGGCAGAGGGGCAGAATCCGGCATCATTCAATAAATGACGCACTGGCGTCCCCAGCCG
TGCCCAGACGTTGCCCGGGCGAGCGATTGCTTCGCCAGTCAGGGTTACAACACGCTCGGT
AATCGGCTCGCCATCAATAACGGCACGTTTCACTGCATAAGCAGTGCCGACGTTTTGCAT
TAATACGCCGATATCGGATGAACGCCCGCCATGTGGAACCTGCTTCCCGGTCAGAATGTA
GGTTAATTGTTTAGCACCGCCAGAAGGATATTTGGTTGGAATCACCCGCAGAGAAATATC
GTTAGAGTCCGCCAGCACCGCGCGCAGCATGGAAATCGCCTGCGGTTTGTTATCTTCAAT
GCCGATAAGAATTTCGCGTGGCTGCAGAATATGCGCAAGAATGCGAATACCCTCTACGAC
CTGAGCCGCGCAATCCTGCATCAAACGGTCATCGGCGGTAATGTACGGCTCGCACTCAGC
CGCGTTGATAATCAACGTTTCAATCTTATCTCCGCCACCCTGCAATTTAACGCCTGTCGG
GAATCCTGCACCGCCCAGCCCGGCAACACCAAACTGATGTATGCGCTCGATTAACTCTTC
GCGACTGCGAGTGCGATAATCGGCCCAGCCGTCGCGCGGGATCCAGCAGTCTTCACCATC
GGCATCAATAATCACGCTTAATTCAGCTAAAGCTGAAGGATGAGCCGTAGAGTGGGGCGC
AATAGCCGTAACGGTACCCGAGGTGGGCGCGTGAACAGGCAGCATTTTGCCGCGACCACG
GGTAAGCGGCTGGCCGCGCAATACTTTATCGCCGACGCTAACGCACAACTCACCTTCAGC
GCCAATATGCTGTTTCAGTGGAATAACAAAACGCTGCGCCAGGGGTACCTGGCGCAGGGG
TGTACCGTTGGACTGGGTTTTCATCTCCGGTGGATGGATGCCGCCGTTGAAATCCCAGAT
TTTATTTTTTCTGAATGCAGAGAATAACTTAAGCATGGTGTTCCACGGGAATGATACGCA
CGGGAATGGTGTTCAGATCCCATTTCCAGGAGTCAGGTGTTTCTGCGACCGGTTGCAACG
AGATGCAGTGCGTCGGGCACGGATCAACACATAAATTGCAGCCCGTACAGAGATCACTCA
TTACCGTATGCATGGCACGGGTAGCGCCAACGATGGCGTCTACCGGACACGCCTGAATAC
ATTTAGTGCAGCCAATACAGTTATTTTCATCAATAACCGCCACCATCCGCGCAGGCGTTA
TCTCTTGCGCTTCGCCATCCAGCGGCTGCGGCTCGACATTAAGCAACTCGGCAATTTTTA
GCATCACAGCTTCGCCACCTGGGGCGCAACGGTTGATTTTTTCACCGTTACAGCTGATGG
CTTCCGCGTAGGGGCGACAGCCGGGATAACCGCACTGACCACACTGGCTCTGCGGTAAGA
TTTCGTCAATTTTCTCAACGACCGGATCGTCTTCCACCGCAAAACGGCGGGAGGCATAAC
CCAGAATGGCGCCAAACGCCAGGCCCAGCAGGCTCACGGCGGCAACGGCAATCCAGATAG
CATTCATTACAACTTCACCAAACCACTAAAGCCCATAAAGGCCAGAGACATAAGACCTGC
GGTAATTAACGCAATGGCATTACCGCGAAAAGGTGCCGGGACATCAGCCACAGCAAGGCG
TTCGCGGATGGCGGCGAAGAGCACCATCACCAGCGAGAAACCGACAGCGGCGGAAAAACC
GTACAGCGCCGACTGCAAGAAATTGTGCCCGAGATTGATATTCAGCAACGCCACGCCGAG
CACTGCACAGTTGGTGGTGATAAGCGGCAAAAAAATCCCCAGCAGACGGTAAAGCACCGG
GCTGGTTTTGCGCACCACCATCTCGGTGAACTGCACGACCACAGCAATCACCAGAATAAA
TGCCAGGGTGCGCAGGTAAATCAGATTAAGTGGGATCAAAATCCACGTATCGATAAGCCA
GGCGCAAATAGACGCCAGCGTCATCACAAACGTTGTTGCCAGCCCCATGCCCATCGCGGT
TTCCAGTTTTTTGGAAACCCCCATAAACGGACAGAGACCGAGAAACTTGACCAGTACAAA
GTTATTGACCAGTACAGTTCCGACAAACAGTAACAGGTAGTCAGTCATTTTTCGGCCTGA
AATAAAAAAGCCGCCTATTATCCGTTAATCCAGAGCAGGCGACAACAGGTTAACTGTAAG
GTTATTACGGATTCACAAACGTCGCTTTTACCCGCGACGAGCGTTTGAAATAGGGGACGA
TCAATGCGGTTGCCAACAAAGTAAACAGCAACTGGCGAACGGCTATGCCATCTTCCACGG
GTGAAAAAGCGAATGCTTTTACTGCCAGCAATACGGAAATAAGCAGCCAGATAATATAGT
GTTTAGGAACACAACGCCGACGTTTAAAGAAAGCGATGGTCAACCACAGTGTGTAATACC
ACAAGGCGATAGCGGTAATAAAAGAAACGCCCCATAAGATTTGTGTCGTCAGTGCTTGTC
CGCCGAGCGTTTGAAATGTTTGCGGAGAAGATAACGCAGCGGTATACAGCAACAACGCCA
GCGTCGTACTCAACAGAGCGACTAAAAGCCAGGCCAACGGGCCAAGCAACCAGCCTCCAA
TACGTTGTGGCGTTGTGGTGGTCATAGGTTCTCCAGAATAGCGACGCAAACAGGCAAATC
TAATTTTAGGGGCGTTATTATAAGGCTTTTATAACCGATCGCTACTTTCTTTATTGGACA
TAGTGCCAGACGGACTTCGGTACCTGGCCGAGGTCAAACAAACGCCCGCCAGAAACCAGC
TCTGCGCGACGGTGATCGGCAGCACGATACATATTGATCAGTTCCTGATCGTCCGTCAGG
GTGTAATTAAGATGGTCGTAGAGTTTTTCCAGACTTTCGAGTGAACTGATTTTGCGAAAT
TTTAATAAGTAGTCCTGAACAGTCATAAAAGGTCCATAAAATAATTAATACCAAAGGGGT
AGGTATTATTAGTGATGATAAAATTTCACCAAAAGTGAACGCTTGTGTTATTACAATAAT
AAGAATGCGCTGATGGCAAATATTCAGGGATGAAAAACTGCTCTGAAAAGAGTAACGCGC
TTTACTATCCCTGACAATCACCAACAACATCGAACAAGATAATAAATTCCTGGTTTAATA
TCCGACAAGTGAAAACATGCACCCGGACGGGCAGCATGTCGCTCCACAAGTGCAGAGCTT
ACTTGTGTTGTACCGAAGCACTCTGTTCAGGTGGCTGATAGTTGTCAATGTGACTCGCCA
CGCCAAGAAGAATGACTGAAACGACAAGAACGATCCAACCTGTTAATTCAATAAGACGAT
TCATTACAGCCCACATCTCTCTTGATTGATCCATTAACTTCAGGGGGTAAATGTTACTTA
GCAATAATAGCTCCAGCAAGATTTTTACTGAGGTTTTTGCGATATTTAGCTTTTGTCGTT
GGAAAATTCGCTATTTTTTTGACTTAAGTTAAACAACATCCCTTATTGCTGGCAGGTTAT
TAAACTGTTGAGCGTGGGTAAAGGATAGTGTCAAATAGCCATCATACTTCAATGAGAGGC
AATGACATGAGCGACAACATCCGTGTTGGGTTGATTGGGTATGGTTATGCGAGCAAAACC
TTCCATGCGCCCCTGATTGCGGGCACGCCCGGGCAGGAACTGGCGGTAATCTCCAGCAGT
GATGAAACAAAAGTAAAAGCCGACTGGCCAACGGTTACGGTTGTCTCTGAGCCGAAGCAT
CTGTTTAACGATCCCAACATAGACCTGATTGTCATTCCTACACCCAACGATACCCATTTC
CCGTTAGCCAAAGCGGCGCTTGAGGCGGGTAAACATGTGGTCGTTGATAAACCCTTTACC
GTGACACTGTCACAAGCGCGAGAGCTGGATGCGCTGGCAAAAAGCCTGGGGCGTGTGCTG
TCTGTATTCCATAACCGTCGCTGGGATAGCGATTTCTTGACGCTAAAAGGTTTACTCGCG
GAAGGCGTGCTGGGTGAAGTTGCTTACTTTGAGTCTCATTTTGACCGCTTCCGTCCGCAG
GTGCGCGATCGTTGGCGTGAACAGGGCGGCCCAGGCAGCGGTATCTGGTACGATTTAGCA
CCACATCTTCTTGATCAGGCCATTACGCTTTTTGGTTTACCGGTCAGCATGACGGTAGAT
TTGGCACAGTTACGGCCCGGAGCGCAGTCGACCGATTATTTCCACGCCATCTTGTCCTAT
CCACAGCGGCGAGTCATTTTACACGGTACCATGCTGGCAGCCGCTGAGTCAGCACGGTAT
ATCGTGCATGGATCCCGAGGCAGTTATGTGAAATATGGCCTCGATCCACAGGAAGAACGT
CTGAAAAATGGCGAGCGTCTACCGCAGGAAGACTGGGGCTACGATATGCGTGATGGCGTA
CTTACCCGCGTGGAAGGTGAGGAACGTGTCGAAGAAACGCTGTTGACGGTGCCTGGGAAT
TATCCGGCTTACTATGCGGCTATTCGTGATGCGTTAAATGGCGATGGTGAAAATCCGGTT
CCGGCAAGCCAGGCAATCCAGGTAATGGAGTTGATTGAGCTGGGCATCGAATCCGCCAAA
CATCGCGCGACTTTGTGCCTTGCATGAAAAATGGATGGTGCATTTGCACCATCCATTTTG
TTACTTCGCGGCGACTTTTTCTCGCAGTGCGCGTTTTTCCTCAGCGCTGAGGAAAGCCAT
TTCCAGACCATTAATCTGTGCCTGGCGGATTTGCTCGCGGGATAACCCAGCAGCTGGCGC
GGCAACGGTATATTCGTGAATGATATCCACTCCCTGTACGCCGGGATCGTCAGTGTTAAT
GCTGGCACGAATGCCATGCTCAAGGAACGTTTTCAGCGGATGTGCAGCCAGCTCTGCTAC
GGTGCTGGTCTGAATATTGGAGGTCAGACAGGATTCAATACCAATTTGTTGCTCGGCGAG
AAAATCCATCAGCGCCCGATCTTCAATGGCTTTTACGCCATGTCCAATACGCTCCGCACC
CAGTTCACGAATCGCCTGCCAGATGCTTTCCGGCCCGGCAGCTTCGCCTGCATGGACGGT
AATATGCCAGCCCGCATCACGCGCGCGGTTGAAGTGAGAAAGGAACAGACTTCCCGGGAA
ACCAAGTTCATCACCGGCTAAATCAAGTGCGGTAATCTGGTCACGGTGGGCTAAAAAGGC
CTCCAGCTCTTGCTGACAGGCGGCTTCGCCGAAGGTCCGGCTCATAATGCCGATAAGCTT
CGCCTGCACACCAAAGGTGCGGCAACCTTCACGTACGCCATCGATCACCGCTTCGACAAC
ACCCGCTACAGGCAGCTGATGTGCCATTGCCATGTAGCCTGGTGAAAAACGCAGCTCGAC
ATAGTGCAGGCCGTGACGGGCTGCATCTTCAATGTTTTCAAATGCCACGCGGCGACAGGC
ATCAAGAGAGGCGAGAACTTTAACGCCCCAGTCAAGTTTGGTCAGAAAGCTCACCAGATC
GGGTTCGTTGGCAATGACCTGAACGTGGGGAATCAGTGTTTCCAGGGATTGTGCAGGAAG
CGAGATATTATACTGGCGGCCAAGTTCAAGAATGGTCTGGGGACGAATGTTGCCATCAAG
GTGGCGATGGATATCAGTTAATGGCAGGGTGGTATCAATCATGGTCGCACTCTTTTTCTG
GATATAAAAGTGCGCACCATTATAAAAACAAAGCAGGGTAAAAATCCACGATTGCGCAAC
GATTTTTTACGTTGCGCAATTGGGGTTAACGAACAGCGCGGATGGCGTTAATTAATCCAG
CCACACCTTTTTCCAGTTTCGAACGTGGGCAGCCGGCATTGAGACGGACAAAACCACGAC
CTTCTTCACCGTAGGTATACCCCGGCATGATCGCGACTTTTTCTTGTTCGATAAGTGCTT
TTTGCAACGCGTTGTCGTCAATATTCAACGGACGTAAATCAAGCCATGCCAGATAAGTGG
ATTGTGGGATCTGCCAGTTGAGTTCAGGAAACGCGGCGTTCATTTTATCTGCGATATACG
TCAGGTTATCTTTCAGATAGATGCGTAAGGCATCCAGCCACGGCGCGCCTTGCTGATAGG
CGGCGATATGGGCAGTTAACGCCAGTACCGAAGGGGAAGAAAGCCCATCACGGCCTTTCA
GTGCCGATAAATAGGCATCGCGGCTACTGCTATTTTCTATAATCCCGTAAGCACCGGTCA
GGGCGGGAATATTGAAACTTTTCGAGCCCGACGTTAGCAACGCCCAGTCTCCGCGAGCCA
CATTACTCCAGGGAATATGCGGCTGCTCGCCCCAAACCATATCCATATGGATTTCATCGG
AAATAACCCGCACACCATGACGCTCGCACAGGTCAGCCATGATCTCCAGCTCATCGCACG
TCCACACTTTCCCGGTAGGATTCTGTGGGCTACACAGGAGCATAATTTTACATTCTGGTT
TCGCCAACACGGCTTCCAACTTGCCCATATCGCAAAACCAACCATCAGCCTGCTTCTCTA
AAGCAACGGGCATTACTGTGCGCTGGTTACCTTCAATGGCCTTGTAAAATGCGTCATAGG
CGGGTGTGTGGATCACCACGCCTTCACCTGTTTCAGACCACTGACGAATCAGTTCTGAAA
CCATATAGATGACAGAAGGGCCATACACCACCGTCTGAGAATCGATGGCGGTGTAATGCT
GGGTGGAAAACCAGTGGGCAATAGCCGCGAGAAACTCATCGTTTTTCCAGCGGCTGTAGC
CAAATACGCCGTGCATCAGGCGCTGATTCAGCGCCTCGATAATGCAGGGGGCAGTGGCAA
AATCCATGTCTGAAATCGTGAACGGTAACAGGTCAGCAGTGCCGAAACGGTCAGCGACAT
AATCCCACTGTGTACACCATGTGCCATGACGATCCACGACCTTTGAAAAATCGAACATAT
CTTATCCTTATGCCTGGACAGTATGCATCAGACCGGCCATTTCATCTTTTACTGACTGAA
CTTGTGGCCCGATAACAACCTGCAGGTTATGTTGATTAAGTTGTACTACGCCAATTGCCC
GATTGTCCTTCAGTGCCTGCACATTAACAAGCGACATATCTTTCACAGACAAACGCAGAC
GGGTAATGCAGTTATCGAGGCTGACAATATTGTCGGCACCGCCTAATGCTTCGAGGATTG
CAGGAACGTTGTAACCTGATTTACCCGGCGCACCGGCAACGGCTTTTTCGATTGAGCTGG
CAACTTCGCTATCGCGCCCCGGGGTTTTCAGATTGAAGCGGGTGATAGCGAAACGGAAGA
TGACGTAGTAAACGACAAACCAGATTGCCGCCACCACTGGCACCATGTACCACTTGGTTG
ACAGACCATGCAAAATACCGAACACCACGAAGTCGATGATATTGCCGTCGGTATTACCGA
TGGTGACGCCGAGCACAGACATGACGGTGAAGCCGAGGCCGGTTAACAGCGCGTGGATGA
CATACAGAACTGGCGCTACGAACAGGAACAGGAATTCCAGCGGTTCGGTAGTGCCGCCAA
CGACGCAGGCGATCAGGCCAGAAATCAGCAGACCTTTAATTTTATGGCGATTTTCCGGGC
GCGCGCAGTGATACATAGCTAACGCTGCACCTGGCAGACCGCCGAGAAACGCAGGCATTT
TACCTTGCGAAAGGAAACGCGTGGCGCTTTCAGAAAAACCGTGAGTGGTCGGGCAACTCA
ATTGCGCCTGGAAGATGGTCAGTGCGCCGCTGACGGTTTGACCGCAGACTTCCTGCGTGC
CGCCTGCGTCGGTAAAGCGAATTAATGCCACCAGAATGTGATGCAGACCAAACGGCAACA
GCAGACGTTCACCGGTACCAAACAGCATCGGTCCGAAATCACCCGCGCTGTTTATCATAT
GGCCCAAGCCGCTAATACCCATGGCGAAAATCGGCCAGACTAATGGAATCACCAGGCCGA
CAAGGCCCATCACCAGCGAGGAGATAATTGGTACGAAGCGCGTACCGCCGAAGAATGCCA
GCGCATCCGGCAGGCGGATATTATGGAAACGCTCATGCAGCATCCAGACGATAATACCGG
CGATCACCGCACCGAGGATCCCGGTATCGATCGACTGGATCCCAAGAATGCTCTGGATGT
TATTGGCTTTCAGAACCGCGGCATCCGTGGTTGGCAGAATGCCTTTATTGGTCAACCAGA
AGTTTACCGCGAGGTTCATTACCGCATAACCGATGAAGCCAGCGAATGCCGCTACGCCTT
TATTTTCGCGTGCCAGGCCCAGCGGGATGGCGATACAGAACATGACAGGCAGGAAACTAA
AAGCAAACGAGCCAATCTTACTCATCCAGGTAAAGATAGCCTGCAACACGGGGTTGCCCA
GGACCGGGATCAGGGTTATGACATCATGGCTGCTAAGAGAACTACCAATGCCGAGCATAA
TGCCGCAGAACGACAATAATGCCACGGGTAACATGAAGGTTTTGCCTAACTGCTGGAAGA
ACTCCCACAGCGTGACTTTCGGTGCTGTTTTCGCCGTCATAAAACGACTCCTCGTAGAGA
ACAATCTGGATTCAGTAAATTGCGCGAGAAGATAAAACGTTTTATCAAATTTTAGTGAGG
CATAAATCACATTACGCAACGATAATAGCGGGTATAAGATAAATAAAAGGTAAAACGTTT
TATCTGTCACATAATCAGGGAGTAGGTCATCTGCATGGCTACCGCCAAAAAAATAACCAT
TCATGATGTTGCGCTGGCTGCGGGCGTGTCGGTAAGTACCGTTTCGCTGGTGCTTAGTGG
CAAAGGGCGAATCTCTACCGCCACAGGAGAACGCGTTAACGCCGCCATTGAAGAGCTGGG
ATTTGTGCGCAATCGCCAGGCGTCGGCGCTGCGCGGCGGGCAAAGCGGCGTCATTGGTTT
GATCGTCCGTGATTTATCTGCGCCGTTTTACGCCGAATTGACGGCCGGATTGACGGAAGC
TCTGGAAGCGCAGGGACGGATGGTTTTTTTGCTTCACGGCGGTAAAGACGGTGAGCAGCT
GGCACAGCGGTTTTCACTGTTACTGAATCAGGGTGTCGATGGTGTGGTAATTGCCGGAGC
TGCAGGAAGTAGCGATGACCTGCGACGGATGGCAGAAGAAAAAGCTATCCCGGTGATTTT
CGCTTCCCGTGCCAGTTATCTTGATGATGTTGATACGGTTCGCCCGGACAACATGCAGGC
TGCACAGTTGTTGACGGAGCATCTCATTCGCAATGGGCATCAGCGGATCGCCTGGCTGGG
AGGGCAAAGTTCCTCATTAACCCGTGCAGAACGGGTTGGGGGCTATTGTGCAACTCTACT
AAAATTTGGCCTGCCGTTTCATAGCGATTGGGTGTTGGAGTGCACTTCCAGCCAGAAGCA
AGCCGCGGAAGCTATCACGGCGCTTTTACGTCATAACCCGACCATCAGTGCCGTGGTTTG
CTATAACGAAACTATTGCGATGGGGGCATGGTTTGGTTTGCTCAAAGCAGGGCGGCAAAG
CGGGGAAAGCGGAGTCGATCGTTACTTTGAGCAACAGGTTTCGCTGGCGGCATTTACCGA
TGCGACACCAACCACACTTGATGATATACCTGTTACCTGGGCCAGCACGCCAGCGCGGGA
ACTTGGTATCACACTTGCGGATCGCATGATGCAAAAAATCACCCATGAAGAGACGCATTC
ACGCAATCTTATTATTCCCGCCCGGCTCATTGCAGCGAAATAATCCTCTCTTTATCTGCT
ATACCTGGTAGTGTCCTTTCCTCAAGGTTAATGATAAAAAATGTGGCACACAGGCGGTGC
CTTTTATTTTTACTGAAGTTCACAGGAGGTTTATGTGTTTAATTCTGACAACCTGAGACT
CGACGGAAAATGCGCCATCATCACAGGTGCGGGTGCAGGTATTGGTAAAGAAATCGCCAT
TACATTCGCGACAGCTGGCGCATCTGTGGTGGTCAGTGATATTAACGCCGACGCAGCTAA
CCATGTTGTAGACGAAATTCAACAACTGGGTGGTCAGGCATTTGCCTGCCGTTGTGATAT
TACTTCCGAACAGGAACTCTCTGCACTGGCAGACTTTGCTATCAGTAAGCTGGGTAAAGT
TGATATTCTGGTTAACAACGCCGGTGGCGGTGGACCTAAACCGTTTGATATGCCAATGGC
GGATTTTCGCCGTGCTTATGAACTGAATGTGTTTTCTTTTTTCCATCTGTCACAACTTGT
TGCGCCAGAAATGGAAAAAAATGGCGGTGGCGTTATTCTGACCATCACTTCTATGGCGGC
AGAAAATAAAAATATAAACATGACTTCCTATGCATCATCTAAAGCTGCGGCCAGTCATCT
GGTCAGAAATATGGCGTTTGACCTGGGTGAAAAAAATATTCGGGTAAATGGCATTGCGCC
GGGGGCAATATTAACCGATGCCCTGAAATCCGTTATTACACCAGAAATTGAACAAAAAAT
GTTACAGCACACGCCGATCAGACGTCTGGGCCAACCGCAAGATATTGCTAACGCAGCGCT
GTTCCTTTGCTCGCCTGCTGCGAGCTGGGTAAGCGGACAAATTCTCACCGTCTCCGGTGG
TGGGGTACAGGAGCTCAATTAATACACTAACGGACCGGTAAACAACCGTGCGTGTTGTTT
ACCGGGATAAACTCATCAACGTCTCTGCTAAATAACTGGCAGCCAAATCACGGCTATTGG
TTAACCAATTTCAGAGTGAAAAGTATACGAATAGAGTGTGCCTTCGCACTATTCAACAGC
AATGATAGGCGCTCACCTGACAACGCGGTAAACTAGTTATTCACGCTAACTATAATGGTT
TAATGATGGATAACATGCAGACTGAAGCACAACCGACACGGACCCGGATCCTCAATGCTG
CCAGAGAGATTTTTTCAGAAAATGGATTTCACAGTGCCTCGATGAAAGCCATCTGTAAAT
CTTGCGCCATTAGTCCCGGGACGCTCTATCACCATTTCATCTCCAAAGAAGCCTTGATTC
AGGCGATTATCTTACAGGACCAGGAGAGGGCGCTGGCCCGTTTCCGGGAACCGATTGAAG
GGATTCATTTCGTTGACTATATGGTCGAGTCCATTGTCTCTCTCACCCATGAAGCCTTTG
GACAACGGGCGCTGGTGGTTGAAATTATGGCGGAAGGGATGCGTAACCCACAGGTCGCCG
CCATGCTTAAAAATAAGCATATGACGATCACGGAATTTGTTGCCCAGCGGATGCGTGATG
CCCAGCAAAAAGGCGAGATAAGCCCAGACATCAACACGGCAATGACTTCACGTTTACTGC
TGGATCTGACCTACGGTGTACTGGCCGATATCGAAGCGGAAGACCTGGCGCGTGAAGCGT
CGTTTGCTCAGGGATTACGCGCGATGATTGGCGGTATCTTAACCGCATCCTGATTCTCTC
TCTTTTTCGGCGGGCTGGTGATAACTGTGCCCGCGTTTCATATCGTAATTTCTCTGTGCA
AAAATTATCCTTCCCGGCTTCGGAGAATTCCCCCCAAAATATTCACTGTAGCCATATGTC
ATGAGAGTTTATCGTTCCCAATACGCTCGAACGAACGTTCGGTTGCTTATTTTATGGCTT
CTGTCAACGCTGTTTTAAAGATTAATGCGATCTATATCACGCTGTGGGTATTGCAGTTTT
TGGTTTTTTGATCGCGGTGTCAGTTCTTTTTATTTCCATTTCTCTTCCATGGGTTTCTCA
CAGATAACTGTGTGCAACACAGAATTGGTTAACTAATCAGATTAAAGGTTGACCAGTATT
ATTATCTTAATGAGGAGTCCCTTATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCA
AAAAACTCGACGGCCTGTGGGCATTCAGTCTGGATCGCGAAAACTGTGGAATTGATCAGC
GTTGGTGGGAAAGCGCGTTACAAGAAAGCCGGGCAATTGCTGTGCCAGGCAGTTTTAACG
ATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCGAAG
TCTTTATACCGAAAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCACTC
ATTACGGCAAAGTGTGGGTCAATAATCAGGAAGTGATGGAGCATCAGGGCGGCTATACGC
CATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTATCACCGTTT
GTGTGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGACGAAA
ACGGCAAGAAAAAGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGGATCCATCGCA
GCGTAATGCTCTACACCACGCCGAACACCTGGGTGGACGATATCACCGTGGTGACGCATG
TCGCGCAAGACTGTAACCACGCGTCTGTTGACTGGCAGGTGGTGGCCAATGGTGATGTCA
GCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTAGCGGGA
CTTTGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTGT
GCGTCACAGCCAAAAGCCAGACAGAGTGTGATATCTACCCGCTTCGCGTCGGCATCCGGT
CAGTGGCAGTGAAGGGCGAACAGTTCCTGATTAACCACAAACCGTTCTACTTTACTGGCT
TTGGTCGTCATGAAGATGCGGACTTGCGTGGCAAAGGATTCGATAACGTGCTGATGGTGC
ACGACCACGCATTAATGGACTGGATTGGGGCCAACTCCTACCGTACCTCGCATTACCCTT
ACGCTGAAGAGATGCTCGACTGGGCAGATGAACATGGCATCGTGGTGATTGATGAAACTG
CTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTCGAAGCGGGCAACAAGCCGAAAG
AACTGTACAGCGAAGAGGCAGTCAACGGGGAAACTCAGCAAGCGCACTTACAGGCGATTA
AAGAGCTGATAGCGCGTGACAAAAACCACCCAAGCGTGGTGATGTGGAGTATTGCCAACG
AACCGGATACCCGTCCGCAAGGTGCACGGGAATATTTCGCGCCACTGGCGGAAGCAACGC
GTAAACTCGACCCGACGCGTCCGATCACCTGCGTCAATGTAATGTTCTGCGACGCTCACA
CCGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAACCGTTATTACGGATGGTATG
TCCAAAGCGGCGATTTGGAAACGGCAGAGAAGGTACTGGAAAAAGAACTTCTGGCCTGGC
AGGAGAAACTGCATCAGCCGATTATCATCACCGAATACGGCGTGGATACGTTAGCCGGGC
TGCACTCAATGTACACCGACATGTGGAGTGAAGAGTATCAGTGTGCATGGCTGGATATGT
ATCACCGCGTCTTTGATCGCGTCAGCGCCGTCGTCGGTGAACAGGTATGGAATTTCGCCG
ATTTTGCGACCTCGCAAGGCATATTGCGCGTTGGCGGTAACAAGAAAGGGATCTTCACTC
GCGACCGCAAACCGAAGTCGGCGGCTTTTCTGCTGCAAAAACGCTGGACTGGCATGAACT
TCGGTGAAAAACCGCAGCAGGGAGGCAAACAATGAATCAACAACTCTCCTGGCGCACCAT
CGTCGGCTACAGCCTCGGTGACGTCGCCAATAACTTCGCCTTCGCAATGGGGGCGCTCTT
CCTGTTGAGTTACTACACCGACGTCGCTGGCGTCGGTGCCGCTGCGGCGGGCACCATGCT
GTTACTGGTGCGGGTATTCGATGCCTTCGCCGACGTCTTTGCCGGACGAGTGGTGGACAG
TGTGAATACCCGCTGGGGAAAATTCCGCCCGTTTTTACTCTTCGGTACTGCGCCGTTAAT
GATCTTCAGCGTGCTGGTATTCTGGGTGCTGACCGACTGGAGCCATGGTAGCAAAGTGGT
GTATGCATATTTGACCTACATGGGCCTCGGGCTTTGCTACAGCCTGGTGAATATTCCTTA
TGGTTCACTTGCTACCGCGATGACCCAACAACCACAATCCCGCGCCCGTCTGGGCGCGGC
TCGTGGGATTGCCGCTTCATTGACCTTTGTCTGCCTGGCATTTCTGATAGGACCGAGCAT
TAAGAACTCCAGCCCGGAAGAGATGGTGTCGGTATACCATTTCTGGACAATTGTGCTGGC
GATTGCCGGAATGGTGCTTTACTTCATCTGCTTCAAATCGACGCGTGAGAATGTGGTACG
TATCGTTGCGCAGCCGTCATTGAATATCAGTCTGCAAACCCTGAAACGGAATCGCCCGCT
GTTTATGTTGTGCATCGGTGCGCTGTGTGTGCTGATTTCGACCTTTGCGGTCAGCGCCTC
GTCGTTGTTCTACGTGCGCTATGTGTTAAATGATACCGGGCTGTTCACTGTGCTGGTACT
GGTGCAAAACCTGGTTGGTACTGTGGCATCGGCACCGCTGGTGCCGGGGATGGTCGCGAG
GATCGGTAAAAAGAATACCTTCCTGATTGGCGCTTTGCTGGGAACCTGCGGTTATCTGCT
GTTCTTCTGGGTTTCCGTCTGGTCACTGCCGGTGGCGTTGGTTGCGTTGGCCATCGCTTC
AATTGGTCAGGGCGTTACCATGACCGTGATGTGGGCGCTGGAAGCTGATACCGTAGAATA
CGGTGAATACCTGACCGGCGTGCGAATTGAAGGGCTCACCTATTCACTATTCTCATTTAC
CCGTAAATGCGGTCAGGCAATCGGAGGTTCAATTCCTGCCTTTATTTTGGGGTTAAGCGG
ATATATCGCCAATCAGGTGCAAACGCCGGAAGTTATTATGGGCATCCGCACATCAATTGC
CTTAGTACCTTGCGGATTTATGCTACTGGCATTCGTTATTATCTGGTTTTATCCGCTCAC
GGATAAAAAATTCAAAGAAATCGTGGTTGAAATTGATAATCGTAAAAAAGTGCAGCAGCA
ATTAATCAGCGATATCACTAATTAATATTCAATAAAAATAATCAGAACATCAAAGGTGCA
ACTATGAGAAAAATAGTGGCCATGGCCGTTATTTGCCTGACGGCTGCCTCTGGCCTTACC
TCTGCTTATGCGGCGCAACTGGCTGACGATGAAGCGGGACTACGCATCAGACTGAAAAAC
GAATTGCGCAGGGCGGATAAGCCCAGTGCTGGCGCGGGAAGAGATATTTACGCATGGGTA
CAGGGAGGATTGCTCGATTTCAATAGTGGTTATTATTCCAATATTATTGGCGTTGAAGGC
GGGGCGTATTATGTTTATAAATTAGGTGCTCGTGCTGATATGAGTACCCGGTGGTATCTT
GATGGTGATAAAAGTTTTGGCTTTGCCCTGGGGGCAGTAAAAATAAAACCCAGTGAAAAT
AGCCTGCTTAAATTAGGTCGCTTCGGGACGGATTATAGTTATGGTAGCTTACCTTATCGT
ATTCCGTTAATGGCTGGCAGTTCGCAACGTACATTACCGACAGTTTCTGAAGGAGCATTA
GGTTATTGGGCTTTAACACCAAATATTGATCTGTGGGGAATGTGGCGTTCACGAGTATTT
TTATGGACTGATTCAACAACCGGTATTCGTGATGAAGGGGTGTATAACAGCCAGACGGGA
AAATACGATAAACATCGCGCACGTTCTTTTTTAGCCGCCAGTTGGCATGATGATACCAGT
CGCTATTCTCTGGGGGCATCGGTACAGAAAGATGTTTCCAATCAGATACAAAGTATTCTC
GAGAAAAGCATACCGCTCGACCCGAATTATACGTTGAAAGGGGAGTTGCTCGGCTTTTAC
GCGCAGCTCGAAGGTTTAAGTCGTAATACCAGCCAGCCCAATGAAACGGCGTTGGTTAGT
GGACAATTGACCTGGAATGCGCCGTGGGGAAGTGTATTTGGCAGTGGTGGTTATTTGCGC
CATGCAATGAATGGTGCCGTGGTGGATACCGACATTGGCTATCCCTTTTCATTAAGTCTT
GATCGTAACCGTGAAGGAATGCAGTCCTGGCAATTGGGCGTCAACTATCGTTTAACGCCG
CAATTTACGCTGACATTTGCACCGATTGTGACTCGCGGCTATGAATCCAGTAAACGAGAT
GTGCGGATTGAAGGCACGGGTATCTTAGGTGGTATGAACTATCGGGTCAGCGAAGGGCCG
TTACAAGGGATGAATTTCTTTCTTGCTGCCGATAAAGGGCGGGAAAAGCGCGATGGCAGT
ACGCTGGGCGATCGCCTGAATTACTGGGATGTGAAAATGAGTATTCAGTATGACTTTATG
CTGAAGTAAAAAATAACGCCGGAGAGAAAAATCTCCGGCGTTTCAGATTGTTGACAAAGT
GCGCGTTTTTTATGCCGGATGCGGCGTAAACGCCTTATCCAGCCTACAAAAACTCATAAA
TTCAAAGTGTTGCAGGAAAAGGTAGGCCTGATAAGCGTAGCGCATCAGGCAATCTCTGGT
TTGTTTTCAGATGAAAACGCCGGAGTGAAAATTCTCCGGCGTTTTGGCCGTGAATTACTG
CTGCGGAATTGCCGGTACAGCCGGAACGTTAAGAGCTGGCATCGCAAACATGCCAACAAA
ATCTTCTAACGACATTTTCTGCCCATTTAACGTTATCTGACCGTTAGCATATTGCAGGCT
GGTGGTGATGGTATTGTCCTGCAAGGTGGTCAGACGGAACATCTGCCCCATTGCTGATGC
ACCTTCAACTTGCTGTTTCGCCAGTTTTTTCGCTTGATCTTCCTGATAACCTTCCAGCTT
CGCTACCTGAGTCATAAACTCAGTTGCCATATCCACCGGAATGGTCAGTTTCGCATCCAG
AGATTTAACCGAACGATCTACTTCCTGCGCCAGCGTTTGCGGCGCTTCTTTAGTCGTTGC
CGGATCTTTCAGGAACAGCGACAGATTCAGGGCACTTTCACCCTGACTGTTTTTCCAGCT
TAGCGGCGCGATAGTAATCACCGGATCGCCTTTCAGCATCAGCGGCAGGGCGCTAAAGAA
GGCTTCCGTCACTTTCTCCTGATAAAGTTCGGGGTTGTTGGCAATTTCTGGCTGTGCCAG
CAGCGCCTGAGTTTGCGCGTTATATTGCTGGCTAAACTGATGCCAGGCTTCACCATCAAT
CTGGCCGACTTTTAAAGTCAGCTTGCCGCTGCCCAGATCCTGATTCTGTACCTTCAGGCT
GTTTAGCGAGTAATCCAGTTGGCTATTGATCGTTTTACCGTCATTGACCAGATCCGATTT
ACCGCTGATCTCCATGCCTTCCAGCAGTGCCAGTTCTTTGCCTTCCACTGAAATGGTCAT
TTTTTCCAGTGACAGTTTTTGATTTCCTACACGCTCACCAAAACTTGCCAGCGTGCTGGA
ACCGTCGGTTTTCAGATTATTAAAGGTCAACTGCACTTTCTGGTTGTATTCGTTAACTGC
GTCTATCCGACCACTTTGCGCCTCCCCGGAAAGGGAGATGGCTTTGCCGTCTCTGTCAGC
ATTTAACTGGAACTCGCCGCCGCTAAAGGCGACTTTTTCATCCTTTTGCTCGTAATTCAG
TGGCTTGAGCGAAATATCGGAACTGGAATCACCGCTGTAACCAATGCGCGAGTTAATCTC
AAAAGGCGTTTCACCTTTTGCCATATCAAACAGTGGTTTGCTTACTTCGTTATTAACCAG
CGTGGTTTGAATTGATGCCATCGACGGGATCAGGTTCAGTTTTTTAAGCTGGGCAAGCGG
GAAGGGACCATGATCAACCGATTCGTTGAAGATGACGCTCTGACCGCTTTTAATCCACGG
ATTTTCTTTCCCGGCAATGGGTTTCACCAACAGTTGCAACTGGCTGCTGAATACGCCGCG
ATGATAGTTTTGATAACTCACTTCCAGGTTGGATTCAGGAGCTGTCAGTTTGAGTTGCGC
GTTCGCCTGCGCGACCATGTCTTCGAGATGGGTTTCAATCTTCTTGCCTGTATACCATGC
GCCGCCTGTCCAGACTACGCCTAGCGCAACAATGACGCCTACCGCTACCAGCGATTTATT
CATAATGATTATCCATAAAATGAAATCAGGCGGACTGGCCGCCTGAAGGTGTTATAAGCC
TTTAATAAGCTTAGCAAGAGATGTTAATTTTTTCAGTAAGCTCTTACAGCTTGTTGTAAA
CACGCGCTAAACGGCCGTGGCCTTTGACAGTCACCGGTGATTCGTTGGCGGCAATAAACG
CTGATTCACCCGGTTTAAGCTGTAACTGCTGAGAACCTTTCCACAACGTTGCATCGCCTT
CGACGCAGAACAAAATGGCGGCACTCTGCTGGCTAATGGTGGTTTCTTTATCACTAAGGT
CATGCAGCGAGAAGGCAAAATCATCCACTGGAATCGGGAAGTCCAGTTCTGCACCTTGTT
TCACCGGCTGGGTCAACAACTGGTTAGCCGGTTTGGCTTCGAATTTCACATTGGCAACCA
GTTCCGGAATATCAATGTATTTAGGCGTCAGACCCGCACGCAGCACGTTATCGGAGTTTG
CCATCACTTCCAGCGCCACGCCTTGCAGGTAAGCGTGCGGTGTTTCAGCGAACAGGAACA
TCGCTTCGCCAGGGTTCAATTTCACCACATTCAGCAATAGCGGGGAGAACAGACCGCTGT
CTTCCGGGTAAAATTCAGAAATTAAACGAATCGTTTGCCACGGTTCACCCTGCTGGCTAT
CGAGGGCCGATTTTAAAATCGCCAGCGCGCGGGATTTTTCTTCACCCTGCATATTCAACA
GGCTGGCGAACAGTTCGCTTAAACGTTCGGCATCAGGCTGTTGTAAAAAGTGAGCAATCG
CCGGATGTGCACCTGCGACCGGCTGGAGTAGGGAGACAATCTCGGAAAATTCACGAAACG
CGTTCATCGCAAGGAAAGGCGTCAGCGCAAAAACCAGCTCCGGCTTGTGGTTAGGATCTT
TATAGTTACGCTCGGCGGCATCCATCGGGATACCTGCGGCATTTTCTTTGGCAAAACCGA
TTTCAGAATTGTGTTTGTTTGGATGAACCTGAATGGAGAGTGGCTGTGCTGCGCATAATA
CTTTGAACAGGAAAGGCAGTTCGCCAAAGCGTTTGGCAACGGCCTCTCCGAGCAGAGTCG
ATTTATCACTCTCAATCACATCACGCAGTGAAACGATATCTCCGGCGGCATTCTGCACTC
GTGAACTGCTTTTCGGATGTGCGCCCATCCACAGCTCGGCCATCGGCTGGCTGGACGGAT
TTTCCATACCATAAAGTTCAGTCAACGCCGTTTTGCTGCCCCAGGCATAGTTTTGCACTG
AGTTAATGAGTTTTTGCATGATCAATCCCTGTTTTAATGTGGAAATTAATCCCACTATTA
AAGCAAGAATCCTACGGGAAGTAACCTGGAGCCGCAAAAAGTCGTACTAGTCTCAGTTTT
TGTTAAAAAAGTGTGTAGGATATTGTTACTCGCTTTTAACAGGGCAACGGAACACCCGCC
CAGAGCATAACCAAACCAGGCAGTAAGTGAGAGAACAATGTCAAACAAACCCTTTCATTA
TCAGGCTCCTTTTCCACTCAAAAAAGATGATACTGAGTATTACCTGCTAACCAGCGAACA
CGTTAGCGTATCTGAATTTGAAGGGCAGGAGATTTTGAAAGTCGCACCCGAAGCGTTAAC
TCTGTTGGCGCGCCAGGCGTTTCATGATGCGTCGTTCATGCTGCGTCCGGCGCACCAACA
ACAGGTGGCCGACATTCTGCGTGACCCGGAGGCCAGCGAAAATGATAAATATGTGGCGCT
GCAATTCCTGCGTAACTCCGACATCGCGGCGAAAGGCGTTCTGCCAACCTGTCAGGATAC
CGGCACCGCGATTATTGTTGGTAAAAAAGGGCAGCGTGTATGGACCGGTGGTGGTGATGA
AGCGGCGCTGGCGCGCGGTGTCTATAACACTTATATCGAAGATAATCTGCGCTACTCGCA
AAACGCGCCGCTGGATATGTATAAAGAAGTGAATACCGGCACCAATCTGCCAGCGCAGAT
CGATCTTTATGCCGTTGATGGCGACGAATACAAATTCCTCTGTATCGCCAAAGGTGGTGG
TTCGGCAAACAAGACGTATCTCTATCAGGAAACCAAAGCGTTACTGACGCCGGGGAAACT
GAAAAATTACCTGGTTGAGAAGATGCGCACGCTGGGTACGGCGGCCTGTCCTCCGTATCA
TATTGCGTTCGTTATTGGTGGAACTTCTGCAGAAACGAACCTTAAAACGGTGAAACTGGC
TTCCGCGAAATACTATGATGAACTGCCAACGGAAGGGAATGAGCACGGTCAGGCGTTCCG
CGATGTGGAACTGGAAAAAGAATTGCTGATCGAAGCGCAAAATCTTGGTCTGGGTGCGCA
GTTTGGTGGTAAATACTTCGCTCACGACATCCGCGTGATTCGCCTGCCACGTCACGGCGC
ATCCTGCCCGGTCGGTATGGGCGTCTCCTGCTCTGCTGACCGTAATATCAAAGCGAAGAT
CAACCGTCAGGGGATCTGGATCGAAAAACTGGAACATAATCCAGGCAAATATATCCCGGA
AGAGCTGCGCAAAGCGGGAGAAGGCGAAGCGGTGCGCGTTGACCTTAACCGTCCGATGAA
AGAGATCCTCGCACAGTTGTCGCAGTATCCCGTTTCTACACGCTTATCGCTTAACGGCAC
GATTATCGTCGGTCGTGATATTGCTCACGCCAAACTGAAAGAGCGGATGGATAACGGTGA
AGGGCTGCCGCAGTACATCAAAGATCATCCGATTTACTACGCGGGTCCGGCCAAAACGCC
GGAAGGTTATGCCTCCGGTTCTCTTGGCCCAACGACCGCCGGACGGATGGATTCTTATGT
CGATCAACTGCAAGCGCAGGGCGGAAGTATGATCATGCTGGCGAAAGGCAACCGCAGCCA
GCAGGTGACGGATGCCTGTAAAAAACACGGCGGCTTCTACCTTGGCAGTATCGGTGGTCC
GGCCGCTGTATTGGCGCAGGGAAGTATTAAGAGCCTGGAATGTGTTGAATATCCGGAACT
GGGAATGGAAGCCATCTGGAAAATTGAAGTGGAAGATTTCCCGGCGTTTATCCTTGTGGA
TGATAAAGGAAATGACTTCTTCCAGCAGATACAACTCACACAATGCACCCGCTGTGTGAA
ATAAACAGAGCCGCCCTTCGGGGCGGTTTTTTTACATGGCACGAAAGACCAAACATTTGT
TATCAAATGGTAAATAATAAGTGAGCTAAAAGTTGCTTAACGAAAGCAAAACAGAAAGAA
AAAATTAATCAGGTGAGGAGCAGGTCATGAATACAGTACGCAGCGAAAAAGATTCGATGG
GGGCGATTGATGTCCCGGCAGATAAGCTGTGGGGCGCACAAACTCAACGCTCGCTGGAGC
ATTTCCGCATTTCGACGGAGAAAATGCCCACCTCACTGATTCATGCGCTGGCGCTAACCA
AGCGTGCAGCGGCAAAAGTTAATGAAGATTTAGGCTTGTTGTCTGAAGAGAAAGCGAGCG
CCATTCGTCAGGCGGCGGATGAAGTACTGGCAGGACAGCATGACGACGAATTCCCGCTGG
CTATCTGGCAGACCGGCTCCGGCACGCAAAGTAACATGAACATGAACGAAGTGCTGGCTA
ACCGGGCCAGTGAATTACTCGGCGGTGTGCGCGGGATGGAACGTAAAGTTCACCCTAACG
ACGACGTGAACAAAAGCCAAAGTTCCAACGATGTCTTTCCGACGGCGATGCACGTTGCGG
CGCTGCTGGCGCTGCGCAAGCAACTCATTCCTCAGCTTAAAACCCTGACACAGACACTGA
ATGAGAAATCCCGTGCTTTTGCCGATATCGTCAAAATTGGTCGTACTCACTTGCAGGATG
CCACGCCGTTAACGCTGGGGCAGGAGATTTCCGGCTGGGTAGCGATGCTCGAGCATAATC
TCAAACATATCGAATACAGCCTGCCTCACGTAGCGGAACTGGCTCTTGGCGGTACAGCGG
TGGGTACTGGACTAAATACCCATCCGGAGTATGCGCGTCGCGTAGCAGATGAACTGGCAG
TCATTACCTGTGCACCGTTTGTTACCGCGCCGAACAAATTTGAAGCGCTGGCGACCTGTG
ATGCCCTGGTTCAGGCGCACGGCGCGTTGAAAGGGTTGGCTGCGTCACTGATGAAAATCG
CCAATGATGTCCGCTGGCTGGCCTCTGGCCCGCGCTGCGGAATTGGTGAAATCTCAATCC
CGGAAAATGAGCCGGGCAGCTCAATCATGCCGGGGAAAGTGAACCCAACACAGTGTGAGG
CATTAACCATGCTCTGCTGTCAGGTGATGGGGAACGACGTGGCGATCAACATGGGGGGCG
CTTCCGGTAACTTTGAACTGAACGTCTTCCGTCCAATGGTGATCCACAATTTCCTGCAAT
CGGTGCGCTTGCTGGCAGATGGCATGGAAAGTTTTAACAAACACTGCGCAGTGGGTATTG
AACCGAATCGTGAGCGAATCAATCAATTACTCAATGAATCGCTGATGCTGGTGACTGCGC
TTAACACCCACATTGGTTATGACAAAGCCGCCGAGATCGCCAAAAAAGCGCATAAAGAAG
GGCTGACCTTAAAAGCTGCGGCCCTTGCGCTGGGGTATCTTAGCGAAGCCGAGTTTGACA
GCTGGGTACGGCCAGAACAGATGGTCGGCAGTATGAAAGCCGGGCGTTAATCTGCAACAT
ACAGGTGCAGCCGTGGAATGATCAAACGAAGCGGCTGCGCCTGAGGTTTATAACGGTGCT
GCACATTGTCGGCATCGTAATTTAACAACTCACCAACGTCCGGCACGCCCGCGCCATTAT
CCCGATTAATCAGTGCAATCAGTGGTGTAGGGCAGGCGTGTTGGACTTGTTTTTGATCTC
CTTTGTACCAGACGCGGGCAATCGGCTGCACCTTCACCGGACGTTTGATTTTTAACTTCG
CGTTCTGTGGCAGGGCAGCGATATCCTGATACTCTCGCTCCAGTTTTCTTTGCCACTCCT
CGCGCGTCCACGGTGCGACACTGCGTGGTGATTTCAGGCTTTTTTCCAGCTGTGCCAGGA
CTTCATCACGATGTAAATTCTTAATGATATGTTTATTAGCCCAACCAAAGCGTAAAGTGG
CGGGGTCGTGCAGAACGGTGAGCGTGCGGTAAGCATTAAGGGTGATCAGCCCCGGCAAAT
GACGATGCACCCATTCAAAACGTGCCGCGGTGGGGAGTTCTGATTCAACCGTGACGATAT
GCTCGAACGTGGTCTTGAGTTTATTGATGTGCTGAATATGACTGACCAACGCTGCTTGCG
AAAGGTTATCGACCTGGTAACACAACACGCCAGGCAGACGGACAGCGGCCTTGCTGCTGC
GATTTTCGGACTGTTGTTGAATAAATAAATGGCGGAAATGACGCAACGCCAGCGACTGCG
CGTCGTTGCCGAGATGTTGTTTTACCTCAATACGATTAAGCGGATTATGCTCATCCTCTT
TTTTTACCTCCGGCAAAGAGAACACGCGGGCAACCAATAGCTTGTGTTGCTCAAGATGAG
CGGCAAATATAGCCAGCTCTTGTTCCATCTGGCGAAAGGTAGTGTTGAGTCGGTCTACGA
GATCGTAACGCGCCATAATATTAACCACTTTAGTTACAACATACTTATTTTATAGCACAG
TCGTGGTGACTTGACCATCGTGCGCGTAGTGTCAGGCAGAGGTAAATTGCGGGATGTTAT
GCCATAACGGCCAGCTAAACGAGAAGCGGGCACCACCCAGTTCGCTGGTGTCACAATTAA
CCGTACCGCCCATTGCCAGTGCTATAGAGTGGACAATTGCCAGCCCCAGCCCGCAGCCGC
CGGTTGAGCGATCCCGGCTGGGATCGAGGCGAACAAAAGGTTCAAAGATATGTTCGCGGT
TTTCTGGGGCAATCCCTGGGCCATCATCCTCAACAATTAATGTCGCTCTATTCCCCGACA
GTAGCAGGCTGGTTTCAACCGTTGAATGGCAGTACCGCAGGGCGTTATTGAGCAAATTAT
CCAGCACGCGCTCCATTAAGCGCATATCCAACGCCGCATAATGGCCTTGCACGAGCGTTT
TTATCCGTACCGTTTTATCGGGCGTTACTGCCTGAATATCTGCCAGATGCGTTGACAGCC
ACAACGGCAGGTCTGGTTCGCTAAGATGAAGCTCGTTTTGTGGGCGATCGAGTCGGGCAT
AAGTCAGCAGCTCTTCAATTAAAGCTTCAAGTTGACTGATATCACGATTCAACGCCTGGG
ATTCGGCGGCGCTCAGGTTATCGCTCATCTCCAGTCGATAACGCAGGCGCACTAACGGTG
TTCGCAGTTCGTGAGCGATACCGTCAATAAGCTGTTTTTTGCTGGCAATTAAGGCGTTGA
TATTGTCCGCCATCTGGTTAAATGCGACGCCAAGTCGTTCAAAGCTCGAACCCTCATCAA
AGTGGATACGTTCATTGAGATGCCCATCGCCAAATCGTTGCGCCGCTGCTTCCAGTTTTA
ACATATCCTGCCAGTGCGGACGCATCCAGATAAACACCGGAAAGGCGAGGGAAATAGCAA
TAAAAGCGATCAGGGCGATATCCAGCAATCGCATCTGATGGAGATAATAAAGATAAGGAA
CAGGACCAACTGCCAGCACGTAGTGGCTGCGCGGGATACGCTGCAAAAACGTGTACTGAT
CGTCCAGGGCGACAATTTCGCCGCCACGCAGTCGGTGCATGGAAATATCATCAAGATGGT
ATTTACTCAGTGGCTCGACACGCAGATCGAAAGAGAGATTTAAATCCATCTCTTTCAGAG
TTTTACCCCAGTCGTGTGGGGGGATCTCACGCAATTCGCTGCGCATCAGATACAGCGAAC
TGTTCATCAAATCATCCAGCGACTGTTTGCCCGCGCGTTCGGCGGTAAATTTGTACACCA
GCCCAACCAGCAGAGACATCACAAGGAAGCAGACAAACAATAACAGGTAAAACTGGATAA
ACAGTTTTTTCATCGCTTATTCCCATGCATGAGGCGCAAAAAGATAGCCTTTGTTACGCA
CAGTTTTAATGCGATAAGGTTCTGCGGCGTTATCGAGCAGTTTTTTTCTTAACCGCGAAA
TAGCCACGTCCACGCTACGATCCAGTCCGTCATAACTGACGCCGCGTAAATTTTTCAGCA
ATGCATCGCGGTCCATGATTTGCCCGGCATGGGTAGCTAATTCCCACAATAATTCGAAAT
CAGCTGTCGAGAGCGAGATTTCAGTGTTAGCCAGGGTGACTACGCGGTTGATGGGATCGA
TGGTCAACGTGCCGAAATGCAGGGCTTTGTAGGGAGTCAGAGACGTTTCCTGAAGACCTT
TGGTCAGTGTGGCTTGCTCATTCTGACGCAAATGCAAACGTAAACGCGCTAGCAAAACAG
CAGGGGGCGTCGTTTTGAGAATATAGTCGCAGGCACCCATTTCCAGTGCCAGGATGTGGT
TCATATCGCTATCGAGAGAGGTTAGAAGAACAATCGGTCCAGACCACTTTGCGCGTAAAT
CACGACAAATGGTCATGCCGTCCTTGCCTGGTAGCATGATGTCGAGTAACACCAAATCCG
GATTTTCTCGCAAAATGGTTTCTTCGGCCTGGTCGCCGCGCGGCTCTACGGTAACCTGCA
TATCATGTTTTGCCAGGTACGCGGCAATCAGTGAACCGACTTCCGCATCATCTTCCACAA
ATACGATAGTGTTCATAACATTCACGGTAGATATAAAAACGTCACAATACACCGCGCTGT
TTTTACTTACTATCAATCGTTTCTAAACAAGTTTTCATCAGGTATTCTACTGATGACTTG
TTATGGAAGTGTTAAGGTAAAAAGATGGGGCTGGTAATCAAAGCCGCGCTCGGTGCGCTG
GTAGTGCTGTTGATTGGTGTTTTAGCAAAAACGAAAAATTATTATATCGCCGGGCTGATT
CCACTTTTCCCGACCTTTGCGCTTATCGCGCATTATATTGTTGCCAGCGAACGCGGCATT
GAAGCCTTACGCGCAACCATCATTTTTAGTATGTGGTCGATTATTCCCTATTTTGTTTAC
CTGGTGTCGCTGTGGTATTTCACCGGAATGATGCGCTTGCCCGCCGCTTTTGTTGGTTCT
GTTGCGTGTTGGGGGATAAGCGCATGGGTGTTGATTATATGCTGGATAAAGCTGCATTAA
CGCAGATGACGACCGCCATCAAGTGGGAAACTGCGTCCGGTGACAAAGCAACTGGTAAGT
AAGTAATCGACCAGGTCGATCACTTCTTTCTCGCCAGGCGCGGTTTTCATCAGTGATTTA
TTCAGCGCCTGTTGTCGATATTCGGCATCATCATGTTCATTAAACAGGATCAGCGATGGC
GCAATAGAATTCACTTTCACTTCCGGTGCCAGCTTGCGGGCAAACGAGCGGGTCATATTA
TCCAGTGCCGCTTTGCTTGCAGCATACGCAATATGTTTGTCGCTACCGCGCTCCACCACA
TAATCGGTAAAGTGAATGATATCGCTGGCGGCGTGTCCGTGCCCACGCAGTAATCTTTCC
AGCGCATGGTTGAGCAGGTATGGGGTATTAACGTGGATCTGCATCATGCAAGCCAGTACG
TCGGCCAGTGGCGCACCCGGTTTTTCCGCCATCCACGCACTGGCGTTATGCAAAATAGCA
CGCAGACCATGGGTGCTTTTTAGTACTTCATCGGCAAACGCCATCACACCGTCGTTGGTC
GAAAAATCAGCCTGAATACACTGCGCACCTGCATTAATCAGTCCATCAATGGCTGGATAG
TGTGTCCGATAGCTGACAATCACCGGTTGCTTTTGATTAATGAAATGCCATGCGAGGGCG
AGGCCGATGCGACGACCTCCGCCAGTAATTAATATTGGCAAGGGCTGGGTTTTACCCATC
GTTATCTCCTTTGCTATCCAACGATGGGATGAACGTTATCCCACCAGCATCCAGGTCGCC
GGAACTGAGGCAATTAACAGCATGCCAATCAGCACCATTTCCTGACGGTTCAGTACATTA
TCATGGGTATGCGTTTTGCGCGCGTACAGGAAAACCAGCAGCCCCGGTGCATACAGAACA
ACGGATAACAGCAAGTGCATTGGACCAGAGGCGTACAATAACCATAAGCCATAAATGCAG
GCACCGACACCTACCGCTTTATGCAGTGGACGGGTTGCGATTTTCAGCAAGAACGCGCCG
ACCAGGAAATAGGGCACCAGAATCATTTCTGAGGCGATGGTCAGCAACGTGTTGTAATCG
GAACCGGTCAGCCAGATGAGTACCAGACAAATTTGCACGCAGATGTTGGTCAACCACAGT
GAGGCGGATGGCGCAGCTTGTGCGTTCTGGCGCGCAAAAATGCGCGGGAATGCTTTATGA
GTGGCGGCCAGGAACGGTACTTCTGCTGCCATGATGGTCCAGCTTAAGTACGCGCCGCAA
ACGGAAACGATCAAACCGGCAGCGATGATGATTTCGCCCCATGGTCCCATCATTTCCACC
ATCAGACCGGCCATTGACGGGTTACGAATTTCAGCCAGTTCAGGACGTGCCACCACACCC
AGCGAAAGCAGCGTTACCAGCAAGTAAACGCCCAGAGCGGAGAGAACCGCCAGCAGTGTC
GCTTTGCCAACATCACGTTTATTACGCGCACGCGCAGAAACAACCACGGCACCTTCCACA
CCAATGAAAACCCACAGGGTGATCAGCATGGTGTTTTTCACCTGTTCCCAAACGGGTACG
CCAAGTGCAAGTCCGGTGAAGTCGAGCTTGAAGGTATCCAGTTTGAACATCATCATCGCC
AGCACAACAAACAGACCCAGCGGCAACAATTTTGCCAGTGTCGCCACCAGGTTAATGCTG
GCAGCGGTTTGCACCCCGCGCAGGATCAAAAAGTGAACAATCCACAATAAAGCCGATGCA
CCGACTATCGATTGCCAGGTATTACCATCGCCAAACAGGCGCAATTCCGGCGTGTCCGTA
AAAAAGCTTAACGCGGAAAAAACGATCACCAGATAGGAGACGTTGGCGATGACTGCGCAC
AGCCAGTATCCCCATGCGGAACAAAAGCCGATTAGCTCGCCAAACCCTTCGCGGGCATAG
GTAAAGATACCGCCGTCAAGTTCGGGACGAATGCGCGTGAGGATCAGCATGGCAAAGGCC
AGCAATAAAATGCCAGCGCCAGTAATACCCCAGCCGATGAGCAGTGCTGCCGGGCTGGCA
ACTGCCGCCATATTTTGCGGCAGACTGAAAACACCCGCGCCCAGCATTGAGCTTAATACC
AGCGCGGTGAGTGCGCTCAGTCCCAGTTTCTTTTCCATCGATATCCAGTGATTAAAACGT
GATAAGAAGAATAAATATTAGGGCAAAACGCATAAAAATGGAGTTTGCCACTGAAGCGCG
GGATTTTACGAAGAGATGTGTCTGCATGCAATGGTCGCGGGGAAATTTGTGACTAAAAAT
GCGAAAGGCGGCATCAAGCCGCCTTATAGGAGTAACTGAATAGTTATTTATACAGATCTG
CGCTGACGGTCAGGTTATTACCACGTTCCTGCCACTGGCGGGTGATGTGGTAATACTTAG
CACCTTTCTTCGCGGCACGTTTCGCAACCTGATAGGAGACTTCGGTCATGTTGCCGTAGT
TGCCAGAGAATTTGATGCTGTCGAACGGGACCATCATCGCTGCGGTCGCTTTGTTCAGTT
CTTCGACTTTAGTGCCATCCGGGAGCGTGACGGTGTAACGCCCGCCTTTTGATGACTGGG
TTTCAAAGAAGCGACCGACTTCAGAACTTGGTGATGCGGTAGTCGCAACACCCGGGATCT
CAACTTTCTTCGCGGCTTCGCCACCGGCAGCCAGAGCTGCACGTCCTGCTTCGGAATCTG
CCGGGATCACATCCGGGCTCTGGACGATACGTTTCTTAGCATCTTTTTTATAGATGAATG
CAGTAATACGCTGGTTGCCGCCCTGGTTGGCATCGATTTGACGAACGATGTAGAAAGAGT
AGGCACCTTTCGCTTTTGCCGCTTTGGTGATGGCATCATTGACTTCTGGCTGGCTACGAT
AGAAGCCCTGGACGGTGACCGTGTCAAACGGTTCAATCAGAACAGCCTGATCTTTCGGCA
GTTCGACAACACCGTTAATTACGCGATTACTTGTTTCTTCTGCTTTTTCAGCATCGGCTT
TATAGAGGTCAGCGACCACACGCCAGTTACCGCTGTTACCAAAATCAGAAGTGTCGACAA
CATAAAAAGAGGCGGCACCTTCTTTATCTGCGCGACGAGAAACGGCTTTCACCGCTTCGC
CAATAGCATTAAAACGACCGGTAACCACTACACGGTCAAAAGGTTTAACCGCTGCCGCTT
GCTCCGGTGTCAGTTCTGTTGCTGCGTTAACGGAGAATGCCATAGCAGAAAGCAGTGCCG
ACGCCAGGAGGGTGTTCTTAAGCTTCATAAAAATAATCCTTCGCCTTGCGCAAACCAGGT
ACTGGTATTGTTATTAACGAGAAACGTGGCTGATTATTGCATTTAAACGGTGTAACTGTC
TGCGTCATTTTTCATATCACATTCCTTAAGCCAATTTTAATCCTGCTCAAATGACCGTCT
ATGCTTAAAAAACAGCCGTATCAGCATCATTACTACTGAAGCAACTGAATTGTATAAGTT
AATTTAATGTTAAGTAGTGATTCGTGCCGGGGCGATGTCTCGTTTTACCCGACCGTCGAA
GACAATTATCAGTCTTTATCCGGCGTTCTAAGGTGTTTATCCCACTATCACGGCTGAATC
GTTAATATTTTGCGAGTTCACGCCGAAATACTGATTTTTGGCGCTAGATCACAGGCATAA
TTTTCAGTACGTTATAGGGCGTTTGTTACTAATTTATTTTAACGGAGTAACATTTAGCTC
GTACATGAGCAGCTTGTGTGGCTCCTGACACAGGCAAACCATCATCAATAAAACCGATGG
AAGGGAATATCATGCGAATTGGCATACCAAGAGAACGGTTAACCAATGAAACCCGTGTTG
CAGCAACGCCAAAAACAGTGGAACAGCTGCTGAAACTGGGTTTTACCGTCGCGGTAGAGA
GCGGCGCGGGTCAACTGGCAAGTTTTGACGATAAAGCGTTTGTGCAAGCGGGCGCTGAAA
TTGTAGAAGGGAATAGCGTCTGGCAGTCAGAGATCATTCTGAAGGTCAATGCGCCGTTAG
ATGATGAAATTGCGTTACTGAATCCTGGGACAACGCTGGTGAGTTTTATCTGGCCTGCGC
AGAATCCGGAATTAATGCAAAAACTTGCGGAACGTAACGTGACCGTGATGGCGATGGACT
CTGTGCCGCGTATCTCACGCGCACAATCGCTGGACGCACTAAGCTCGATGGCGAACATCG
CCGGTTATCGCGCCATTGTTGAAGCGGCACATGAATTTGGGCGCTTCTTTACCGGGCAAA
TTACTGCGGCCGGGAAAGTGCCACCGGCAAAAGTGATGGTGATTGGTGCGGGTGTTGCAG
GTCTGGCCGCCATTGGCGCAGCAAACAGTCTCGGCGCGATTGTGCGTGCATTCGACACCC
GCCCGGAAGTGAAAGAACAAGTTCAAAGTATGGGCGCGGAATTCCTCGAGCTGGATTTTA
AAGAGGAAGCTGGCAGCGGCGATGGCTATGCCAAAGTGATGTCGGACGCGTTCATCAAAG
CGGAAATGGAACTCTTTGCCGCCCAGGCAAAAGAGGTCGATATCATTGTCACCACCGCGC
TTATTCCAGGCAAACCAGCGCCGAAGCTAATTACCCGTGAAATGGTTGACTCCATGAAGG
CGGGCAGTGTGATTGTCGACCTGGCAGCCCAAAACGGCGGCAACTGTGAATACACCGTGC
CGGGTGAAATCTTCACTACGGAAAATGGTGTCAAAGTGATTGGTTATACCGATCTTCCGG
GCCGTCTGCCGACGCAATCCTCACAGCTTTACGGCACAAACCTCGTTAATCTGCTGAAAC
TGTTGTGCAAAGAGAAAGACGGCAATATCACTGTTGATTTTGATGATGTGGTGATTCGCG
GCGTGACCGTGATCCGTGCGGGCGAAATTACCTGGCCGGCACCGCCGATTCAGGTATCAG
CTCAGCCGCAGGCGGCACAAAAAGCGGCACCGGAAGTGAAAACTGAGGAAAAATGTACCT
GCTCACCGTGGCGTAAATACGCGTTGATGGCGCTGGCAATCATTCTTTTTGGCTGGATGG
CAAGCGTTGCGCCGAAAGAATTCCTTGGGCACTTCACCGTTTTCGCGCTGGCCTGCGTTG
TCGGTTATTACGTGGTGTGGAATGTATCGCACGCGCTGCATACACCGTTGATGTCGGTCA
CCAACGCGATTTCAGGGATTATTGTTGTCGGAGCACTGTTGCAGATTGGCCAGGGCGGCT
GGGTTAGCTTCCTTAGTTTTATCGCGGTGCTTATAGCCAGCATTAATATTTTCGGTGGCT
TCACCGTGACTCAGCGCATGCTGAAAATGTTCCGCAAAAATTAAGGGGTAACATATGTCT
GGAGGATTAGTTACAGCTGCATACATTGTTGCCGCGATCCTGTTTATCTTCAGTCTGGCC
GGTCTTTCGAAACATGAAACGTCTCGCCAGGGTAACAACTTCGGTATCGCCGGGATGGCG
ATTGCGTTAATCGCAACCATTTTTGGACCGGATACGGGTAATGTTGGCTGGATCTTGCTG
GCGATGGTCATTGGTGGGGCAATTGGTATCCGTCTGGCGAAGAAAGTTGAAATGACCGAA
ATGCCAGAACTGGTGGCGATCCTGCATAGCTTCGTGGGTCTGGCGGCAGTGCTGGTTGGC
TTTAACAGCTATCTGCATCATGACGCGGGAATGGCACCGATTCTGGTCAATATTCACCTG
ACGGAAGTGTTCCTCGGTATCTTCATCGGGGCGGTAACGTTCACGGGTTCGGTGGTGGCG
TTCGGCAAACTGTGTGGCAAGATTTCGTCTAAACCATTGATGCTGCCAAACCGTCACAAA
ATGAACCTGGCGGCTCTGGTCGTTTCCTTCCTGCTGCTGATTGTATTTGTTCGCACGGAC
AGCGTCGGCCTGCAAGTGCTGGCATTGCTGATAATGACCGCAATTGCGCTGGTATTCGGC
TGGCATTTAGTCGCCTCCATCGGTGGTGCAGATATGCCAGTGGTGGTGTCGATGCTGAAC
TCGTACTCCGGCTGGGCGGCTGCGGCTGCGGGCTTTATGCTCAGCAACGACCTGCTGATT
GTGACCGGTGCGCTGGTCGGTTCTTCGGGGGCTATCCTTTCTTACATTATGTGTAAGGCG
ATGAACCGTTCCTTTATCAGCGTTATTGCGGGTGGTTTCGGCACCGACGGCTCTTCTACT
GGCGATGATCAGGAAGTGGGTGAGCACCGCGAAATCACCGCAGAAGAGACAGCGGAACTG
CTGAAAAACTCCCATTCAGTGATCATTACTCCGGGGTACGGCATGGCAGTCGCGCAGGCG
CAATATCCTGTCGCTGAAATTACTGAGAAATTGCGCGCTCGTGGTATTAATGTGCGTTTC
GGTATCCACCCGGTCGCGGGGCGTTTGCCTGGACATATGAACGTATTGCTGGCTGAAGCA
AAAGTACCGTATGACATCGTGCTGGAAATGGACGAGATCAATGATGACTTTGCTGATACC
GATACCGTACTGGTGATTGGTGCTAACGATACGGTTAACCCGGCGGCGCAGGATGATCCG
AAGAGTCCGATTGCTGGTATGCCTGTGCTGGAAGTGTGGAAAGCGCAGAACGTGATTGTC
TTTAAACGTTCGATGAACACTGGCTATGCTGGTGTGCAAAACCCGCTGTTCTTCAAGGAA
AACACCCACATGCTGTTTGGTGACGCCAAAGCCAGCGTGGATGCAATCCTGAAAGCTCTG
TAACCCTGACGGCCTCTGCTGAGGCCGTCACTCTTTATTGAGATCGCTTAACAGAACGGC
GATGCTTTGACCTCCCGCTGTTTGTTCAAGCGCAATTTTGACAATAATTGTCAACGGCAC
GGAAAGCAGCATACCCACCGGTCCTAACAACCATCCCCAAAAAATCAACGACAAAAATAC
CACCAATGTGGAAAGCCCCAGCCCACGCCCCATGATACGCGGCTCCAGAATATTGCCGAA
GACCAGATTAATCAGCAGATATCCCGCCAGCACCAGCAACGCTTCGTAGAAGCCATTAAA
CACCAGTACCTGAGCGATAGGGGGGATTGCCGCGAGGACTGAACCAATATTCGGGATGTA
ATTAAGCGCAAAGGCCAGCAATCCCCAGACAAAAGCGAAGCGAACATCGAGTGCGGCGAG
CATCGCCCAGGCGACCAGGCCGGTGATGATGCTGATGGCTGTTTTCAGCACCAGATAATG
AGAAACACTGTCAATCGCACGTTGAATCGCCGCCATCCCTTCAACCGGACGCGCCATCAT
TTGCTGAAATTTTCCGGGCAATTGTGGCACTTCGAGCAGCATAAACAGCACCGTCAGCAG
CAATAAAAATATTGATGACATGGCATTAGATAACTGCGTCAATAAGTTGGTGAGCAACGT
CATCGCCGCGTTCGGATCAATATAATGCGCCAGCTGGTCAACTGAGACGTCAATCCCTAC
GCGTTGCAACAACGGTTCAAGCGCTTGCAGCGGCGTCATAATAGAGTTGCGATATTGCGG
TAACGTCCGCGTCAACTCGTTGAGCGCGGAACCCAGATAAGCTAATAGCAACACCATCGC
CATCACGATGATGGTCATCAAAATCGACACCGCCAGTACACGCGGCACACGCCAGCGGAC
CATGTGTTGCACCAGCGGGTTAAGAATAACAGCAATAAATAATGCGAGAATAAACGGCAC
GATGATCTCGGCGGCAAAACGGATACCGCAGAGAATAATGACCAGCATTCCCAACATAAT
GACGATTTTTAGGCCATTGAGCGTGATGATCGGCTTTGCCATGCTTGTCCCCGTTTTTTC
TTCCTTTGCTAATAATAATGTCTTTTTCGCTCCGTCATCATAACGAAAATCAAACCGCTC
AGGTAAAGAAGTGAAAATATTTTGAGTTAATTCTTAAGCTATGATACAAATCAGGCGTGT
TCAACTACCGAGGACAATTATCATCCGCGATGACGAGAAGCAACACTGCGGATAATTGTA
ATATTATGGACAATTTGTTCAGGACGTTATTTTCTACATTTACCCATCTTCGTACCTCAT
CCACTATCTTGCTCGTAGGTGAGCAGCACTGGCGCAACGCGCTTTAGTCCTTTCTTCTGC
CAAAGCTTGCGCTATGCGCGGGGCTTGACCACTTTACTTTGGTTTCGCTGAATTAAGCGA
AAATTAAAATAATTCTCTTGCAGGAGAAGGACAATGTATATTTATTGGATTTTATTAGGT
CTGGCTATTGCTACAGAAATTACCGGTACGCTGTCAATGAAATGGGCGAGCGTCAGTGAG
GGAAATGGCGGCTTTATTTTAATGCTGGTGATGATTTCTCTGTCGTATATATTTCTCTCT
TTCGCCGTTAAAAAAATCGCCTTAGGCGTAGCTTATGCGCTGTGGGAAGGTATCGGTATT
TTATTTATTACCTTGTTTAGCGTTTTGTTATTCGACGAAAGTTTATCGCTGATGAAAATT
GCCGGGTTAACCACCCTGGTCGCCGGGATTGTGTTGATAAAATCAGGTACCCGTAAAGCG
CGTAAACCTGAACTGGAGGTGAACCATGGCGCAGTTTGAATGGGTTCACGCCGCCTGGCT
GGCATTGGCAATCGTGCTGGAAATCGTTGCTAACGTCTTTTTGAAATTTTCTGACGGCTT
TCGTCGCAAAATATTTGGCTTGCTCTCCCTGGCGGCGGTGCTGGCTGCCTTTAGTGCGCT
TTCTCAAGCCGTTAAAGGGATCGACTTGTCTGTCGCTTATGCATTGTGGGGCGGGTTTGG
TATTGCCGCCACGTTAGCCGCAGGTTGGATCTTGTTTGGTCAACGGTTAAATCGTAAAGG
CTGGATTGGCCTGGTCTTGCTGTTGGCTGGAATGATCATGGTGAAACTTGCCTGATGAAG
ACGCTGCCCGCGCTGTCGGGCAGCGTTTGAACATTATTTTTGCGACAGTTGATCCAGCTT
GTCGCGAAAACCGGTAACAGAAATGGCCCGGTTATCGGCGCGCCAGCGATCTTTCGCGGC
AGGAGCCGAACTTTGCACCCCAATTAATTGCCAGCCGTCATCGGTATGCAACATCAGAGG
CGAACCGCTGTCACCCGGCAAGGTATCGCACTGATGTGACATCACCGACGTTTGCGCCCA
GCCAGTCACTTCACAGTTTTGATGACTGTACAACGTATCGAGATGATCTTCAGGGTAGCC
TGCCTGAGTCACTTTACGACCTGCCGCTTTTAATGCGGCGGTAAGCGCGGCTTTATCTCC
CTCAAATAACGGCAACGGCGTAATGCCAGAAGGGGGATTACGTAGCACAATCAATCCGAA
GTCCCACGGCGCGGCTGCGGGAGGTACAATCCAACCATCCCCATCTGCTTTTAACCGCTT
TCCCAGTGTCGGATCAACGCGGCCTTCTATGTCGTGGATCTCATAGCGCCAAAGACCTTT
ATTTGACACAAAACGCAGCGCCACTGCTTTATCGGCTTTACCCTTTGGAGGTGTCAATAA
ACAGTGTCCTGCCGTTAATGCCAGATTGGGTGCAATCAGCGTCGCCGTACATAAATTGCC
GCTGGCCGTTTCCAGTTGCCCAACCGCATCCCACGGTGATTGGGTCGTGTCATTCACTGG
CACACGATCATCATGACCAAAAAACAGGGTGCTGACCTCATCGTTTGCCGATCTGGCAAC
GTCTGGTTTATCTGCAAACACAAAAGCAGACGTCAAACTAATTGCACCCAACACTACAGC
AATGGTTGTACGCATATCACACTCTGGTGGGTAATTATGATTATTAAAAGCAAACCCTCA
TAAATACTATAGACGGGACGGGATGAAAGTGGGAGTAAAATCAGATAACTACAATCAGGA
AAGATAAAAACGGGCGGTAATCAGTGCGCATAAAATAAGGATGATCAGAATGAACTCAAA
GCGATAACGGCCCACCATACTACCCTCCGCTAAAGGCGGTGCTAAACGTTACCCGCTTAG
CACCGTAATTTTCAGGCGCGAGGGGGCGCGCCAGCATTACTGTTGAAAACTTACGCTGCG
GGTTGTGCAGCAGGTTTTGCCGGTTGCTGATGGCTGTGTTTCTTGGCGTGTTTCTTCGCT
GCCTGCGCTTTTTGTTCAGGGGCTTTCTGTTCAGCTTTCGTATTTTTATGATGCTTTTTA
GCCGCCTGCGCTTTCTGGGCAGGTGCTGCTTTATGCTGTTTTTTATGATGTGTAGTTTTC
GCCGGCGCTGCTTTGGTGGTCGTCGCAGTCGGAGCAGGTGTGGTCGTAGTCTCTGCAGCA
AAGGCGGCAGAAGACAGACCCATAGCAGCGGCAACAACCAGAGCTAATACTTTTTTCATT
GTCATACCCTCAATTTGTTTTTTCATTTAACCCCACTGCGGGGCCGTTGAAATAACTATA
TCCCTGGGAATGGCAGACTTCCGTGAGTGGTTGGTTTCAGCGTGTAACGATATGTACAAA
CGCTGAATAAATTACAGCGTTGATAATAACGTATTGTGACTTAAGGGAAATTTAGCTACC
AATAATAGTAGTCTTGATCGGGTTAACTATTTTACTACTTACAAAGCAGTAGAATAACTG
CGCATCAGTAATAAATGACACACAGCAAAATGAATCCGTTTATTTGGGTACTTATAATCC
TGATGACGCTAGACGCGCTGCGGGAATTGGCTGGCGCTTCGTCTATTTTAGGATGGCTAT
TAACGTTGGTTTGAGCTGGCAATAAGTCCGGACGGGTATTTACCGCAGTCCGGACTTATT
TTTCAGGCGTGCAGACGACGATGCAAACGCGTCCCGACCAGCAGAGCAATGACCAGCATC
AGAGCAATAAATGCGCCGACGCCGTTCCAGCCATAGTTATGCCAGAAAACACCACCCAGC
GTCCCGGCAATACTCGACCCCAGATAGTAACTGAACAGATACAGCGAGGAGGCCTGGCCT
TTAGCGCGTTTTGCGCGGGGGCCGATCCAGCTGCTGGCTACTGAGTGGGCTGCGAAGAAT
CCTGCTGAGAAGAGTAACATTCCGGCAAAGATCAGCCACAGCGAGCTGAATAAGGTCATC
AGTAAACCAAACAGCATAACCCCCGTCGAAAACAACATCACTGGACCACGCCCATAGCGG
GTGGTCATGGTTCCGGCTTTGGGTGAGCTCCATGTACCGGTCAAATAAGCCAGCGATAAT
AAGCCAACCACGGCCTGACTGACATGCCAGGGGGAGAGCATCAACCGATAGCCGATGTAA
TTAAACAGCGTGACGAACGACCCCATCAGCAAAAAGCCTTCTGCGAACAATAACGGTAAT
CCCCGGTCACGCCAGTGCAGACGAAAGTTGATAAACAACGTCTTAGGGCGCAGCGAAGTC
GGGCGAAAATGGCGTGATTCAGGGAGGATTTTCCAGAACATCAACGCCGAGGCCAGCGCG
AAACAACCGATTGCCGCCAGAGCAATTCGCCAGTTGAAAAAGTCCGTGAAGACACCGCTA
ATTAAGCGTCCGCTCATGCCGCCAATTGAGTTGCCGCTGATATACAACCCCATTGAAAAG
GCCACGAAACTGGGATGGATTTCCTCGCTAAGATAAGTCATGCCAACAGCTGCCACGCCA
CTTAACGAAAGCCCAATCAAGGCGCGCATAATCAAAATGCCGTGCCAGCTGGTCATCATT
GTCGAAAGTAACGTACAAATGGAGGCCAACAGTAGCGCCGTGACCATCACTGGTTTGCGA
CCAATGGCATCGGATAGCGGGCCAGTAAACAGCAAACCAATAGCCAACATCGCCGTGGAA
ATGGACAGTGAAATACTACTGTTCGCGGGGGTTAAGCCAAACTCCTGCGAAAGCACCGGA
AGGATAGGCTGCACACAATAGAGAAGTGCAAATGTTGCCAGTCCGGCAGAGAACAGCGCC
AGGGTGACGCGCATAAATTGCGGCGTACCGCGTTTAATAAATTGATTTGGCTGAGAAATG
CTTTGCTTGTCAGTGTCGCTTGCCGGAGCGCCATCAACAGTTGTAGTACGGCTCACTTGA
AATCCTTGCTAAATATGCCTGTAGATCAGGCTTATACATAGGGTAGGAAAATCGAATTGT
TCTGTCTAATATATTAATAATCTCAAATAAGATGTTTTAAATATGAATATTGAACTTCGT
CATCTGCGTTACTTTGTTGCTGTTGCGGAAGAGCTGCATTTCGGGCGCGCCGCTGCCCGC
CTGAATATTTCGCAACCGCCGCTAAGTCAGCAGATTCAGGCGCTGGAGCAACAAATTGGT
GCCCGACTGCTGGCACGAACCAATCGCAGTGTATTGCTGACGGCAGCAGGAAAACAGTTT
CTTGCAGATAGTCGGCAAATCCTGTCTATGGTGGATGACGCTGCCGCTCGCGCTGAAAGG
CTGCATCAGGGTGAAGCGGGGGAGTTGCGCATTGGTTTTACTTCGTCGGCTCCTTTTATT
CGGGCGGTGTCCGATACGTTATCGCTGTTTCGCCGTGATTATCCTGATGTCCATTTACAA
ACCCGCGAAATGAACACTCGCGAGCAAATCGCTCCGCTCATTGAAGGAACGCTGGATATG
GGATTGCTGCGTAACACAGCGTTACCGGAGTCGCTTGAACACGCAGTCATCGTCCATGAA
CCGCTTATGGCGATGATCCCGCACGATCATCCCCTGGCAAATAACCCGAATGTAACGCTG
GCTGAACTGGCGAAAGAACCCTTTGTCTTTTTTGATCCGCACGTCGGGACAGGGCTGTAT
GACGATATTCTCGGGCTGATGCGACGTTACCATTTGACGCCCGTCATCACTCAGGAGGTG
GGCGAGGCAATGACCATCATCGGTCTGGTTTCCGCCGGTCTGGGTGTTTCAATTTTGCCT
GCGTCATTTAAACGTGTTCAGCTCAACGAAATGCGCTGGGTGCCGATTGCTGAAGAGGAT
GCGGTTTCTGAAATGTGGTTGGTCTGGCCGAAACATCATGAACAAAGTCCGGCTGCGCGT
AACTTTCGTATTCATCTGCTGAATGCTCTCAGGTGAGGGAAATTTCAGCGAAAAAGCCCG
AAAAATGTGCTGTTAATCACATGCCTAAGTAAAAATTTGACGACACGTATTGAAGTGCTT
CACCATAGCCTACAGATTATTTCGGAGCGCGAAAATATAGGGAGTATGCGGTGGTTGCTG
AAAACCAGCCTGGGCACATTGATCAAATAAAGCAGACCAACGCGGGCGCGGTTTATCGCC
TGATTGATCAGCTTGGTCCAGTCTCGCGTATCGATCTTTCCCGTCTGGCGCAACTGGCTC
CTGCCAGTATCACTAAAATTGTCCGTGAGATGCTCGAAGCACACCTGGTGCAAGAGCTGG
AAATCAAAGAAGCGGGGAACCGTGGCCGTCCGGCGGTGGGGCTGGTGGTTGAAACTGAAG
CCTGGCACTATCTTTCTCTGCGCATTAGTCGCGGGGAGATTTTCCTTGCTCTGCGCGATC
TGAGCAGCAAACTGGTGGTGGAAGAGTCGCAGGAACTGGCGTTAAAAGATGACTTGCCAT
TGCTGGATCGTATTATTTCCCATATCGATCAGTTTTTTATCCGCCACCAGAAAAAACTTG
AGCGTCTAACTTCGATTGCCATAACCTTGCCGGGAATTATTGATACGGAAAATGGTATTG
TACATCGCATGCCGTTCTACGAGGATGTAAAAGAGATGCCGCTCGGCGAGGCGCTGGAGC
AGCATACCGGCGTTCCGGTTTATATTCAGCATGATATCAGCGCATGGACGATGGCAGAGG
CCTTGTTTGGTGCCTCACGCGGGGCGCGCGATGTGATTCAGGTGGTTATCGATCACAACG
TGGGGGCGGGCGTCATTACCGATGGTCATCTGCTACACGCAGGCAGCAGTAGTCTCGTGG
AAATAGGCCACACACAGGTCGACCCGTATGGGAAACGCTGTTATTGCGGGAATCACGGCT
GCCTCGAAACCATCGCCAGCGTGGACAGTATTCTTGAGCTGGCACAGCTGCGTCTTAATC
AATCCATGAGCTCGATGTTACATGGACAACCGTTAACCGTGGACTCATTGTGTCAGGCGG
CATTGCGCGGCGATCTACTGGCAAAAGACATCATTACCGGGGTGGGCGCGCATGTCGGGC
GCATTCTTGCCATCATGGTGAATTTATTTAACCCACAAAAAATACTGATTGGCTCACCGT
TAAGTAAAGCGGCAGATATCCTCTTCCCGGTCATCTCAGACAGCATCCGTCAGCAGGCCC
TTCCTGCGTATAGTCAGCACATCAGCGTTGAGAGTACTCAGTTTTCTAACCAGGGCACGA
TGGCAGGCGCTGCACTGGTAAAAGACGCGATGTATAACGGTTCTTTGTTGATTCGTCTGT
TGCAGGGTTAACATTTTTTAACTGTTCTACCAAAATTTGCGCTATCTCAATTTGGGCCAG
GAAAGCATAACTTAGACTTTCAAGGTTAATTATTTTCCTGGTTTATATTTGTGAAGCATA
ACGGTGGAGTTAGTGATGCTGAAGCGTTTCTTTATTACCGGTACAGACACTTCTGTAGGG
AAAACGGTGGTTTCCCGCGCATTGCTACAAGCGTTAGCCTCCCAGGGAAAAACGGTTGCG
GGATATAAACCCGTAGCGAAGGGGAGCAAAGAGACACCCGAAGGGCTGCGTAATAAAGAT
GCCCTGGTGTTGCAGAGTGTTTCAACCATCGAACTGCCTTATGAAGCAGTTAATCCTATC
GCGTTAAGCGAAGAAGAAAGTAGCGTGGCGCACAGTTGCCCAATCAATTACACCCTCATT
TCAAACGGCCTGGCAAACCTGACCGAAAAAGTCGATCATGTCGTGGTAGAAGGGACTGGC
GGCTGGCGCAGTCTGATGAATGATTTGCGTCCACTCTCTGAATGGGTAGTGCAGGAACAA
CTGCCGGTGTTGATGGTTGTCGGTATTCAGGAAGGTTGCATTAACCATGCACTGCTAACA
GCTCAGGCGATCGCCAACGACGGGCTGCCGCTCATTGGCTGGGTGGCTAACCGAATCAAC
CCAGGACTGGCGCATTATGCGGAAATCATTGATGTGCTGGGTAAAAAACTTCCGGCACCG
CTCATTGGTGAACTGCCTTATCTGCCGCGCGCCGAACAGCGTGAACTGGGGCAATACATC
CGCTTAGCTATGCTGCGCAGTGTGCTGGCGGTAGATAGAGTCACGGTGTAACGTCCGCGA
AATTACCGACGCAATTACGCAGGCAATCAATAAACCGGGGAGTAGCTGATACTCCCCGGT
CATTTCACATATCATCAACGTCGACATAATCGGCGCGTGCGTGGTCGCCGCCAACAGTGT
CGCCATCCCGGTCAATCCGAGTAAAAGTGTAATTTCTTCGCCATCAGGGAACCATAATCC
CAGGCTACGACCATACAACATGCCAATGGCAAGACCGATAAATAGCGTCGGTGTAAAGAC
CCCACCGGGTGCGCCGGAACCGCTACTCGCCAGCACGGCACACAGTTTACAAAGGAAGAT
CCCGGCAATGATCATTAACAGTGGTGGGGCGGTTAAAAAGGATTGTACGGTGCTATAGCC
GTTGCCCCACACTGCAGGTGTGAACAGGGAAAGCAGACCCACGATCAACCCGCCTAGTGC
CAGTTGCCAGGGCGGCGCAAGTTTGAGACTCACAAATCCACGATGACAGGCGTTCATTAA
CGTTAACAACAGTGGTCCGCACAGACCTGCCAGCACACCTGTACTGATAATCAGCGCATA
GTCACGAGCCTGAACCGTCACTGAGAGTTGTACGTTGTAGAGTAACGCGTCGCTATGATT
AATCAGATTGCTAACCAGCAATGCCACGACGGCGGAAATAATCACCGGGCCGAGAGAGGC
CAACATCATAGTGCCAAACAGCACTTCGGCTATAAATAAACTGCCAGCAAGCGGGGCACG
ATAGGCCGCAGCCATTCCCGCCGCGGCCCCACAGGCGATCCATAATTTCCACTCCTGGCG
TGGCGTAAAACGTTGGGCAAAACAGGAGGCGGCAAGGGCAGCTAAAAGAATCATCGCACC
TTCGCGACCAATTGCACTGCCGCTGGTTACTACCAGCAGAGAGGCAAGCGATTTAACCAG
GCTTGCTGCGTAATCGAACTGTCCATCGGTTTGCAACGCTTCCATATAATCGGTCGGCGC
ATGAGGGCGTTGTTGGGTAAATTTCTGCCAGCCCATCAGCAACAAACCCGCCGCCAGTCC
GCCGAGCGCCGGAGTTAGCAACCGTCGCCAGGGGGAAAGGTTTGTCGCTGCATTGACCAG
ACTGCCGGAGTCATTATTGAGGAACAACCACTCCAGTAGCAGCATCGCATGACGAAACCC
GGCAACGGCAAAGGCCGCGAGAATACCGACGACTGTTGCGATAAGCAGACGGTGGAACAT
AGTGCGCAGATCCGGATAGATGTGTAGATGATGCATGAGCAGAAATGGGCAATGAAACAC
GGGCGACTATTTTGCGGCAAAAGAGGCCAGCCGCAAAAGCAGTGCGTGCTTTAAGAGATA
AAAAAACGTGACACTGTAACCTATTATTGCCGGATTGCGCGTAATCGTCACCATCCGGCA
ATATTACGGTGATCCTATCGAAACAGCGGTTTAACCGCGACAGGAATTAACAGTTGTGAT
TGCCATTGCGCCAGCGTTAAGCGAGCCAGTTCACCCAGTGCACGGTAGAAAGGGTGTTCT
GCTTTTTCGATAAAAACATCAAGAAAACGTGTTGACCACGGAAAAAGGTGCCATGCCAGC
AATTCTTCGCATTCTGTCTGGCGACCATTCTCCGCCAACCACGCAGCCATCAACAGCAGT
GAACCAAAATGATCTTCCGGTTCGTTTTGCTTCATTTCAAACTGAATGCCTTTCTCGCGC
ATCCACTGACGAAGTGCCAATGTTGAATCGCCAAACAGCACAGATTCGCGATCCAGCCAG
ACCGACCCCCACGGCGGAGACGGCAGTGCCCACGGGCCGACAAACAAACGCTGCCAGGCC
TGGGCGTGAGTCTCTTCACACTGTGTCTGAAAAGCCGTCACCAGCGGCGCTAATGACGCT
TCTGGTAGAGGCCACTGAGTTTCCCAGCCGTCACTGGTGAGTACCGCAACCAGAGGTGCG
GCTTCCGCACTCTCTGGAGCGTAATAAAACAGCGCGCCCAACACGCGCGCCGCGACAGAA
AAATTATCTTGCTGTGAAAAATGGGTCATTCCTAACATCCTGAAATGTGCGGGTTGCCCC
GCACCAATTTGTTAACCTGCAATAGCCATTCCTACTGTCATGTGCAGGCCATAAAAGAGC
ACACGCCCGATCATCTCACCGCCAAGTATGAGGATTAGCCCCAGAATAAGTCCGGCAACG
TGAGGTTCACGGCGACGAATGAGCGGGCAAAGCCAGCATCCAAGACCTGCGCATAACAAT
ACCACACGCCAGACCTGTAAGGAGGCGTAATCTGGTACCAGTGCGCTGGCTTGTTGCACG
GATGAGTGAATAGACGCCAGAGACAAACCTTGCAGCACAATCACCCCGGCACAAGCGATC
AGCGCCAGAACGCTAATGATGGCAAATGGTGTGGTATTAAATGTAACGCGAGCTGCCCGC
AGAATTGCGGCAGCAAGTATTGGACCGCTCAACAATACCGTCAGGAAGAAAGCCAGCGTA
GTGTAACCGTTATGCCAGGTTGGCACGGTGTCGATTTGATACACGCAGGTCATCATCCAG
ACGAAAATGACGCCGAGCGCCATGCTGAAAAGTAACCAGAGTTTCCCCAACGCTTGCGGC
ATTTTACCGATGACTGCCACCAGCCACCATAATCCGCCAACGGCAAAAAATATGGAACCG
GCAGCAATCTCGTTACTCAGACCAGAAGCTCCGATTCGATTCAGGGAGTTAAACGCCCGC
AGTGGCGATCCCAGGTGCATGACAGAGGCAATAAACCCGACGCCCATCAACAGCCAGAGG
AAAAACATGCCACGGACAATACGCTGACGGTCTGCGTCATTTTTGGCGGCGAACCAGCCA
ATTCCGCTAACAATCAGCGCGCCTACTACGCATTGACCCAATACGGTAAAGATAACCAGT
GGCCACTCATGCCATCCATTTCCCATTTTACACTTCCTCCGGATTAGCCAGATAACCAGT
GGTATCGCCGGTCGGGCGGCTGTTGGCGTTAGGTTTGATAACGATATTGGGTTTTGTGAA
ATGCGCGCGCGGCAGTGGCGCGACGGCAGCAAGAGTGCCGTGCTTCTGGCGCAGCTCTTC
AATTGGACCGAACTCAAGTGCACGCAGCGGGCAGGATTCGACACATATGGGTTGTTTCCC
CTCGGCGACGCGCGAATAACAACCATCGCACTTCGTCATGTGCCCTTTTTCAGCATTGTA
CTGTGGCGCGCCGTACGGACAAGCCATGTGGCAGTAGCGGCAGCCGATACAAACATCTTC
ATCAACCACCACAAAGCCATCTTCACGCTTATGCATTGCGCCGCTGGGGCAGACTTTTGT
ACATGCGGGGTCATCGCAATGGTTACAGGAGATGGAGAGATAATAAGCGAACACGTTCTG
GTGCCAGACGCCATTATCTTCCTGCCAGTCGCCGCCAGCGTATTCATAAATACGGCGGAA
ACTGACTTCCGGGCCAAGATCTTTAAAATCTTTGCACGCCAGTTCGCAGGTTTTACAGCC
AGTACAGCGGCTGGAATCGATAAAAAATCCATATTGTGTGGTCATGGGCTACTCCTTAAA
CCTTTTCGATCTGGACAAGATTGCTGTGCGACGGGTTTCCCTTTGCCAGCGGTGAAGGGC
GGTGAGAGGTCAGAATATTGATACTGCCGCCGTGATCGACCCGGTCACCAAACATATCCG
CTTTAAGCCACGCACCTTGCCCGATGGCGGTAACGCCAGGCAGAATACGCGGAGTCACTT
TTGCGGCAATCAGCATTTCTCCATTATTGTTAAATACCCGCACGGTATCGCCATGACGGA
TACCGCGTGCCTGAGCATCAATGGGGTTGATCCACACCTCTTGTGGGCAGGCCTGCTGTA
ACACATCAATATTGCCGTAGCTGGAGTGGGTACGCGCTTTGTAATGGAAGCCCGTTAACT
GCAGTGGATAGGTTTTCCGCAGGGGATCGTCCCAGCCATCAAAACCTGGGGTATACGCAG
GAAGGGGATGAATAATTTCATCTTTTTTCAATTCCCAGGTATCTGCAATCTTCGCCAGTC
GTTCAGAATAAATTTCGATTTTCCCCGAAGGTGTTTTCAACGGGTTTGCCTGTGGATCTT
CACGGAATGCGCGGAAAGCGACGTAGTGTTCTTCCGGGCATTTTTTCTTAAAGATCCCGG
TCGTTTTCATCTCCTCGTAGTCGGGCATCTCAGGGTTACGTTCCTTCGTTTTCGCATGGA
GATATTTGATCCATTCATGCTGACTGCGACCTTCAGTAAAGGTTTGATAAACGTCTGGTC
CTAAGCGTTTGGCGACTTCACTCAGCATCCAGTAGATGGGTTTGCGTTCAAATTTTGCTG
AGGTTGCGGGTTGGGCGAGGATCACATAGCCCATATTCCCTGCAGATTCATGAGAGATAA
GGTCTTCTTGCTCTGTTGGCATCAGGTCGGGCAACAGGATATCGCAATACTTAGCCGAGG
CCGTCATGAAGTGGTCAATGCCAACAATCATCTCGCACTTGCTGTCATCCTGAAGCACCT
CATGGGTGTGATTGATGTCGCCATGTTGATTGATCAATGTGTTACTGGCGTAGCACCATA
AAAACTTGATGGGGACATCCAGTTTTTCTTTTCCACGAACACCATCACGGGTCGCGGTCA
TTTCCGTACCATGGTCGATGGCATCTGTCCATGTAAAGACGGAAATCTGCGTTTTAACAG
GATTCTCGAGCATCGGGAACCATTCTACCCCCAGATCCCAGCTACCTTCGCGTACGCCTG
AGTTGCCGCCGTTTATGCCGACGTTGCCGGTGAGAACGGAAAGCATGGCAATAGCGCGGG
ATGTTTGCTCGCCGTTGGAATGTCGTTGTGGCCCCCAACCCTGACAAATATAAGCAGGTT
TTGCTGAACCGATCTCTCGTGCCAACTGGATAATTTTTTCTGCCGGGATGCTGGTGATTT
TTGCTGCCCATTCCGGCGTTTTAGCTATGCCGTCAGGCCCTTCGCCCAGAATATAGGCTT
TATAATGCGCGTTACGTGGTGCGTTGGCGGGCAGCGTTTTTTCATCGTAACCAACACAAT
ATTTGTCGAGAAATGGCTGATCGACCATGTTTTCAGTAATCAGTACCCAGGCAATCGCAC
AGGCCAGTGCGCCATCGGTGCCAGGGCGAATGGGCAGCCATTCATCTTCACGCCCGGCAG
CAGTGTCGTTATAACGTGGATCGATGACGATCATGCGTGCGTTTGAACGTTCGCGGGCTT
GCTCGACGTAGTAAGTGACACCACCGCCGCTCATCCGCGTTTCTGCCGGGTTATTTCCGA
ACATAACGACCAGTTTCGTATTGGCGATATCATCCGGGCTGTTGCCATCATTGGCACCGA
ACATATAACTCATTGCGGCACTGATCTGTGCGGTACTGTAGCTGCCATAGCGACTGAGAA
AACCACCGCAAGAGTTCATCAGACGGTACGGGACGTTTGAGTTGGTGATGTTTCCGCCAT
CTACGCCTGTTCCGTACAGGACATGTACAGCCTCATTGCCGTAATCTTTCAGGATCCGCC
GAAGATTATCACTGATGGTATCCAGGGCTTCGTCCCAACTTATCCGTTCAAATTTACCTT
CACCGCGCTTGCCGACGCGCTTCATGGGATATTTCAACCTATCAGGATGATTCATCCGTC
GGCGGATAGAGCGCCCGCGTAAACACGCTCGAACCTGATGATTACCGTAGACGTCGTCAC
CTGTCGTATCAGACTCCACCCAGTACACGGTGTCATCTTTCACATGCAAACGTAACAGAC
AGCGGCTCCCGCAGTTAACGGTGCAGGAACTCCAGACCGCTTTCTCTTCTACCGGAGCCT
CTGCCGCCCGGACCATTTGGGAAAATGGCAGAGTGAAAGCACTGCTTGCCAGCGCAAGAC
TGCCAAGTGCGGAGGTTTTCATCAGACTTCTACGGCTGATTTCAGCCTTCATGAGCGCCT
CTGTGGTATGGATTTTCATCATTACTCACTTATTGCTTTTCAAACAAAATGTCATGCCAG
AATTTATGGTTGTCGTGGGTTATATTTTTTCGATCTCGACCAGATTAGTGTGCTGCGGGT
TTCCCTTCGCCAGTGGTGAAGGGCGCAGAGTGGTTAGCGTATTCACACAGCCGCCATGGT
CGATTTTATCGCCAGACATATTGGCCTCGTGCCAGGCTCCCTGGCCCATAGCGCTAACTC
CAGGGAGAATACGTGGTGTTACTTTGGCTGGTAGCCGAACTTCGCCACGATGGTTAAACA
CCCGCACCATATCGCCGTTGGCAATCCCACGTTTCTGCGCATCTATAGGGTTGATCCACA
CCTCCTGACGGCAGGCAGCCTTCAGGAGATCAATATTGCCGTAGGTCGAGTGAGTACGGG
ATTTGTAATGGAAACCAAACAGTTGCAGTGGGAAGGTTCTACGTTCAGGGGAGTTCCAGC
CTTCAAAGGTTGAGGCATAAACTGGCAATGGGCTTATCACTTCATCTTTTTCCAGTTCCC
AGGTACGGGCAATTTCCGCCAGCCTGCTGGAATAAATTTCAATCTTACCGGAAGGCGTTT
TAAGTGGATTTGCCTCGGGGTCGTCACGAAATGCTTTGTAGGCGACAAAATGGCCATTGG
GATCTTTACGCTTATAGATACCCATTTTTTTCAGTTCGTCGTAAGACGGTAACGCCGGAT
CTTTGGCAAGCATTTTGGCGTACAGATGTTGTAACCATTGTTCCTGCGTGCGACCTTCTG
TGAACTTTTGATAGACGTCAGGTCCAAGACGTTTCGCGACTTCACTCAGGATCCAGTAAA
TCGGTTTGCGTTCGAATTTTTCGCTGGTGACAGGCTGGAGGAAAATGAGATATCCCATGT
TACCGGCGTAGTCGTTAGGAATAATATCTTCCTGCTCAACGGTCATCAGGTCTGGCAGCA
GAATGTCGGCATATTTTGCCGATGAGGTCATAAAGTTTTCGATGACCACAATCATTTCGC
ATTTCGATTCGTCCTGCAGAATTTCATGCGTTTTGTTGATGTCAGAATGCTGATTAACGA
GGGTATTTCCCGCGTAGTTCCAGATGAACTTAATGGGCACATCCAGTTTATCTTTGCCGC
GGACGCCGTCGCGGATTGCCGTCATTTGCGGACCATGATCGATAGCATCTGTCCAGCTGA
AGCAGGAGATTGACGTTTTGACCGGATTATCCAGCACCGGCAGGCGTTCTATGGTAATGG
TATAGGTCGATTCACGCGCGCCACTATTTCCGCCGCTGATGCCGACATTGCCCGTCAAAA
TAGGTAACATAGCAATAGCGCGTGCAGTCAGTTCGCCGTTTGCCTGGCGTTGTGGCCCCC
AGCCCTGGCAGATATAAGCGGGTTTTGCTGTGCCAATTTCACGCGCCAGTTTGATGATAC
GGTCCTCCGGGATACCGGTAATTTGCGAAGCCCACTGCGGCGTTTTCGCTGTTTTATCGT
CACCTTCACCAAGAATATAGGCTTTATAGTGACCATTTTTGGGTGCATCTGCGGGTAAGG
TTTTTTCGTCATAGCCGACGCAGTATTTATCGAGAAAAGGTTGATCAACGAGATTTTCGT
TAATCAATACCCAGGCAATACCCGCAACCAGCGCGGCATCGGTGCCCGGGCGAATAGGGA
GCCATTCGTCTTCACGACCGGCAGCCGTATCGGTATATCGCGGATCGATAACAATCATTT
TGGCGTTCGATTTCTCGCGCGCTTTTTCAAGAAGATAAGTGATGCCACCACCGCTCATGC
GGGTTTCTGCCGGGTTGTTACCAAACATCACGACCAGCTTGCTGTTTTCAATATCCGTGG
TGCTGTTGCCATCATTACTGCCGTAGGTGTAGGGCATGGCACAGGAAATTTGCGCAGTGC
TGTAGGAGCCATACTGGTTGAGTGAACCGCCGTAGCAGTTCATCAGGCGTTTGACCGCCG
AGGCTGATGGCGAAGAGCGGGTCATATTGCCGCCAACGATCCCCGAAGAGTACTGAATAT
ATACAGCCTCATTGCCATATTGTTCGACGGTTTTCTTCAGGCTACTGGCGATAGTATCCA
GGGCTTCATCCCAGCTAATCCGTTCGAATTTGCCTTCGCCGCGTTTGCCCACGCGTTTCA
TTGGGTAATTCAAGCGATCGGGATGATTAATACGCCGGCGGATGGAGCGACCGCGCAAAC
AGGCGCGTACCTGATGGTTGCCGTACTCATCGCTGCCGGTATTGTCAGTTTCCACCCAGG
TCACTTCATTATCTTTAACATGTAGACGAAGTGCACAGCGGCTACCACAGTTGACGGAAC
AGGCACCCCAGACCACTTTTTCGCGGGCCTGTTGTACCGCTGCTGCTGCATTGCGCAGGG
TAAACGGCAAAGAAAAACCGCCTGCAGCCAGCGCCAGAGAACCTATCGCGGTAGATTTAA
CGAGTGTTCTGCGGCTGATGCCCACCATTCGTTCATTTTTGGACATAACTCACTCCCTGT
TCTTTATCGTTATATAAAAGTTTATATATTGAATATTTAGCGCGCTAACAATAGAGGGAG
TCTACCCATTTTGGGTTAAGAATTATTAATCCATATCAATAGAAGGGTATGAGTAATAAG
GTGGGATTATGTTGTATGTTCAAATCGCCGGATTTGTCATATCCGGCGTTCAGTCGATAA
TGTGTTACTGCGGTTCGGCAGGCGCGCCATCCTGGCTAGACTGCGCGGGAGCAGAGACGT
TACCGCTGGTGGTGCGGGTATAGAGAATTTTATGCGTATCATTAGCGCAATGGCCGACGA
CCTGGGAATCAGGCTGATCAACCTGGTCATTGGGTACAATACTTAACGTGAAGCTGCTTT
CGGGTACGCCATTATTGATAATGCGCTGTGATATATCGCTCTGTATGCGCTCACAGGATC
CCGGCGCGGCGAGTACCGCGGGTGAGGCGAGGGCGAGCAGAAGCGCGGCACAGCAGGTTG
AGAGTTTCATCATAAGCTCCTTACGCGAAGATAACTTCTTTAAGCATAGCATTTAACGTG
TAAAGTACTGTATTTGCTACTATGATTGAGAATCATCTCTACTCTCTGGTGACTGTTGTG
AAATACAAATTACTACCATGCTTACTCGCGATATTCCTCACAGGATGTGACCGCACAGAG
GTAACACTTTCATTTACCCCTGAGATGGCCAGTTTCTCTAATGAATTCGATTTTGATCCG
CTGCGTGGTCCGGTAAAAGATTTCACTCAGACATTAATGGATGAGCAAGGTGAAGTGACG
AAACGTGTTTCTGGGACTTTGTCGGAAGAAGGCTGTTTTGATTCACTCGAATTACTGGAT
CTGGAAAATAATACCGTGGTCGCTCTGGTACTGGACGCCAATTATTACCGTGATGCCGAG
ACGCTGGAGAAGAGAGTACGTTTACAGGGAAAATGCCAGCTAGCAGAATTACCTTCTGCC
GGGGTGAGTTGGGAAACCGATGATAATGGCTTCGTGATTAAAGCCAGCAGCAAACAAATG
CAGATGGAATATCGCTATGATGATCAGGGTTATCCGCTGGGTAAAACCACGAAAAGTAAC
GACAAAACATTATCTGTCAGCGCCACGCCATCAACGGATCCGATCAAAAAATTAGATTAC
ACAGCGGTTACTTTACTGAATAATCAACGGGTTGGTAATGTAAAACAGAGCTGTGAATAT
GACAGTCACGCTAATCCGGTGGACTGTCAGCTAATCATTGTTGATGAAGGAGTAAAACCC
GCCGTCGAACGGGTTTACACCATCAAAAATACGATCGATTATTATTAATGCTATTGTGCG
GTCGGCTTCAGGAGAGTCTGACCCGGTGTTTTGTGCTCTGCCAGATACTGATGCTGGAAT
ATACACATGCGAATGGCATTACGATATTGACCATTAATAAAGAACTCGTGCATCAATTCA
CCTTCAACCGAAAAGCCAAGCTTGCGGTAAATGTGAATCGCTTTTTCATTCTCTTTATCA
ACGATCAGATACAGCTTATAGAGATTGAGAACGGTAAAGCCATAGTCCATTGCTAATTTG
GCGGCACGGGTTGCCAGACCTTTCCCCTGATACTCCGGGGAGATAATTATCTGAAATTCT
GCGCGGCGATGAACATGGTTAATTTCCACCAGCTCCACCAGACCGGCTTTTTCGCCGTCA
CATTCCACCACAAAGCGCCGTTCGCTCTGATCGTGAATATGCTTATCATACAGATCAGAG
AGTTCAACAAAGGCTTCGTAGGGTTCCTCAAACCAGTAACGCATCACACTGGCGTTATTG
TCGAGTTGATGTACATAGCGTAAATCTTCACGCTCCAGCGGGCGTAGCTTAACACTGTGG
GCGCTTGGCATAACGTGTCCTTACATTCCTTAAATCAATAACAGGTTAGGGGGTAATAAC
GCGGCCAGTTCGACGGTCCAGGCAGCGCAAAGTATTGGGCTCCCAGTAGGCATTGATGTT
GGCGCTTTGCTCACATTTATCGCGGTTATCAAAAGCGGCGTCGGCTTTATCCCACTCTTT
TTCAGTGCGTTTATTCACTTTCTGGCGCAGATTGCGCGTGTCATTCCATTGCTCTTTTTC
CATAGCGGCGTGCTGGCGGCTTTGTGCACTGTCGCCAGACTCAATCACCAGTTTGTTAGT
TTCGGCATGAACAGTTGTGCTCAATGCCAGTGCGCAAGGCAGCAGAATAGCGAGCAGGCC
GATTCGTTTGCTGAGAGTGATTTTCATAATTCATTCCCTGTATGAATGATTAAAGGTGAT
TCTACACCATCCACTGCGGACGCAAAACGTACCAGGAGGGTGTTTATATTGATGATATTA
TGTCGCCCTATAACTATACATGATGTCAATAAGAGACAAAGATGATTAAAACAACGTTAC
TATTTTTTGCTACTGCGCTGTGTGAAATTATTGGATGCTTTCTGCCCTGGTTGTGGTTAA
AACGAAACGCCAGTATCTGGCTGTTGCTTCCGGCGGGGATTTCACTGGCGCTGTTTGTCT
GGTTGTTAACGTTGCATCCAGCGGCGAGTGGGCGTGTTTACGCGGCTTATGGTGGCGTTT
ATGTCTGCACGGCGTTGATGTGGCTGCGCGTTGTGGATGGCGTGAAACTGACTCTTTATG
ACTGGACGGGTGCGTTGATTGCGCTTTGCGGCATGTTGATCATTGTTGCGGGCTGGGGGC
GCACGTAGGAACATAAATCCATTTTATCAATAAGATAAGAGGAAGTGTCAGCTGACAAAA
GGTATTCTATTTCATCTTTTGTCAACCATTCACAGCGCAAATATACGCCTTTTTTTGTGA
TCACTCCGGCTTTTTTCGATCTTTATACTTGTATGGTAGTAGCTCAGTTGCGTAGATTTC
ATGCATCACGACAAGCGATGCAAGGAATCGAACATGAAGATCGTAAAGGCTGAAGTTTTT
GTTACCTGTCCGGGGCGTAATTTCGTCACATTAAAAATCACCACTGAGGACGGTATTACG
GGCCTTGGGGATGCCACCCTCAATGGACGTGAGCTTTCCGTGGCCTCTTATTTGCAGGAT
CACCTTTGTCCGCAGCTTATTGGTCGCGATGCGCACCGTATCGAAGATATCTGGCAGTTT
TTCTATAAAGGTGCTTACTGGCGTCGCGGTCCGGTTACGATGTCGGCCATTTCAGCGGTT
GATATGGCGCTGTGGGATATTAAAGCCAAAGCTGCCAACATGCCGCTTTACCAGTTACTC
GGCGGCGCGTCTCGTGAAGGGGTGATGGTTTATTGCCATACCACCGGTCACAGTATTGAT
GAAGCTCTGGATGATTATGCCCGTCATCAAGAGCTTGGATTCAAAGCCATCCGCGTGCAG
TGCGGAATCCCTGGTATGAAAACCACCTACGGCATGTCGAAAGGTAAAGGTCTGGCTTAT
GAACCCGCAACCAAAGGACAGTGGCCGGAAGAGCAGCTGTGGTCGACGGAGAAATACCTC
GATTTCATGCCGAAATTGTTTGACGCGGTACGTAACAAGTTTGGTTTTAATGAACATTTG
CTGCATGACATGCACCATCGCTTAACGCCTATTGAAGCGGCGCGCTTTGGTAAAAGCATT
GAAGATTATCGCATGTTCTGGATGGAAGACCCGACGCCTGCGGAAAACCAGGAATGCTTC
CGTCTCATTCGCCAACATACCGTCACACCCATCGCAGTGGGTGAAGTCTTCAACAGCATC
TGGGACTGCAAACAACTGATTGAAGAGCAACTCATCGATTATATCCGCACCACGCTGACC
CATGCAGGCGGAATTACCGGTATGCGCCGGATTGCCGATTTTGCTTCGCTGTATCAGGTA
CGTACTGGCTCACACGGTCCTTCCGATTTGTCACCAGTCTGCATGGCTGCGGCGCTGCAC
TTTGATCTGTGGGTCCCCAATTTCGGTGTCCAGGAATACATGGGTTATTCCGAACAAATG
CTCGAAGTCTTCCCGCACAACTGGACTTTCGATAACGGCTATATGCATCCGGGAGACAAA
CCGGGTCTTGGTATCGAATTCGATGAAAAGCTGGCGGCGAAATATCCCTATGAACCTGCT
TATCTACCAGTCGCACGTCTGGAAGATGGCACGCTGTGGAACTGGTAAGGAGTAAGATAA
TGAAAAGCATATTAATTGAAAAACCGAATCAACTGGCGATTGTCGAACGTGAAATACCCA
CCCCGTCAGCGGGTGAAGTACGAGTAAAAGTGAAACTTGCCGGAATTTGTGGTTCAGATA
GCCATATTTATCGTGGGCATAATCCTTTTGCGAAATATCCGCGCGTCATTGGTCATGAAT
TCTTTGGCGTCATTGATGCAGTGGGTGAAGGCGTGGAAAGCGCCAGAGTCGGTGAACGTG
TTGCTGTCGATCCGGTGGTCAGCTGTGGGCATTGCTATCCGTGCTCTATAGGTAAACCGA
ACGTTTGTACGACACTGGCTGTATTAGGTGTGCACGCTGACGGTGGTTTCAGTGAATATG
CCGTGGTTCCGGCAAAAAATGCGTGGAAAATTCCTGAAGCAGTGGCCGATCAATATGCGG
TAATGATCGAACCTTTTACCATTGCGGCTAACGTAACCGGACATGGTCAACCGACTGAAA
ATGATACCGTTCTGGTTTATGGTGCCGGTCCAATCGGCCTGACGATCGTTCAGGTATTAA
AAGGCGTCTATAACGTTAAAAATGTGATTGTTGCCGATCGCATTGATGAACGACTGGAAA
AAGCGAAAGAGAGCGGGGCTGACTGGGCGATTAATAACAGCCAGACACCGCTTGGCGAGA
TTTTCACTGAAAAAGGCATCAAGCCGACATTAATTATCGATGCGGCTTGTCATCCTTCTA
TCCTGAAAGAGGCCGTAACGCTGGCTTCTCCAGCGGCACGTATTGTATTGATGGGGTTCT
CCAGTGAACCGTCTGAAGTGATTCAGCAAGGAATTACCGGAAAAGAACTCTCTATTTTCT
CTTCACGCTTAAATGCAAATAAATTCCCGATCGTTATCGACTGGTTAAGTAAAGGGTTAA
TTAAACCAGAAAAATTAATTACCCATACGTTTGATTTCCAGCATGTTGCTGATGCCATTA
GTTTATTTGAACAGGATCAAAAACATTGCTGCAAAGTCTTACTCACTTTTTCTGAATAAT
ACCAATAACGGCGAGTAAGTAGTACGCATCTTACCTCTTTTTTAGAGATAACCATTATGA
CAATAGAAAAACACGAAAGAAGCACTAAGGATTTGGTGAAAGCAGCAGTATCGGGATGGC
TGGGCACTGCGCTTGAATTTATGGATTTCAAGAGTCATGCGTGTTAACTATTTGATAAAT
ATTAAATTAATTTTTCATTGCTTCGTTATGGGGCATGGTTGGGGCAAACTCGCTTAACTG
TGTATTTAACAAAGCTACCTGTGCATTATTGTTTTCAGACATCCATTTTCCGTATACCTG
AAATACCATTTGCGCATCTGCATGGCCCATCTGGTTTGCTATAAATGCCGGGTTAGCACC
AGCTGTCAGCGACCAGCAGGCATAAGTATGTCTCGACTGATATGATTTTCGATGGCGGAG
TCCGGCACGTTTTATCGCTGCGTCCCACATCTGCCTTATTGAGTCAACGGTAAAATGGTC
ACCATAATTTTTTACTCTCGCTGACACTTCAGGTTGAAAAACAAAGGTGCATTTTTGTTT
TTCTGTTCTGCCATACTCTCTGAAGTGAACATCAATGATATGCTCTTTGCTCAGTCTCGT
TAATGTCATCTGACTCCGGAGAGCGTCGATTGCTGGCTTAATAAGATGAATGACCCGATT
GGTTCCCGCCTGTGTTTTTGGTACCGTGAAACGGTCTTTTGCTAAATTTCTCCTGATCAT
CATTGTTCCATTTTTCAGATCTATGTCCTCCCATCCAAGTGCACACAGCTCACCAGGGCG
AACTCCAGTATAAACAGAAACACACCATAAATTTTTTGCTTGCTGATTTCTGCACGCATC
GATAAGACGGATAAATTCTTCCCGCGAAAGAGGATCCGGAATGGTTCTTGATTCCTTTAA
TGGCGAGATCCCCTTAAACGGATTATCTGCCAGGTAACCGTTATCAACACCAAACTGGAA
CACGGCGTTAAGATTTGTCATGTAATTATTTACAGTTACAGCCGATCTCCCTGGTTGTGT
AACAATATAGTTACTTTTGGGGATCTGGTATCCAGTCAGTAACTCTTTACGAACCTCCAG
TAATTTTTCTTTATTAATCGATGAGGCAAGATTTTTTTCACCGATTATGCTCAGGATATT
TTTGATGACGGCACGGTATGTGTTGAGTGATGTTTTGGCGACTTCAGTTTCTTTCAGTGC
CAGAAATTTTTCAGCCAGTTCTTTTATGGTTAAATCTTGTCGGGCCTCACCAAATTTTTC
CAGATTGCGTGAGGAGGGAAACTGTTTTGCATAGTCGAAAACACCAGTTTTTATTGCGTA
ACAAACAGAGGAGCGTAGTTCACCTGTGGATTTGCCCCTATATTTCCAGACATCTGTTAT
CACTTAACCCATTACAAGCCC
>seq2
CACGTTAAATCATATCAGGCGTAATACCACAACCCTTAAGTTAGCGCTTATGGGAATTAT
CCCCGGCTTTTTTATGTATGGTCTTACAGCACCAGTGCTGCGATTGACGCAGACAGCACA
CTCACCAGGGTAGAGCCGTAAACCAGCTTCAGACCGAAGCGAGAAACCACGTTACCTTGC
TCTTCATTCAGGCCTTTAACTGCACCTGCGATAATCCCGATTGAAGAGAAGTTAGCGAAG
GAAACCAGGAACACAGAGATGATGCCTTCAGCACGCGGAGAGAGCGTGGAAGCAATTTTC
TGCAGATCCATCATCGCAACGAACTCGTTGGAAACCAGTTTGGTCGCCATGATACTGCCC
ACTTGCAGTGCTTCACTGGAAGGAACACCCATCACCCATGCAATCGGATAGAAGATGTAG
CCCAGGATGCCCTGGAAGGAGATGCTGTAGCCAAACCAGCCAGTAACGGTGGCAAACAGT
GCGTTCAGCGCGGCGATCAGGGCGATAAAGCCAATCAGCATCGCGGCAACGATAATGGCA
ACTTTGAAACCTGCCAGAATGTATTCACCCAGCATTTCGAAGAAGCTCTGACCTTCGTGC
AGGTTGGACATCTGGATGTTTTCTTCACTGGCATCAACACGGTAAGGATTGATCAGCGAC
AGCACGATAAAGGTGCTGAACATGTTCAGTACCAGCGCAGCAACGACGTATTTCGGTTCC
AGCATGGTCATGTATGCACCAACGATGGACATCGACACGGTGGACATTGCCGTGGCAGCC
ATGGTGTACATACGATTACGGGAGATTTTGCCGAGGATATCTTTATAGGCAATAAAGTTT
TCAGACTGACCCAGAATCAGGGAGCTGACGGCGTTAAAGGATTCCAGTTTGCCCATGCCG
TTGACTTTGGAGAGCAGGAAACCAATTGCGCGGATGATCACCGGCAACACGCGAATGTGC
TGGAGAATACCGATCAGTGCAGAGATAAAGACGATTGGGCACAGCACTTTCAGGAAGAAG
AATGCCAGGCCTTGATCATTCATGCTACCAAAGACGAAGTTAGTCCCTTCGTTGGCAAAT
CCGAGCAGTTTTTCGAACATTTCGGAGAAGCCTTTCACGAAGCCTAAACCAACGTCGGAG
TTCAGGAAGAACCACGCCAGTAACACTTCGATAACAAGCAGTTGAATAACATAACGGATA
CGAATTTTTTTGCGGTCGCTGCTTACCAGCAGTGCGAGAATCGCAACAACGGCAAGTGCC
AGTACAAAATGAAGGACGCGGTCCATATTTGCTCCAAATATGAGGCAGGTTAAATTTCCG
TGCACATTCTATGTAACATGGTTAAGGAAAACGAGATCTGACACACACTATAATGACGTC
CTGTGACAGGCTTCAAAAATAGTGATCTGTCATACATTTCTGCTATGTTGTGTATGGAAG
CTGAAAGTTATGTAAATGTGCTAACATTAAACATAACCATAACATTCAAGTCATCAATCT
TTTCGTAGTCATAATCCTGGTCTATCAGAGAAATCACCACAATCCATTTAAATGAATTTG
ATAATCATTCTCGTTTGGCATAGCATGAAACATAGCAAAGGCTATGTTTTAGAGGCACAA
GATGACGAACTATCGCGTTGAGAGTAGCAGCGGACGGGCGGCGCGCAAGATGAGGCTCGC
ATTAATGGGACCTGCGTTCATTGCGGCGATTGGTTATATCGATCCCGGTAACTTTGCGAC
CAATATTCAGGCGGGTGCTAGCTTCGGCTATCAGCTACTGTGGGTTGTCGTTTGGGCCAA
CCTGATGGCGATGCTGATTCAGATCCTCTCTGCCAAACTAGGGATTGCCACCGGTAAAAA
TCTGGCGGAGCAGATTCGCGATCACTATCCGCGTCCCGTAGTGTGGTTCTATTGGGTTCA
GGCAGAAATTATTGCGATGGCAACCGACCTGGCGGAATTTATTGGTGCGGCGATCGGTTT
TAAACTCATTCTTGGTGTTTCGTTGTTGCAGGGCGCGGTGCTGACGGGGATCGCGACTTT
CCTGATTTTAATGCTGCAACGTCGCGGGCAAAAACCGCTGGAGAAAGTGATTGGCGGGTT
ACTGTTGTTTGTTGCCGCGGCTTACATTGTCGAGTTGATTTTCTCCCAGCCTAACCTGGC
GCAGCTGGGTAAAGGAATGGTGATCCCGAGTTTACCTACTTCGGAAGCGGTCTTCCTGGC
AGCAGGCGTGTTAGGGGCGACGATTATGCCGCATGTGATTTATTTGCACTCCTCGCTCAC
TCAGCATTTACATGGCGGTTCGCGTCAACAACGTTATTCCGCCACCAAATGGGATGTGGC
TATCGCCATGACTATTGCCGGTTTTGTCAATCTGGCGATGATGGCTACAGCTGCGGCGGC
GTTCCACTTTTCCGGTCATACTGGTGTTGCCGATCTTGATGAGGCTTATCTGACGCTGCA
ACCGCTGTTAAGCCACGCTGCGGCAACGGTCTTTGGATTAAGCCTGGTTGCTGCGGGGCT
GTCTTCAACGGTGGTGGGGACACTGGCGGGGCAGGTGGTGATGCAGGGCTTCATTCGCTT
TCATATCCCGCTGTGGGTGCGTCGTACAGTCACCATGTTGCCGTCATTTATTGTCATTCT
GATGGGATTAGATCCGACACGGATTCTGGTTATGAGTCAGGTACTGTTAAGTTTTGGTAT
CGCTCTGGCGCTGGTTCCACTGCTGATTTTCACCAGTGACAGCAAGTTGATGGGCGATCT
GGTGAACAGCAAACGCGTAAAACAGACAGGCTGGGTGATTGTGGTGCTGGTCGTGGCGCT
GAATATCTGGTTGTTGGTGGGGACGGCGCTGGGATTGTAGTTGAATGAGCGTCGCATCTG
GCACTATTGGCGGATGCGGCGTAAACGCCTTATCCGCCCTACGCGTTAAAGAGCCGGTTT
GTAGGCCTGATAAGACGCACTAGCGTCGCATCAGGCATTGTGCTCCATTGGCGGACGCGT
TTAATGGCGGTGCCCATGACCCCGGCCTTTTCCGCGATGATCGTCACGATCGCGCCAGCC
TTCACGATAGCCACGCTCATACGCTTTACGCTTATCCCAGCCACGGTGGTAGCCATTATC
ATGACGCCACCAACGGTTTTTGCGCCACTCATAATTGCGATGCCAGTAGTCACGGTCGCG
CCAGTGACCACCGTCCCAGTAATTACCGTAATGATCGCGATCGCCAATTTGTAATTTGAT
TGATGGCAGTAGGGTGATTTCACCTGCGTTTGCTGCAAGCGGGGTAAATGCCATCAGGGC
GGCCGCCAGAAACAGTGACCTGAACATTGTTATTCTCCTTCACGCTCGAAGCCGTCAGCG
GCCTGTTAACGCAATATTACGGGGAGGTAAAGCCCCGTATCATCGCCATAACTCTTAAAT
CATAAAGGAGAGCATTTTTTGCTAAACGTTATCGTGGGGTGGCTGTTGCTTCGGACGATT
GACCATCATCATCGGCTTACCTGCTAATAACAGCCATGCCGGAAGCATGACGATACAGAG
CAGCGGTAGCAATGTGGTATTGGGTACAACGACTGCCGCCATAAAAAGACTTAACCAGCC
ATCGCGTGTTACCACCAGCACGATGCCGAGAATAGCGCAAGAAACGGTTATTGCCGCTGG
TACGGCGGGAACGTGCTCATGCAGCATCAACCCTAATGCCACGCCGACAAACACTGCCGG
GAAGATTCGCCCACCGCGAAAGCCACTGGCGGCAGCAACGACCAGGGCGGCAAGTTTAAT
TACCGCCAGCAAAAAGTAATCGCTGGTGCTGAAAGCCTGATTTGCCACCATCTGCTGCAT
CTCATCCAGCCCTTTAAACAGCGAAACTGGTCCACCAATAACCCCCAGAATACCGAGAAT
AAATCCGCCAATACCCAGCACGAGCACCGGATTTTTCATTTGATGCATCATCGCGTGCAA
CCGTGGTAAGCACCATACGGCGACCATCCCTGCTGCGATGGCAATCGCCGCGACAATTGC
ACCGCTGAGAATATCGGTCATTTCCATCTGTCCGTAATGAGCAATGGGCAGTGAAAAATG
AGGATGGAAAAATAATCCGGTAGTAAGTGCACCAGCTGCTGCCGCCATTAACGGCGCAAA
GAGACGATCCCATAGCGGAACTTCACTACTGCCATTTAAGGTTTGCGAAAATATCAACGC
CGCCGCAACAGGAGTGCCAAACAGTGCGCCGATGGTTCCGGCAGAGGCTAAAATAGTCCA
CTCCATTCGGTTGACGCGCGGTAACAGACGAGCGCCAATGGCAACCGCAAGGGCGATATT
GACGGTCATGATCGGATGTTCCGGCCCCAGGCTGACGCCGCCAGCAAGACCGAGAATTAA
TGCTACGATAAGTCCAGGTAGCGCAGAGGGCGGAACCGGTGCGCCGATCAGCGGTTCACA
GGCGGGGTCTGGTCCGGCATGACCCTGGCTGAAACGGATAACCAACCCCACCGCAATACC
CGTTAGCGTTAATACACCGATGATCCAGAGGGGTGAATCCTGGGCTATCCCCAGAGTTCC
CGGCAGTCGTTGCCAGAGCAAATTCTGTAATACCGAGGCGATTTTCATCACCACAATCAG
AATAAGACTGGACGCAATCCCAATTGCCACGGCGGGGAGCGATAATAACAACATGGTTCT
GGCTCGCGGATGGAGCATGTTCTATTCCTTATGCGGGGTCAGATACTTAGTTTGCCCAGC
TTGCAAAAAGGCATCGCTGCAATTGGTGCTGAAACGATAAAGTAATTGTGTGACCCAGAT
CGATATTTACAGGGAGCCTGCCTTTCCGGCGTTGTTGTTATGCCCCCAGGTATTTACAGT
GTGAGAAAGAATTATTTTGACTTTAGCGGAGCAGTTGAAGAATGACAAAGTATGCATTAG
TCGGTGATGTGGGCGGCACCAACGCACGTCTTGCTCTGTGTGATATTGCCAGTGGTGAAA
TCTCGCAGGCTAAGACCTATTCAGGGCTTGATTACCCCAGCCTCGAAGCGGTCATTCGCG
TTTATCTTGAAGAACATAAGGTCGAGGTGAAAGACGGCTGTATTGCCATCGCTTGCCCAA
TTACCGGTGACTGGGTGGCGATGACCAACCATACCTGGGCGTTCTCAATTGCCGAAATGA
AAAAGAATCTCGGTTTTAGCCATCTGGAAATTATTAACGATTTTACCGCTGTATCGATGG
CGATCCCGATGCTGAAAAAAGAGCATCTGATTCAGTTTGGTGGCGCAGAACCGGTCGAAG
GTAAGCCTATTGCGGTTTACGGTGCCGGAACGGGGCTTGGGGTTGCGCATCTGGTCCATG
TCGATAAGCGTTGGGTAAGCTTGCCAGGCGAAGGCGGTCACGTTGATTTTGCGCCGAATA
GTGAAGAAGAGGCCATTATCCTCGAAATATTGCGTGCGGAAATTGGTCATGTTTCGGCGG
AGCGCGTGCTTTCTGGCCCTGGGCTGGTGAATTTGTATCGCGCAATTGTGAAAGCTGACA
ACCGCCTGCCAGAAAATCTCAAGCCAAAAGATATTACCGAACGCGCGCTGGCTGACAGCT
GCACCGATTGCCGCCGCGCATTGTCGCTGTTTTGCGTCATTATGGGCCGTTTTGGCGGCA
ATCTGGCGCTCAATCTCGGGACATTTGGCGGCGTGTTTATTGCGGGCGGTATCGTGCCGC
GCTTCCTTGAGTTCTTCAAAGCCTCCGGTTTCCGTGCCGCATTTGAAGATAAAGGGCGCT
TTAAAGAATATGTCCATGATATTCCGGTGTATCTCATCGTCCATGACAATCCGGGCCTTC
TCGGTTCCGGTGCACATTTACGCCAGACCTTAGGTCACATTCTGTAAATCCTTCCTTTTA
TATCGGGAGGTAACTCTCCCGATAATCTTTTAAATCATACAGTTTATTCAATTTTTCTTT
GTGTCCCCTCACAAGGTCGACCTGCGTCACACTTCCGTACAGCGGGATTAATTCTCCAGT
AAATGCATTATTTGTCTGGTAACGGCGATTTGTTTTGCACGTTCATAATTTCACTCGTCA
ACTATCACTGAACGAGGAATTAACGATGAGTAAGAAACTGATTGCCTTATGTGCCTGCCC
GATGGGCCTGGCTCACACCTTTATGGCCGCTCAGGCGCTGGAAGAAGCGGCGGTAGAAGC
CGGTTATGAAGTGAAAATTGAAACCCAGGGCGCGGACGGTATCCAGAATCGCCTGACGGC
GCAGGATATCGCCGAAGCGACCATCATCATCCACTCCGTGGCAGTTACCCCGGAAGATAA
CGAACGTTTCGAATCACGCGACGTTTATGAAATCACTTTGCAGGACGCAATTAAAAACGC
TGCGGGCATCATCAAAGAAATCGAAGAGATGATTGCCTCTGAACAACAGTAATATTCGAC
AGGGATAATTGTTATGGCCATTAAAAAACGCAGTGCAACCGTTGTGCCTGGCGCATCCGG
TGCGGCAGCGGCAGTTAAGAATCCGCAGGCCTCTAAAACCAGCTTCTGGGGTGAACTCCC
GCAGCATGTGATGTCAGGGATTTCACGCATGGTGCCGACCTTAATTATGGGCGGTGTGAT
CCTCGCTTTCAGCCAGCTGATTGCTTATAGCTGGCTTAAAATTCCTGCTGAGATCGGCAT
CATGGATGCTCTTAATAGCGGGAAATTCTCCGGTTTCGACCTCTCCTTACTTAAATTTGC
CTGGCTGTCGCAGTCCTTCGGCGGCGTGTTGTTTGGTTTTGCCATTCCGATGTTTGCTGC
TTTTGTGGCGAACTCTATCGGTGGCAAACTGGCGTTCCCGGCTGGTTTTATCGGCGGGTT
GATGTCTACCCAGCCGACGCAACTGCTGAACTTCGATCCCAGCACTATGCAATGGGCGAC
CTCTTCGCCGGTGCCGTCCACCTTCATTGGTGCGCTGATTATTTCTATCGTTGCCGGTTA
CCTTGTGAAGTGGATGAACCAGAAAATCCAGTTACCGGATTTCCTGTTAGCGTTCAAAAC
CACATTTTTGCTCCCGATTCTTTCCGCCATTTTTGTCATGCTGGCGATGTACTACGTCAT
CACCCCCTTTGGTGGCTGGATCAACGGCGGTATCCGTACTGTGCTGACTGCCGCAGGTGA
GAAGGGCGCGCTGATGTACGCAATGGGGATCGCCGCGGCGACAGCAATCGACCTTGGTGG
CCCGATCAACAAAGCCGCAGGTTTTGTTGCCTTCAGCTTTACCACTGACCACGTATTACC
GGTCACCGCTCGTTCTATCGCTATCGTTATTCCGCCGATTGGTCTGGGGCTGGCGACCAT
TATCGACCGTCGTTTAACCGGCAAACGCCTGTTCAACGCTCAACTTTATCCGCAGGGTAA
GACCGCCATGTTCCTGGCGTTTATGGGGATCAGTGAGGGTGCGATTCCGTTTGCGCTGGA
AAGCCCCATCACCGCCATTCCGTCGTATATGGTCGGCGCTATTGTCGGCTCAACCGCCGC
TGTCTGGCTGGGCGCAGTGCAATGGTTCCCGGAGTCCGCTATCTGGGCATGGCCGCTGGT
CACTAACCTGGGCGTCTATATGGCGGGGATCGCGCTGGGGGCAGTCATAACTGCGCTGAT
GGTGGTGTTCCTGCGTCTGATGATGTTCCGTAAAGGCAAATTGTTAATCGATAGCCTGTA
AGAAGGAAAATCCAGATGACATTACTCGCTTCGCTGCGCGACTGGCTTAAGGCGCAACAA
CTGGATGCAGTGCTTCTCTCCTCACGGCAGAACAAACAGCCGCATCTGGGGATCTCCACC
GGATCAGGTTATGTGGTGATTAGCCGTGAAAGTGCGCACATTCTGGTGGATTCGCGCTAT
TACGTTGAGGTGGAAGCCCGTGCGCAAGGCTACCAGCTGCATTTGCTTGACGCGACGAAC
ACGCTTACCACTATCGTCAATCAAATCATTGCCGATGAACAGTTGCAAACGCTCGGTTTT
GAGGGCCAGCAGGTGAGTTGGGAAACCGCGCACCGCTGGCAGTCTGAACTCAATGCGAAA
CTGGTTAGCGCCACGCCGGATGTGCTGCGGCAAATCAAAACGCCAGAGGAGGTGGAGAAA
ATCCGCCTCGCCTGTGGGATTGCTGATCGCGGTGCAGAGCATATTCGCCGCTTTATTCAG
GCGGGGATGAGCGAGCGCGAGATAGCCGCTGAACTGGAGTGGTTTATGCGCCAGCAGGGC
GCAGAAAAAGCCTCTTTTGACACCATTGTCGCCAGTGGCTGGCGTGGGGCGCTGCCGCAC
GGCAAAGCCAGCGACAAGATTGTTGCAGCGGGCGAGTTTGTCACTCTCGATTTCGGTGCG
CTGTATCAGGGCTACTGCTCTGATATGACGCGCACCTTGCTGGTGAATGGCGAAGGGGTG
AGCGCCGAATCTCACCTGCTGTTTAACGTCTATCAAATTGTCCTGCAGGCACAGCTCGCA
GCAATCTCCGCGATTCGCCCCGGCGTGCGCTGCCAGCAGGTTGACGATGCCGCGCGCCGG
GTCATTACAGAAGCAGGTTATGGCGACTATTTCGGTCATAACACCGGTCACGCTATCGGC
ATTGAAGTTCATGAAGATCCGCGTTTTTCACCGCGGGACACCACGACGCTACAGCCAGGC
ATGTTACTGACCGTGGAGCCGGGGATTTATTTGCCAGGGCAAGGGGGCGTGCGCATCGAA
GATGTTGTGCTGGTTACCCCGCAAGGCGCAGAAGTGCTCTACGCCATGCCGAAAACAGTG
TTGCTCACGGGAGAGGCATAATGGATTTATCGCTATTAAAAGCGTTGAGCGAGGCAGATG
CGATCGCCTCCTCGGAACAGGAAGTGCGGCAGATCCTGCTGGAAGAAGCGGATCGCCTGC
AAAAAGAAGTGCGATTTGATGGTCTGGGATCGGTGCTGATCCGCCTGAATGAATCGACAG
GTCCGAAGGTGATGATCTGTGCGCATATGGACGAAGTGGGATTTATGGTGCGCAGCATCT
CCCGCGAAGGGGCGATTGATGTGCTGCCGGTTGGCAACGTACGCATGGCTGCCCGCCAGC
TGCAGCCGGTGCGCATCACCACCCGTGAAGAGTGCAAAATTCCAGGCCTGCTTGACGGCG
ACCGGCAGGGGAATGACGTCAGCGCCATGCGCGTGGACATTGGTGCGCGCTCCTATGACG
AAGTGATGCAGGCGGGAATTCGTCCCGGCGATCGCGTCACGTTTGATACCACTTTTCAGG
TTCTCCCTCACCAGCGAGTGATGGGGAAAGCCTTTGATGACCGCCTCGGTTGCTATCTGC
TGGTGACGTTACTGCGCGAACTGCACGACGCCGAACTACCTGCGGAAGTGTGGCTGGTGG
CAAGTTCCAGCGAAGAGGTGGGATTACGCGGCGGGCAAACTGCCACCCGCGCGGTGTCGC
CGGACGTCGCCATTGTGCTTGATACCGCCTGCTGGGCGAAAAACTTTGATTATGGCGCGG
CTAACCATCGCCAGATTGGTAACGGGCCGATGCTGGTGTTAAGCGACAAGTCGCTGATTG
CGCCGCCAAAACTTACCGCCTGGGTCGAAACCGTGGCGGCAGAAATTGGCGTGCCGTTGC
AGGCAGATATGTTCAGCAACGGCGGCACGGACGGCGGGGCGGTGCACTTAACCGGCACCG
GCGTGCCCACAGTGGTGATGGGGCCAGCAACCCGCCATGGACATTGCGCCGCATCGATTG
CCGATTGCCGCGACATTTTGCAGATGCAGCAACTTTTATCTGCCCTTATTCAACGTCTTA
CGCGTGAGACGGTTGTTCAACTGACGGATTTCAGATGATCTCCTGATTAACCCGGAGCGG
TTATGTTAACGATTCAATTTCTCTGTCCTTTGCCTAACGGTCTACATGCTCGTCCGGCGT
GGGAACTTAAAGAACAGTGCAGCCAGTGGCAAAGCGAAATCACTTTTATTAACCATCGCC
AGAACGCAAAGGCAGATGCGAAAAGCTCGCTGGCGCTGATTGGCACCGGCACCCTATTTA
ATGACAGTTGCAGCCTGAACATTAGCGGCAGCGATGAAGAGCAGGCGCGGCGCGTGCTGG
AAGAGTACATCCAGGTGCGCTTTATCGACAGCGACAGCGTTCAGCCTACGCAGGCAGAAC
TGACGGCGCATCCGCTGCCGCGTTCATTAAGCCGCCTTAACCCGGATTTACTGTACGGCA
ATGTGCTGGCAAGCGGCGTCGGCGTGGGTACGCTGACCCTGTTACAAAGCGACAGCCTCG
ACAGTTATCGGGCAATCCCCGCCAGTGCGCAAGATTCCACCCGGCTGGAGCACAGCCTGG
CAACGCTTGCCGAGCAACTGAACCAGCAATTGCGTGAGCGTGACGGCGAAAGCAAAACTA
TCCTCAGCGCCCATTTGTCGCTGATTCAGGATGATGAATTTGCAGGCAATATCCGTCGCC
TGATGACAGAACAGCATCAGGGGCTGGGGGCGGCGATCATCAGCAATATGGAGCAGGTTT
GCGCCAAACTTTCTGCCTCTGCCAGCGATTATCTGCGCGAACGTGTTAGCGACATTCGCG
ATATCAGCGAACAGTTGCTGCATATCACCTGGCCGGAACTGAAGCCGCGCAACAAGCTGG
TGCTTGAAAAACCGACCATTCTGGTGGCTGAAGATTTAACCCCAAGCCAGTTTTTGAGCC
TTGATTTGAAAAATCTTGCGGGCATGATTCTGGAGAAAACCGGGCGCACCTCGCATACAC
TGATTCTGGCCCGTGCCTCGGCGATCCCGGTACTGAGTGGCTTGCCGCTGGATGCGATTG
CCCGTTATGCCGGGCAACCTGCAGTGCTTGACGCCCAGTGCGGCGTGCTGGCGATTAACC
CGAATGACGCGGTGAGCGGTTATTATCAGGTCGCGCAGACGCTGGCGGATAAACGCCAAA
AACAACAGGCGCAGGCTGCCGCGCAGCTGGCCTATTCCCGTGATAACAAGCGTATTGATA
TTGCGGCGAATATCGGCACCGCTCTGGAAGCGCCAGGCGCGTTTGCCAACGGCGCGGAAG
GTGTCGGGCTGTTCCGTACCGAAATGCTCTATATGGATCGCGACAGCGCGCCGGACGAGC
AGGAGCAATTTGAAGCCTACCAGCAGGTGCTACTGGCGGCGGGCGACAAGCCGATTATCT
TCCGCACGATGGACATCGGCGGCGATAAAAGCATTCCTTATCTGAATATTCCCCAGGAAG
AGAACCCGTTCCTCGGCTATCGCGCGGTACGTATTTACCCGGAATTTGCTGGCCTGTTCC
GCACTCAACTGCGGGCCATTTTGCGCGCCGCCAGTTTCGGCAACGCCCAGTTGATGATCC
CGATGGTTCACAGCCTCGATCAGATCTTATGGGTGAAAGGCGAGATCCAAAAAGCGATCG
TTGAGCTTAAGCGCGATGGCCTGCGTCATGCAGAGACGATTACGCTTGGGATCATGGTGG
AAGTTCCGTCGGTGTGCTACATCATCGACCACTTCTGCGATGAGGTCGATTTCTTCAGTA
TCGGCTCCAACGATATGACCCAGTATCTGTATGCGGTCGATCGTAATAACCCGCGCGTAT
CGCCGCTATATAACCCGATTACGCCATCGTTCCTGCGCATGTTGCAGCAAATAGTTACCA
CTGCGCATCAGCGGGGCAAATGGGTAGGCATTTGCGGTGAACTGGGCGGTGAAAGCCGTT
ATCTGCCGCTACTGCTTGGGCTGGGCCTGGATGAGCTGAGTATGAGTAGCCCGCGTATTC
CGGCGGTGAAAAGCCAGCTTCGTCAACTGGATAGCGAGGCGTGTCGGGAACTGGCGCGTC
AGGCATGTGAATGCCGCAGTGCGCAGGAAATTGAAGCGTTACTCACCGCCTTTACGCCGG
AAGAAGACGTTCGCCCACTGCTGGCGCTGGAGAATATCTTTGTTGATCAGGATTTTAGCA
ATAAAGAGCAGGCGATCCAGTTCCTGTGCGGCAACCTCGGCGTTAACGGGCGCACTGAAC
ATCCGTTTGAGCTGGAAGAAGATGTCTGGCAGCGGGAAGAGATTGTTACCACCGGCGTTG
GTTTTGGCGTAGCGATCCCGCACACCAAATCTCAGTGGATCCGTCATTCCAGTATCAGCA
TTGCCCGGCTGGCGAAACCGATTGGCTGGCAGTCAGAAATGGGCGAAGTCGAACTGGTGA
TCATGCTGACGCTGGGTGCTAACGAAGGGATGAATCATGTGAAAGTCTTCTCGCAGCTGG
CGCGTAAACTGGTGAATAAAAACTTCCGCCAGTCGTTGTTTGCCGCGCAAGATGCACAAA
GTATCCTGACGCTGCTGGAAACAGAATTAACCTTCTGACGTTAGCCCTGAAAACGGGCGC
TGTACTCTCCCGGCGTCAGACCAAACTGACGCCGGAAAACGCGACAAAAATAGTCGCTAT
CCGGAAAACCGCAACGCTGTGCCACTTCATGAATTGACAGATGATATTTCTGCAAAATCA
TCCTCGCCTTCGCCATTCGCACCCAACGCACATACTCGATAAAACGCATCGTTCCATGCT
GAGCAAACAGTTTTGACAGATGATTGGGCGTGATATTAAAAAACTGCGCCACGCTCTCGC
GGGTGAGCGGCTGGGCATAATTATCCTGAACCCAGTTACAAATGCTGTGATAGAGAAAAT
CGCCGCGCGGCTGCGAATTGCCCGGCGGCATATTCACCACGCTACGGCAAAGATGCAGCA
AACTTAACACCAGCGGCTGAATGATATTTTGCTCCAGCGGCGAACGGCTAAGATGGGTGA
GGGCGGTAAGCATCGCTTCACCTTCACCGCGTTGCAGGCTGGGAAGCTGGATCTGGCGAG
CAGGATGCAACAACGACGTGGTGCGGCTATCGTAAAACGATAACCCAAGCCAGGTCGGAG
CGAACACCAGGCTTAACAGCATCACCGGTTTGTTGTTGACCGGTAAATTAGCCGCGCGCG
CCGGAATAAACAGCATTTCTCCTTCCACCAAACGTTGCTGCTTTGCTTCCAGCAGATTGC
CGTATTCGCCGCGCAGCACGATATCCAGACGGGGAAAATCAATACATAAACTGCCCACCG
GCAACGAGGCAGGCTGGCTGGCAAACCAGACGCGCCCCAGTAGTTGCGGGTTAAGCACCA
GGCCGCTGAACAGATCGGCGAAAAATTGTTGATCGGCGGGCAAGCCTGGTGCTTTCATGA
AAGTTCCCGATTAAAGATGCATTAACTGGCGAAATTCTTTCACTTTGCTGCGGCTGACCG
GCACTTCAAAATCCAGATCTTTCAGTCGCAGAATGTAGGTGTTATTAAACCACGGTTCGA
TTTCGCGTATTTTGTTCAGATTGACACAAAATGAGCGATGGCAGCGGAAAAAATGCGACG
GCGGCAGTTTGCTGCAAAATTCGGTAATGTTCATCGGCATTACGTAGGATTCACGCCGCG
TATAGACAAAGGTCATTTTCTCGTGCGCTTCGGCGTAATAGATATCGTTAATTGGCGTGA
CGATTATTCGCTCATCTTTCACCAGATTAATGGTGTCATTCTCACGCGTTACCGTCGCGG
CAGGCGTACTGCTGGTCTGCTGTTGTTGCCAGGCCGCTTCCAGTTTTTGCAGCATCCCGG
TAATACGTGACTCCTGATACGGTTTGAGAATGTAGTCAAACGCCTCCAGTTCAAACGCTT
CTACCGCATGTTCTTTCCACGCGGTGATGAACACAATAAACGGTTTATGGGCGAACTGGC
TGATGTTTTGCGCCAGCAACACGCCATCCAGCGACGGAATATTGATATCCAGAAAAATGG
CGTCGACGCGGTTATGCTGCAAAAACTTCAACACGTCCAGACCGTCGTCAAAGGTGCCGA
CAATCTCCATCTGGCTGTGCTCTTTAATTAGCCAGCTCAGTTCCTGTTGTGCCAGGAATT
CGTCTTCAACAATGATGACTTTCACAATATCACTCCGGCTCAAAGCAATAACGTAGCCTG
TGAGGCGACTGGGGTGCGTTGGTTAGGAATGTAAAACGCAATTTCCGTCCCCGGCTCCAG
GCGGCGGATATGCAGCCCCTCGCCATACAATAACTTCACGCGATGATGGACATTCAGCAG
GCCAATTTTATTGCCCGGCATTTCATTCGCTTCGACCCGCTCAATCACCTTTGGATCGAT
GCCGTGCCCGGTATCTCGCACCGCAATGCGTACCCGATTTCCGCACTCTGCAACGCTGAT
GGTGACAACGCCTTTACCTTTGCAAGGCTGAATACCGTGGACAATGGCGTTCTCCACCAA
CGGCTGGATCAGCAGGCTGGGAATGCAGCAATTCACCTCTTCATCAATATCATAGATAAC
CGTCAGCTTGTCACCAAAGCGGGCCTGCTCAATGGCAATATAGTCTTTAATTTGATACAG
CTCTTTTTTGATATCGATTTGCTCATCGTCTTTTAATTCAATGTTATAGCGCAGATAACG
CGACAGATTAAAGATCAACTGGCGAGCGGTATCCGGATTCAGACGGATTGACGATGAAAT
AGCGTTCAGAGCGTTAAACAGAAAATGGGGATTAATTTTGCTTTGCAGGGCGCGAAGCTC
TGCCTTATTTGCCATTTCACGTAGCTGCTCGGCGCGTGAAACCTCCAGTTGCGTGGAGAT
GATTTGCGACAGACCGACCGCCATTTCCTGTAATGACGAGGTGATCTGATGCGCGTGGCA
GTAGTAAATTTTCAGCGTTCCGGTCACGACCCCTTTCTCCCACAATGGGATCACCAGCAT
GGAATGAATCTCTGGTGTGCGGTGGGCTTCATCATTGTTTTTAATGATGATTTTTCCGTA
ATTCATCGCCTGACGGGTAGTCGGGCTAATGAAGTCATCGCCATTCTGATAGTTATGTTC
ACCCACGCCAACATAGGCCAGCACATGATCGGTATTAGTAATCGCCACCGCATCGGCGTG
AATGTCATCGCGGATAATTTCGCAGACCTTGCGTAATGACTCGCTATTGACATGGCGAAA
CAGCGGTAGCGTTTTGTTGGCGATATCCAGCGCCAGCTTGGCCTGCCGCGCGGCGCTGGC
CTCTTTTTCGCCCTCAACGCTTTGCACCAGAAGCACAATAAAGCCGATACAGACGCTACC
GAGGATCATTGGAATGCCGATTTTAGAGACGATATCGATCCCCAACGCGGTAGTTGGTGC
CCAGACAATTACCAGAATCATGGTCAACGTCTCACACAACATGCCGCCGAGAATACCGAC
GCGCCAGCGCTGTGCTTTGGGGATTTTCAGGTTGATCCAGCCCGATATACAACCCGCCAG
AATGCTGGTGATAAAGCAGGGGATCGCCGTCACGCCGCCGATATCAATTAAATACCGGTG
AATACCCGCAATCACGCCGGTAATGATGCCTACCCACGGGCCAAACAGAATCCCGCCGGA
CATCACCGCGATAATACGTACGTTCACCAGCGAGCCTTCTACGGGAACGCCGGACCAGGT
GCTGAACAGGGCGAACAGCGAGAAAATGGCGGTAACGGCGAGCAATTCTTTTGGGGAGTG
CGCCGACTTGTGCAACAGTTCGCGAAACAGGCGGATACGGATGAGAAAGAACAGGCAGAT
AAGCATTAACGCTGCCCGATCGAAGACCGCCAGCAGCATGTTGAATATTTCGTGCACGGG
TGACTCTGAATAAGGATTAAACCTCTATGATAGGTAACCTGAAGGCTGATGACCAGCAGG
CCGTTTTTGAGGAAAAACCACAATTTTAAAAGGGGATTGATAGATAAATGGTGTATTAGC
AATGCATCTCTTGATAATGCACTTCTGGTTAGTAAATTTATTGAAATTATTATGTTAATA
AAATGAGTGGTAATTTTCTTGTTAGCGCAGATAAATTTCCTGTTTTTAAAGCAGAGTTCC
TCATTTAACGTCATTAATAAAATGTTCTAAAACGCTGGACAGACAGAAATTAATCAGGCT
ATTTTCAAAACAGCCACCATCGTGGCAGCGTCGCTCGGACGGTCCGGGCGCTAACGTTAA
TCTGAGGAAATTATGGCTGACACTCGCCCTGAACGTCGCTTTACGCGCATTGATCGTCTC
CCGCCCTACGTTTTTAACATCACCGCTGAACTGAAAATGGCTGCGCGTCGGCGCGGCGAA
GATATTATCGATTTCAGCATGGGTAACCCGGACGGTGCGACTCCGCCGCATATCGTCGAA
AAATTATGTACTGTGGCCCAGCGCCCGGACACGCATGGTTACTCCACTTCACGCGGCATT
CCGCGGTTACGTCGCGCCATTTCCCGCTGGTATCAGGATCGCTACGACGTTGAAATCGAC
CCGGAATCAGAAGCCATCGTCACTATTGGTTCGAAAGAGGGCCTGGCGCATCTGATGCTG
GCGACGCTGGATCATGGTGACACGGTGCTGGTGCCGAATCCAAGTTACCCGATCCATATT
TATGGCGCGGTGATTGCCGGGGCGCAGGTACGCTCAGTGCCGCTGGTGGAAGGTGTCGAT
TTCTTCAACGAACTGGAGCGAGCCATTCGTGAAAGTTATCCGAAACCGAAGATGATGATC
CTCGGCTTCCCGTCAAACCCAACCGCGCAATGCGTGGAACTGGAGTTCTTCGAAAAAGTA
GTGGCGCTGGCGAAACGCTACGATGTGCTGGTGGTCCATGACCTGGCCTATGCCGATATC
GTCTACGATGGCTGGAAAGCGCCGTCAATTATGCAGGTACCGGGTGCACGCGATGTGGCA
GTCGAGTTCTTTACGCTGTCGAAAAGCTACAACATGGCGGGCTGGCGTATCGGCTTTATG
GTTGGCAACAAAACGCTGGTCAGCGCCCTGGCTCGTATTAAAAGCTATCACGATTACGGC
ACCTTTACGCCGTTGCAGGTGGCGGCGATTGCGGCGCTGGAGGGCGATCAACAGTGCGTG
CGCGACATTGCCGAACAGTACAAACGCCGCCGTGATGTATTGGTTAAAGGGCTGCATGAA
GCGGGCTGGATGGTTGAAATGCCGAAGGCTTCGATGTATGTCTGGGCGAAAATCCCGGAA
CCATATGCGGCCATGGGATCGCTGGAATTTGCCAAGAAGCTCCTTAACGAAGCGAAGGTT
TGTGTCTCGCCGGGGATTGGCTTTGGCGACTATGGTGATACGCATGTTCGCTTTGCACTG
ATTGAAAACCGCGACCGTATTCGTCAGGCCATCAGAGGGATTAAAGCGATGTTCCGTGCC
GACGGTTTACTACCCGCCAGCAGCAAACATATTCACGAAAACGCGGAATAAACACCGTCG
TCAGAAATGCAAACAGGAGCCTGATGGCTCCTGTTTTTCATTGCACAGTTTGCTTTTAGA
TCATCAGGGCAAAAGTACCGGCCCAAACGATGACCATAAAAGAAATGCCCATAAAGAAAT
ATTTCACTTTACATCTCTCCGCGTAATTACTGTTACGCCTGAATGACTTCATTACACCTG
ATACAGTGAGTTGACACCGGGCAAAGCGACCTTAAAAGCCCTGTATTTTACCGTGGGCAT
CACCCCAGAATTCTGAGCTAAACTGCTCGAGACGGCGCTAATGTACGCCTAAAACTGAAA
CGAGACAAGAGGCATTTTCTTATTTACTTTTAGTAACTTACAAGTGTCTCATATCGGCGA
CAGTTTAATTTCTGACGGTAATAATTAGATATTCAGCGAAGGAAAAAACCTTAAGAAAAA
AGCCATAAAAACCATGAGGTTATTATGGCCGATTTGAGGAGGGAAAGAGTAAGAGCAGTT
TGTTAAATGTACAACGACGATTCTCCCACCGGGCGCGTTTTAAAGCGACGGTGGATCCAG
AGGTACTGCTCCGGTGCGCGCATGATCTCTTTCTCGATAATCTTGTTCATATAGGCAGCG
GCTTGATTTTCATCTGTCGGGTAGCCTTCCATCTCTGGGGTGATGAACAAACGATATCCG
CTGTAATCCGCTTTTCTTACCATCGTTACGGTCAACATGGCTGCGCCAGAGAGACGGGAG
AGAACATAGGTGCCATTGGTTGTGGCGACATTTTCCACCGCAAAGAACGGCGCGAAGGAG
CTGCCTTTACGACCATAATCCTGATCGGGAGCAAACCATACCGCTTCACCTTTCTTCAGT
GCACCGACAATGCCGCGCAGATTATTTCTGCCGATCATCGCTTTGTTAGAGCGCATGCGC
CCACGGGTCTGCACCCATTCCATCAGCTGATTATTATGTGGACGATAGGTAGCCATCATT
GGTTGGCACAGTCCCATCACGCGGCCGCCCAGTTCCAGCGACATAAAATGGACGCCGACA
ACCATTACGCCGCGATTTTGCATTTGTGCGCGTTTAAGGTTATCCAACCCTTCAACATCA
AACCATTTACGTACGCGACTGTCGGGCCAGAACCATGCCATGCCGGTTTCTACCAGCGCC
ATGCCGAGTGAACGAAAGTTTTCGGCAATCATCTTCTCGCGTTCTTCCGCAGAATGCTGC
GGGAAACAAAGTTCCAGGTTTTTACGGGCGATAGATTCACGACGTTTCAGGAATGGTCGC
GCCATTGCGCCAATACGCGTGCCGAGAAAGCAGAGAACAGGATAAGGAAGCTGTACCCAA
AGCCAGAGTACACCAAGCCCAAACCATGTGAGCCAGTAGCGAGGATGTAGAAACTCGCGG
GAAAATTTGCATTGTGGAAACATAGTTACCTTCTGTAGATACGAATTGTTGTATCGCAGA
AGATTCCATGTCGACAGCGGTACACTCAATTGGTTGGGCCATCATGTACGACAATGGTTC
CTGTAAAGAGTGTAAAGACTAGTCAGGACATAACCACGAGGAGCATGAATGCGGTATCTG
TACTTTATCACTCGCTGACTGCTTTCAGCTACTGATTATTAATCGTGCAAAGTAAATATT
TTTCCGTACACAACAGTCTTGCATTTAACATGCTGTTTTCATTGATGCTTAGCAAAAATT
GCCAGAGGTTAAGGATTGTCTTACTATTAAAGTGACTGAAGTTACAGGTTTTTTAGCGCG
GCAGGAGGTTGAGCTATGATTAATTTATGGATGTTTCTCGCCCTGTGTATTGTCTGCGTA
AGCGGCTACATCGGTCAGGTACTGAACGTGGTATCGGCGGTCTCTTCTTTCTTCGGCATG
GTGATCCTCGCTGCACTCATTTATTACTTCACCATGTGGTTAACTGGCGGTAATGAACTA
GTGACGGGGATATTTATGTTTCTTGCCCCGGCTTGTGGCTTGATGATTCGCTTTATGGTG
GGGTATGGCAGGCGGTAGTGGGTCAGGATGGCTCATTTGGGCAGGTGTTCACATCAGCAT
CAGACATGATTGTTCACCTGCCATGTGAAAGACGCTATCGCACAGGATGAATAAGATAAT
TCGCCTTTGTCGGAAAAGGGGGCGGCATTTCTTCTGTGAGGTTTAATGGTGGCGCATCTT
CTCTCATCTTAAACAAAATCGCCTGTGATGGCTGAAGTTTTGTAGAGTGTGTGGTCGTCA
TCGCTGATGTTTTTTCAGTCTCTTTATAGCTCCTCTCACTTCCACCACCCGAAATGGAAA
ATGCAAAAACATTGCATGCCATAATAGAGACCAATAAAAATAAGCTGAAAAGTATTAAGT
TTACTTTCATAGAAAGTTATCCTGAAAATGGTTCACTGAGAACCTACGATGTTATGGCTG
TATTTACATTTAATTAATCAGTATTTACATCGATATAATAAATGACATCTCTTTGTGGTA
TATAAGAATAGTTCTCTGCGACAGGAAGCATATTCCTACAATTGTAAGACTAAAATACTT
CTTGCGATAATAACTACAACTGTAAGATAACCCTTTCAAAATGACCGTTGCTCTCTGATT
TCTCATTTCATGCTCACCCAATATGATGGCGGCGTTTTCTAAAACTGTTAAAGAATGAGG
TAAGTATGAAACGTTTAATTATGGCCACGATGGTCACAGCAATTCTGGCATCTTCAACTG
TATGGGCTGCTGATAATGCTCCGGTAGCGGCACAACAGCAAACTCAGCAAGTTCAGCAAA
CCCAGAAAACGGCAGCGGCAGCAGAGCGTATCTCTGAACAAGGTTTATATGCGATGCGTG
ACGTGCAGGTAGCGCGCCTGGCTCTGTTTCATGGCGATCCAGAAAAGGCAAAAGAACTGA
CCAATGAAGCTTCCGCTTTGCTGTCAGATGACAGTACCGAATGGGCAAAGTTCGCTAAGC
CAGGTAAAAAGACCAATCTCAATGATGACCAATATATTGTCATTAATGCATCTGTCGGAA
TTTCTGAGAGTTATGTAGCAACTCCCGAAAAAGAAGCCGCGATAAAAATTGCCAATGAAA
AAATGGCGAAAGGGGATAAAAAGGGCGCAATGGAAGAGCTTCGCCTGGCCGGTGTTGGCG
TAATGGAAAACCAATATCTGATGCCACTTAAACAGACTCGTAATGCACTTGCTGATGCGC
AGAAACTGCTTGATAAAAAGCAATACTACGAGGCAAACCTGGCGCTTAAAGGTGCGGAAG
ATGGAATCATCGTCGATAGCGAAGCACTGTTTGTGAACTAATGCTGACAGGCAGTATATT
GAGGTAAAGGATTTAACTCCCTCCAGCCGACAATTTTTTATGACCACAATACGACAGGTT
GTGGTCATAAAATTATTTGGCGCTCGCGGTGCTATAAACTCGCATTTTATATTCCTCAAA
GTAAACCGCAATAATCCCGTGTCATCACAAATCATTTATTATGTTATGTTTTATGGTACG
CTTTAAAAAGCGTAATCATACCCTTGCTTGTAAATCACCGGCGCTTCTTACAGTTGTAAG
AATAACATCACAAATGTCGCGACTCTCTCTGATTACCACGAATCAATATTTATCATATTC
TTCTTTTCGTCCTCACTACTTACCATGCAGAAAGGAATTGGAAGTGGCGATGAAATGATT
TTCAGCACTTGATACAGGATTTTAAAAATATCGAGTGCAGCTACGACGATATTTTGCGGG
TTATTTATAGAAGATATTACGCCTTAAATAAACGCTAAATTAACACATATTTAATTAACT
AATAGGTATTGCTATGTCAACTCCACTTCAAGGAATTAAAGTTCTCGATTTCACCGGTGT
GCAATCTGGCCCATCTTGTACTCAAATGCTGGCCTGGTTTGGCGCTGACGTTATTAAAAT
TGAACGTCCCGGCGTTGGTGACGTAACGCGTCACCAGCTGCGAGATATTCCTGATATCGA
TGCGCTTTACTTCACCATGCTTAACAGTAACAAACGTTCTATTGAGTTAAATACCAAAAC
AGCGGAAGGCAAAGAGGTAATGGAAAAGCTGATCCGCGAAGCTGATATCTTAGTCGAGAA
CTTTCATCCAGGGGCCATTGATCACATGGGCTTCACCTGGGAGCATATTCAAGAAATCAA
TCCACGTCTGATTTTTGGTTCGATCAAAGGGTTTGATGAGTGTTCGCCTTATGTGAATGT
AAAAGCCTATGAAAACGTTGCTCAGGCAGCGGGTGGCGCGGCATCCACTACGGGTTTTTG
GGATGGTCCGCCGCTGGTAAGCGCTGCAGCGTTGGGTGACAGCAACACCGGAATGCATTT
GCTGATCGGTTTACTTGCTGCTTTGCTGCATCGCGAAAAAACGGGGCGTGGGCAACGAGT
CACCATGTCAATGCAGGATGCCGTATTGAACCTTTGCCGCGTGAAATTACGTGACCAGCA
GCGTCTCGATAAATTGGGTTATCTGGAAGAATACCCGCAGTATCCGAATGGTACATTTGG
TGATGCAGTTCCCCGCGGTGGTAATGCAGGTGGTGGCGGTCAGCCTGGCTGGATCCTGAA
ATGTAAAGGCTGGGAAACCGATCCTAACGCCTATATTTATTTCACTATTCAGGAGCAAAA
CTGGGAAAACACCTGTAAAGCCATCGGCAAACCAGAATGGATTACCGATCCGGCATACAG
TACAGCCCATGCACGACAGCCACATATTTTCGATATTTTTGCTGAAATCGAAAAATACAC
TGTCACTATTGATAAACATGAAGCGGTGGCCTATTTGACTCAGTTTGATATTCCTTGTGC
ACCGGTTTTAAGTATGAAAGAAATTTCACTTGATCCCTCTTTGCGCCAAAGTGGCAGTGT
TGTTGAAGTGGAACAACCGTTGCGTGGAAAATATCTGACCGTTGGTTGTCCAATGAAATT
CTCTGCCTTTACGCCGGATATTAAAGCTGCGCCGCTATTAGGTGAACATACCGCTGCTGT
ATTGCAGGAGCTGGGTTATAGCGACGATGAAATTGCTGCAATGAAGCAAAACCACGCCAT
CTGATATTAACGGGGGCTTCTGGCTCCCAATTTATAAAAATTTCGAGGTTATTAATCATG
TCAGATCAACTTCAAATGACAGATGGTATGCATATCATCGTTGAAGCATTAAAACAGAAT
AATATTGACACTATTTATGGTGTTGTAGGTATTCCTGTGACGGATATGGCACGCCATGCC
CAGGCGGAAGGCATTCGTTATATTGGTTTTCGTCATGAGCAGTCGGCAGGCTATGCCGCT
GCGGCAAGCGGTTTTCTTACCCAAAAACCGGGGATCTGCCTGACAGTTTCTGCGCCAGGA
TTCCTCAATGGTTTGACCGCATTGGCCAACGCAACGGTAAATGGTTTTCCGATGATCATG
ATTAGCGGCTCCAGCGACCGCGCGATCGTCGACCTACAGCAAGGTGATTATGAAGAGCTG
GACCAAATGAATGCGGCAAAACCGTATGCCAAAGCAGCATTTCGCGTTAATCAGCCGCAG
GATCTTGGCATTGCATTGGCACGCGCTATCCGGGTCTCTGTATCGGGTCGCCCTGGCGGA
GTTTATCTTGATTTGCCAGCAAATGTCCTGGCCGCGACGATGGAAAAAGACGAAGCGTTA
ACCACGATTGTTAAAGTTGAAAATCCGTCGCCAGCATTATTGCCATGCCCGAAGTCAGTC
ACTAGCGCAATTTCGCTTTTAGCAAAAGCTGAACGGCCATTAATTATCCTTGGCAAAGGC
GCGGCGTATTCACAAGCTGATGAACAGCTTCGTGAATTTATTGAAAGTGCTCAGATTCCA
TTCCTGCCAATGTCTATGGCGAAAGGGATCCTTGAAGATACGCATCCACTTTCTGCGGCA
GCTGCGCGTTCGTTTGCCCTGGCAAATGCTGACGTTGTCATGCTTGTTGGTGCACGACTG
AATTGGTTATTGGCACACGGTAAAAAAGGATGGGCGGCAGATACACAGTTTATTCAACTG
GATATTGAACCGCAGGAAATTGACAGCAACCGCCCCATTGCTGTGCCAGTCGTTGGTGAT
ATTGCATCCAGTATGCAAGGTATGCTGGCAGAACTGAAACAAAACACATTTACGACTCCA
CTGGTATGGCGCGATATTTTAAATATCCACAAGCAGCAAAATGCACAAAAAATGCATGAA
AAATTAAGTACAGATACTCAACCATTAAATTACTTTAATGCATTAAGTGCTGTGCGCGAC
GTATTGCGCGAGAACCAGGATATTTATTTAGTTAATGAAGGTGCAAATACCCTGGATAAT
GCACGAAATATTATTGATATGTATAAACCACGTCGTCGTCTGGATTGTGGTACCTGGGGT
GTCATGGGCATCGGTATGGGCTATGCCATCGGTGCTAGCGTGACTTCTGGTTCTCCGGTT
GTCGCCATTGAAGGTGATAGTGCTTTTGGTTTCAGTGGGATGGAAATTGAAACGATTTGT
CGATATAACCTGCCGGTGACGATCGTTATTTTTAATAATGGCGGCATCTACAGAGGAGAC
GGTGTTGATCTCAGTGGCGCTGGTGCACCATCACCAACGGATCTGTTGCACCATGCAAGG
TATGACAAATTAATGGATGCGTTTCGTGGCGTTGGCTATAACGTCACCACGACAGATGAA
CTTCGTCATGCTTTAACCACCGGTATTCAGTCGCGCAAACCGACCATTATTAATGTGGTC
ATCGACCCTGCAGCAGGAACTGAAAGTGGCCATATTACCAAACTTAACCCAAAACAAGTC
GCTGGTAATTAAATACTGACATCGTCTCCTCTTGCCAACTCATTATGCGATGGTGAGGGG
ACCCTTATCGGAAATACTATTATGCTAACATTTTTTATTGGCGATTTATTGCCTATTATC
GTAATCATGCTGTTGGGTTATTTTAGCGGCAGACGAGAAACATTTTCAGAAGATCAAGCT
CGGGCATTTAATAAACTGGTATTAAACTACGCGCTTCCTGCGGCTCTATTTGTATCTATT
ACTCGGGCAAACAGGGAAATGATTTTTGCGGACACTCGTCTGACCCTTGTATCACTTGTG
GTTATTGTCGGATGTTTCTTTTTCTCCTGGTTCGGTTGCTACAAATTTTTTAAACGTACC
CATGCAGAAGCAGCTGTATGTGCATTAATTGCAGGTTCACCTACCATTGGATTCCTGGGG
TTTGCAGTTCTCGATCCTATTTATGGTGATTCCGTATCAACAGGTTTAGTGGTAGCAATT
ATTTCTATTATTGTTAACGCAATTACTATTCCTATTGGTCTGTATTTGCTGAATCCTTCT
TCAGGAGCGGATGGTAAGAAGAATAGTAATCTGAGCGCATTAATTTCTGCGGCAAAGGAG
CCAGTAGTATGGGCACCTGTTCTGGCAACGATCCTGGTGTTGGTTGGGGTAAAAATTCCG
GCAGCATGGGACCCAACCTTTAATCTGATTGCGAAGGCTAACTCAGGGGTAGCGGTATTC
GCTGCGGGGTTGACTCTGGCTGCACATAAATTCGAGTTCAGTGCCGAAATTGCTTATAAC
ACCTTCCTGAAGCTGATTCTGATGCCACTGGCACTGCTTCTCGTTGGTATGGCATGTCAT
TTGAACAGCGAACATCTGCAGATGATGGTACTGGCAGGCGCATTACCGCCGGCATTCTCC
GGAATCATTATTGCCAGCCGGTTTAATGTCTACACCCGTACTGGTACAGCGTCATTGGCT
GTGAGCGTACTGGGCTTTGTCGTCACGGCTCCCTTGTGGATTTATGTCAGTCGACTGGTT
TCATAATTAATCATGTTATTGATTTTACATAAATGCCGAAGTGTCTTTTCACCTTCGGCT
TTTTTCAAGGCATAAGCAAATGACAAATAATGAAAGCAAAGGGCCGTTTGAAGGCTTATT
AGTTATCGATATGACACATGTCCTTAATGGACCTTTCGGAACTCAACTTCTTTGTAATAT
GGGCGCAAGGGTAATTAAAGTTGAGCCGCCGGGTCATGGTGATGATACCCGCACATTTGG
TCCCTATGTGGATGGACAGTCACTCTATTACAGTTTTATTAATCATGGCAAAGAGAGTGT
GGTTCTTGATTTAAAGAATGATCACGATAAAAGTATATTTATAAATATGCTCAAACAAGC
TGATGTATTAGCTGAGAATTTTCGCCCAGGTACAATGGAAAAACTGGGGTTTTCATGGGA
AACGCTTCAAGAAATCAACCCGCGCCTCATATATGCTTCATCGTCAGGTTTCGGACATAC
CGGTCCGCTAAAAGATGCTCCTGCCTACGATACCATCATTCAGGCAATGAGCGGGATAAT
GATGGAAACAGGATATCCTGATGCTCCGCCAGTGCGCGTTGGTACATCTCTTGCGGATCT
ATGCGGCGGTGTCTATTTATTCAGCGGAATAGTGAGTGCACTTTATGGCCGCGAAAAGAG
CCAGAGAGGGGCGCATGTCGATATAGCGATGTTTGATGCCACGCTGAGTTTTCTGGAGCA
TGGTCTGATGGCATATATCGCAACTGGGAAGTCACCACAACGTCTGGGAAATCGCCATCC
CTACATGGCACCTTTTGATGTTTTCAATACTCAGGATAAGCCGATTACGATTTGTTGTGG
TAATGACAAGCTTTTTTCTGCGTTATGCCAGGCACTGGAGCTTACGGAACTGGTTAATGA
TCCCCGATTTAGCAGCAATATTTTACGCGTACAAAACCAGGCTATTCTTAAACAATATAT
TGAGCGGACGTTAAAAACGCAGGCAGCTGAAGTTTGGTTAGCCAGAATACATGAAGTTGG
TGTACCCGTCGCGCCGTTATTAAGTGTGGCTGAGGCCATTAAATTGCCACAAACTCAGGC
GAGAAATATGTTGATTGAAGCCGGGGGAATAATGATGCCGGGTAATCCGATAAAAATCAG
CGGCTGCGCGGACCCGCATGTTATGCCGGGAGCGGCAACGCTCGACCAGCATGGGGAACA
AATTCGCCAGGAGTTCTCATCATAAATGTAAGATGTGCTGGTAAATAGCTCCCACATTTG
AACATTGTGGGAGCCGCTATTTAGTCATTTTTCTGACAGAAAACAGCAATCTCCTGGTCC
AGCTCTGCAATGTGTTCTTTTACAGAGTTCAGCAACTGAAGAATTTCAGGCTTACTGTCA
TCTGAAACAGGTGTTATTTCTAACTGATGGCTAATATTAATCAACTTTTGCAAATTCAGG
ATGTTAGCCGCACCGTGGATGCGATGAATACACTGATGGAAAGTTCTGTTATCGCCAGCT
TCTAGTGCTTGAAACGCAGCGGGTAGATCTTTATGCGTTTCATGCTGGAAAGTCATGAGA
ATCTCCTGCATCAGTTGTAGATCGTTCGCCGTATTATTTTTCAGGGCTTCGATATCAAGG
TGGCGATACTGAGGTGCAATATGCGCAACTTGGTGTAACTGACTTAAATGTGTTTTCAGT
ACATCCAGGGTCAACGGTTTGAACAAACATAAGTTCATGCCGCAACTTAACCCTTTTTCA
CGTTCGTTAGCCTGTGCGTTGGCTGTAAGCCCCCAGATGGGTAAGGAAGAATTTTGCTCA
CGGAGTTTGCGAGTCAACTCAAAACCATCCATATTCGGCATATTAACGTCAGTAATAAGC
AGATCATAATGTTGCATACTGACTTTGTGTAGCGCTTGCACACCATCAGTGGCTTCATCA
ACATCATATCCTAATAGATTTAGCTGGCGTTTGAGTAATAGCCTGTTGGTCGGATGATCA
TCCGCGATTAATATGCTCAACTTTTCAGGTAGTGTGATGGGTTGTTCTGCTTTTGCCTCG
ACAGTCGCCACTTGCTGGCTAATTTCTACCGGGATTGTGATCGTAAATGTTGTTCCTATG
CCTGGATGACTTTCTAATGACAAATCGCCCTGCATATTTTTAATTAATTCTTTGCAGATC
ATTAAGCCTAAACCAGAACCTGTTTGCTGACGACCTGCACTTGTTTGGCTGTAGCGTTTA
AACAGTTGTTGTTGTTCTTCCTGCGATAATCCACTTCCAGAATCCATAATCGTCATTTTG
ATAACAGCGTGGTTGTCATCAATGTGACCCAGGGAGGTCGTAATTTTTACTGCCCCCTCG
GTGGTAAATTTGAGAGCATTACTCAGTAAATTTGATAAGACCTGCTTAAACGCCTGAGGG
TCGATCTTAACCAGGTAATGTTCAGGAAACGTACTGCTGCAACTTAATGCGATCGATTTG
CTTGCAGCAATCGCACCGAAAGAGTGACAAGTGTTCTGGACTAAAGTAGGGATATCGACC
CATTGTGGTTGAAGTTGATAGTTACCCGATTCAATTTTGTCGACATCAAGGATTTCACCA
ATTAAGCCGAGGAGTGATTGTCCGGTGGCGTAGGCAAGTGAAATCGCCTCCACCCGTTGC
TCCTTGCTAAGACCAGAACCCGACAGAAGTTCCAGGAAGCCCATAATAGAGCTTATTGGT
GTTCTTATTTCGTGACTCATCGTTGCCAGAAACTGACTTTTTGCTACGGTAGCCTTTATC
GCTTTATTTTTTTCTACCTCGAGTGCATTAATTAGATCACGCGTTTCAGTAATATCTTGC
CAACCACAAATATATACTGCATTGTCACTTGCAGGAAGATTGCATAATGTATGCCAGTGA
TTAATGCATCTTTTCTCGATGCCATTATCAATTTCAAATACCTGTGTGTATATTGTTCGA
TTTTCTTTCGTTTCTGCTGTGACTTCATGCGCATTAGAAAAAACATCTTTAAAGGGTGAG
TCACTGTTTTCTAATGGTAACATTGCATTTTTGTAGTAATCCGCAGTGAAATAATGTTCA
AAAGCACTATTATGACTAATGACATTACCTTGCCAGTTTACAACATAAGTTGGATTCGGT
AAGGAATCCGAGAGTGCTTTTCGGAATGATATTTGGTTTTCTAAATCACCCTGAATGACT
TTACGACGACGAACTGAGCGTAACAGGTAGAATCCCCATAAAAGGCTACTGCCAACTAAT
AAAACGGATAATGTCGTAACAATATAAAATTGCTCGCTATATAGGTCCCATGTGTCAATG
GTCACATTGGGCATTTTAATCCATTTTTCCGTCAGGCGCAGAACTTCGCTTGGGGGAATT
GCATTCAGTGCTTTATTAATAATATCCTTAAGTTCCGGTTCTCCGCGAGGAAAAGCGAAC
GAAAGCGATGCATTCGGAACGCCAGGAATAAGAAAATGATAAAGTTCATTAGGATAGTAA
TGATCGATCATGTAACGCGAATTTAGCTGTGTCGCGACCAGAGCATCAAGTTCACCTTCC
TTAACCTTGTGAAATGCAGCGCTGGCATTATCGACCTGTATCCATTCAACCTCCGGATAC
ATCTCTTTTAATTGCGAATGCAGCTCATAATAATATGGAATGGCAACTTTCATTCCTTTT
TTTAATGTTTGTTCACTGTCAGGCGCTTTTTGCATGACAAAAACGTAAGGCGTTGTTATG
AAGGCTTCAGCAAATAAAACATTATTTTCTCGATCTTCACTATAAATAGCGCCAGGTATT
ATATCCCATCCTCCGGGGCTAAGCTGTGTTCCAGCATGGATATTGTGTGAAACGGTGATC
GGAGAAAAATTTAAACCTGTTTGCAAGGTAATAATATTAAGAATGTCCCCCATAACGCCC
CGAACCGAGCCATTTTCATCCGTCATAGAATAGGGGGGCGAGTAAGGATTTTCCAGCACC
TTTAAATTGGGATGCTGCTTAATCCACTGTTTTTCATGTTCAGTGAGTTCTAATGGTTTG
TTCAGAAAGGCCAGGTTTCCTGTATCAAGCCAATTTTGTGATACTTCATAGCGAACTTCA
TTTGTTAAAGCATCAACAAATCTATTGAGTACTTCATTAAGAATGACAGATTCTTTTCTG
GTCAAGAAAAAATTATATTGACGCGGCGAGTTATAATATTTCACTACATTTAAGGAGTGA
GTGAAATAGCGGGAAATCATACTGCTGGTAATGATGTTACTACCAATAAAGTAATCATTG
TGCCCAGCTGAGACGGATGCTAATGCCTGATATAAATTTGTAAAAGAGATAATTGTTGCT
TTTGGAAATGATTGATGAATTACCTCGTCTGGGGGGTAATTTGCTACCCGAGCAATATTT
ACTGGTTTTGGTGAGGTAAGCGGTCGCATTGAGTCGTGAAGGGTGGTTACCAGCGCCGGA
AAGGTAATTATCAATGGTTTGGTTGCAGCAATGTCATTATTAAGAGGCGGCGAAGTAACT
AAATGTGATAACACTATATCGACTTCACCTTCTGCAAGCGCGTCCATTGCTTTTTGATGA
TCTGCGTATTCCCGGAGTGTTAATTTGATATTTAACGCTCTTTTTAAAAGATTTAAATAA
TCAGCATTAATACCACGAACCCGTTGCTGCGAATCGGTATGCAACAACGTAGCCGTTTGG
GACTTATGTACTGCAATCACAAGATTTTTTTTGCTCGCTAACCAACGTAATTCCTTGTTG
CTCAGACGTAGTGGATCAAGTGTGACACGGTTGTTACTACTGATGCCACGATATTCGATG
TAATCTTCGTCTGCGAAACTTATGGTCGACCAAAGACCACAACAGAGAAGAAAAATATAG
GGTAAAAACTTCATGTGGTTAGCCGATTTTGTTACGTTGTGCGAATGTGTAAAGATCCAT
CAGTGATTTACATTCTAATTTTTCCATCAGGCGACTTTTATAAGTGCTGACAGTTTTGTT
GCTGATGAACATTTTTTCAGCAATGTCATTATTATCCTTGCCATCAAGAATATACCGCAT
GACACTAATTTCTTGTTTCGATAAGGAGTCGAGTTTTTGCTGGTCGGACGTTAAACTTCC
AACAAACCGGTTGAGAGAGAAGGGGAAATAGCAGTAGCCATTTTTTGCAGCTTCAATAGC
CGCAATGATATTGTTCATGCCTTCTTTTTTACTCACGAAACCATTAGCGCCAGCATCAGC
ACAATGTTTCCCGTAAAAATGGTCATTTTTAGCGGAGACGATAATAATAATTCCGCTATA
TTGGCGCTTCCTCAGCGTTTCTAACACCTGGATACCGTTAACTCCGGGGATATCGACATC
AATGATGACGATATCAGGCTTAAGTGTTTCCACCCGCTGAACGGCACTTCCGCCTTCAGT
CAACTCTGCTAAGATTTCAATATCGTTTTTGATCAATAAATTACGAATTGCTGCGATAGC
AAGAGGATGGTCATCAATAATTATTGCGTTCATAGATTATTCCCTTTGCAATGAAGCATC
TCCCTTCTCCCTGTAGTAATACAGACATAAGGCGTCATCTCATTTTCTCAATAAAAATAA
GAAAATCTGAGCTTCCTTTAAGATAATTCGACAAGTATACCATATAAATAGTCGGCATAA
ATGAAATGTCAACAATAAAATCAGGGATTGTACCGATGATTTATAGTTTCAAGTTGGCAC
TATAAGTCTTCTTACTAATCCTACAGGCGTAAGAATTGTATTGCAAAAGCCACGGTTTAG
TCCTCTGTTGTTTTTTTTGCACCTCATTTAAATTAGGCCTCCAACGTTCCTGGGATAATG
TGCAACACATGCACTGTGTTTGATATGAAGAATGAATGCTCTTTTCATTCAATTCATAAA
TTTCATCTATGAGAAATGAGAGATAATAGTGGAACAGATTAATTCAAATAAAAAACATTC
TAACAGAAGAAAATACTTTTCTTTATTGGCGGTAGTTTTATTTATTGCGTTTTCAGGTGC
CTATGCCTATTGGTCAATGGAATTAGAAGACATGATTAGTACAGATGACGCCTATGTCAC
GGGGAATGCAGATCCAATTTCTGCACAAGTCTCAGGTAGTGTCACTGTCGTTAATCATAA
AGATACGAACTACGTTCGACAAGGTGACATTTTAGTTTCACTGGATAAAACTGATGCCAC
TATCGCACTCAATAAAGCTAAAAATAATCTGGCAAATATTGTTCGGCAAACGAATAAACT
ATACTTACAGGATAAACAATACAGTGCCGAAGTCGCTTCAGCACGTATTCAGTATCAACA
ATCTTTAGAAGATTATAACCGTCGAGTGCCGTTAGCGAAGCAGGGGGTTATTTCAAAAGA
AACGCTGGAGCATACCAAAGATACGTTAATAAGTAGCAAAGCGGCATTGAATGCCGCTAT
CCAGGCTTATAAAGCGAATAAAGCTTTAGTAATGAACACACCATTAAACCGTCAGCCACA
AGTCGTTGAAGCGGCGGATGCAACTAAAGAAGCCTGGTTGGCGCTTAAACGTACGGATAT
TAAGAGTCCGGTTACCGGCTATATTGCCCAGAGAAGTGTTCAGGTCGGCGAAACAGTGAG
CCCCGGACAATCGTTAATGGCTGTCGTACCGGCACGTCAAATGTGGGTTAATGCCAACTT
TAAAGAAACACAACTCACGGATGTACGGATTGGTCAATCGGTCAATATTATCAGCGATCT
TTATGGTGAAAATGTTGTGTTTCATGGTCGGGTGACAGGGATCAATATGGGAACCGGCAA
TGCGTTCTCCTTATTACCTGCACAAAATGCGACAGGGAACTGGATCAAAATCGTTCAGCG
TGTACCGGTTGAAGTTTCTCTTGATCCAAAAGAACTCATGGAACACCCCTTGCGTATTGG
TTTATCGATGACAGCAACTATTGATACGAAGAACGAAGACATTGCCGAGATGCCTGAGCT
GGCTTCAACCGTGACCTCCATGCCGGCTTATACCAGTAAGGCTTTAGTTATCGATACCAG
TCCGATAGAAAAAGAAATTAGCAACATTATTTCGCATAATGGACAACTTTAATGGCAATC
ACTAAATCAACTCCGGCACCATTAACCGGTGGGACGTTATGGTGCGTCACTATTGCATTG
TCATTAGCGACATTTATGCAAATGTTGGATTCCACTATTTCTAACGTCGCAATACCGACA
ATATCTGGCTTTCTGGGAGCATCAACAGACGAAGGCACCTGGGTTATCACCTCGTTTGGT
GTAGCAAATGCCATTGCGATCCCTGTTACTGGCAGGTTGGCACAAAGAATAGGCGAATTA
AGATTATTTTTACTTTCAGTCACTTTTTTTTCGCTGTCTTCATTAATGTGTAGCCTATCG
ACCAATCTTGATGTGCTGATATTTTTTAGAGTCGTTCAGGGGTTAATGGCGGGGCCGTTA
ATTCCACTGTCACAGAGTTTATTATTAAGGAATTATCCGCCAGAAAAAAGAACATTTGCT
CTGGCATTATGGTCAATGACCGTGATTATCGCTCCGATATGTGGGCCGATATTGGGCGGT
TATATTTGTGATAACTTTAGCTGGGGTTGGATATTTTTAATCAATGTCCCTATGGGGATT
ATCGTCCTGACATTATGCTTAACCTTACTTAAAGGAAGAGAAACTGAGACTTCACCGGTC
AAAATGAATCTACCAGGACTGACCCTGTTAGTGCTCGGTGTTGGTGGCTTGCAAATTATG
CTTGATAAAGGGCGCGATCTGGATTGGTTCAACTCGAGTACAATAATAATATTAACAGTA
GTATCAGTTATTTCTCTGATCTCTTTAGTCATTTGGGAGTCGACCTCAGAGAACCCGATT
CTTGATCTCAGTTTGTTTAAGTCCCGTAACTTCACCATTGGTATTGTGAGTATCACATGC
GCGTATTTATTTTACTCTGGAGCGATCGTCCTTATGCCGCAGTTACTCCAGGAAACGATG
GGGTATAATGCGATATGGGCCGGACTTGCTTATGCGCCCATCGGCATCATGCCACTATTA
ATTTCACCTTTGATAGGACGTTATGGCAACAAAATAGACATGCGGTTGTTAGTGACATTT
AGTTTTTTGATGTATGCGGTTTGCTATTACTGGCGTTCTGTGACATTTATGCCAACGATT
GATTTTACAGGCATCATTTTGCCGCAGTTTTTTCAGGGATTCGCCGTTGCCTGTTTCTTT
TTACCCTTAACAACGATTTCGTTTTCAGGCTTGCCAGATAATAAATTTGCCAATGCCTCG
AGTATGAGTAATTTTTTTCGTACCTTGTCAGGATCAGTTGGTACGTCGTTGACAATGACG
CTGTGGGGACGACGCGAATCGTTACACCATAGTCAGTTGACAGCAACCATCGATCAATTT
AACCCCGTGTTTAATTCATCGTCACAAATTATGGATAAATATTATGGTTCGCTTTCAGGA
GTTCTTAATGAAATTAATAATGAAATAACCCAGCAGTCACTTTCTATTTCTGCAAATGAG
ATTTTCCGTATGGCGGCTATTGCTTTTATCTTACTTACGGTTTTGGTTTGGTTTGCGAAA
CCGCCGTTTACAGCGAAAGGCGTTGGGTGATGATAAAAGGAGGGGGTTATAGCGGGTAAG
ACCGGGGATCTTAAGTCTGCGCCATCGGCAGCATCGCTCACCCAGGGAAAGGATTGCGAT
GCTGCGTTGAAACGTTATTAACGGCCTTTTGCCAGATATTGATTCATCTCTTCTTCCGGC
ACCATTCCACCTCCCGTCGCCCACACCAGATGAGTGGTATTACGCAGTTGTTCTGCGCTG
AAACCGTGCATCTGTTGGTAACTTACTGATGCACACACGCGCTGAGGTCCGGCCATACCC
GCCAGTGCCGAAGGTTCAAGACGAATACCTTCTTCCTGCGCCAGCCAGCCAAGCATGTCA
TACATGGTTTGATCGCTAAGGGTATAGAAGCCATCCAGCAGACGCTCCATTGCCCGCCCG
ACAAAGCCTGATGCGCGACCAACTGCAAGGCCATCCGCTGCGGTAAGGTTGTCGATACCA
ATATCCTGAACAGAAATCTGATCGTGTAATCCTGTATGGACGCCTAACAACATACAAGGG
GAGTGCGTTGGTTCGGCAAAAAAGCAGTGAACATGATCGCCAAACGCCAGTTTAAGCCCG
AATGCGACGCCACCAGGACCACCGCCAACACCACACGGCAGATAGACAAACAGAGGGTTA
TCAGCATCGACGATACGGCCTTGCTGGGCAAATTGCGCTTTAAGACGCTGGCCAGCGACG
GAATACCCAAGGAACAACGTGCGGGAATTTTCGTCATCAATAAAGAAACAGTTCGGGTCA
GACTGCGCTGCTTTACGTCCTTCCTCGACGGCAACACCATAATCTTGCTCATATTCCACG
ACCGTAACGCCATGGCTGCGCAGTTTCGCTTTTTTCCATGCCCGGGCATCAGCAGACATA
TGAACTGTCACCTTAAAGCCAATGCGGGCGCTCATAATGCCGATTGATAACCCCAGATTT
CCGGTTGAGCCCACAGCAATGCTGTATTGGCTAAAGAACTGTTTAAACTCCGGAGAAAGC
AGTTTGCTGTAGTCATCATCAAGCGTCAGCAACCCCGCTTCCAGAGCCAGTTTTTCTGCG
TGTGCCAGGACTTCATAAATCCCGCCGCGTGCTTTTATGGAGCCGGAAATGGGCAAATGG
CTATCTTTTTTCAGTAACAGTTGCCCGCTGATCGGTTGCTGATATTCTTTTTCCAGCCGT
TTTTGCATAGCTGGAATGGCAACCAGTTCTGATTCAATAATCCCCCCAGTGGCAGCAGTT
TCAGGAAATGCTTTTGCCAGATAGGGTGCAAAACGGGATAAGCGCGCATGGGCGTCCTGA
ACATCCTGTTCGGTCAGGCCAACATAAGGTAAACCTTCAGCCAATGAGGTCGTGCCAGGA
TTAAACCAGGTGGTTTCTTTAAGAGCAACCAGATCCTTTACCAACGGATACTGGGCGATG
AGCGAGTTCATTTTAGCGTTTTCCATAGTACGTCTCTTTGCGCTTAGATGATAAATGACA
GCAGGAATGTGCCCGCCAGAGCGACGACTGAAGCGATAAATGTCGCTGTCGTATAGTATT
TAAATGTTTCATTGAGCGTAGCGCCGCAATATTGCTTCACTAGCCAGAAAAGCGAGTCCG
TAACGATAGTGCAGCCAATTGCACCTGAACCGATAGCAATCGCAATAATTTCCGGGCTGA
TGTCGGGATACAGCGGCAGCATGGGTGCAACAATTGCCGTTGCCCCCATCATTGCCACGG
TAGCGGAGCCCACTGCCGCATGCAGAATAAGAGCCACTAACCAGGCCAGAAGAATCGGGT
GCATATGCATATTGGAGAGAATAACTGCCAGCGTATCAGCGAGACTGCTGCTTTTTAAAA
TGGCGTTGAATGCGCCTCCGGCCCCGATAATCAGCAAAATATTAGCAATAGAACCGAAGC
CATTTTCCGTATGTGTGAGCATCGTCCCCATGCTCATATGCTGGCGTATACCCAACACAT
AATAGGCGACAAACACGGCGATAAACATGGCAGTGATAGGGTTGCCAATAAACTCAACCA
AGATATACAAACCACTCTCACGCGCCATATTCAATTCGGCAATCGTTTTAACCAACATCA
GCGCAATGGGTAGCAGTATGGTGAATAACGTTGCGCCTAATGACGGTAGTGTTTTTTCAT
CGCGAACTTTGAGATCTGCAAACTCTGTGGGTACAGGTTTAAAGGGCAGTCGTTGACCCA
GAAATTTAAGGAAAAGTGGGCCACCGATCAGTGATGCCATCAGCCCAACCAGCAAACCGT
AGACGATCACCGAACCGATATCTGCGCCCAGCTTATTGGCAACATATAAAGCAGCCGGAT
GTGGAGGAACCACGCAGTGCACTGCCATCAATGCGGTACATAGCGGAATGGCAAGCTTTA
ATAATGAGGTATTGGTTTTTTTGGCAATTGAAAAAGCCAGAGGAATCAATAGCACGACGC
CCACTTCAACAAACAGCGTGATGCCACAAATCAGGCCAACCAGCACCATAATGACATCAA
CTGAAAGCCAGCGGCAGCGTTGAAGTGTCAGACCAATTCTTTCTGCGGCCCCGGATACTT
CCATCATTTTTCCCAGTATCGTGCCAAGGCCGATAACCGCTGCGAGGAACCCCAGCGTTC
CGCCAATTCCACTTTCAATAGCATTTACCATATCCAGTGGCCCCATGCCCATCATCGTTC
CCACGAAGAAGCTGGCCAGCAACAGCGCCAGAAACGGGTGGAATTTGAACTTCACGATGG
TCAGTACAATTAACACGATGCTGATAAGCAGCGTGCTCACAACCCAGATTTGAGAGTGCA
TATCTCACCTTCCCCTGTGATTAACCTGATGATATTGGACAAAAAAACAACGCAGGCTGA
CAAACGATAAAATTTGCCTTTCACATGAGGTAAATTGCATCAATGGAGTGATTTACATCT
AAAAATGAAGGTGAATTGAGATATGGTTCACTTTAGCTCATCTCATAGCTGAAATTTTGC
CGCTATTTTTTTACACTTAAGCGAAAAATGAGGTGATTATGGAACCCCTTCGTGAAATAA
GAAATCGGCTGCTTAACGGCTGGCAATTATCAAAAATGCATACTTTTGAAGTGGCTGCCA
GGCATCAGTCCTTCGCCCTGGCGGCAGAGGAATTGTCGCTGAGCCCCAGTGCGGTAAGTC
ACCGTATCAATCAGCTGGAAGAAGAATTGGGCATTCAGTTGTTTGTTCGTTCCCATCGCA
AAGTGGAATTAACGCACGAGGGGAAACGTGTTTATTGGGCGCTAAAATCGTCGCTGGATA
CCCTGAACCAGGAAATTCTTGATATCAAAAATCAGGAGTTATCGGGAACGTTAACTCTGT
ATTCCCGGCCCTCTATCGCCCAATGCTGGTTGGTGCCCGCATTAGGTGACTTTACACGCC
GGTATCCGTCTATTTCGCTCACCGTGCTCACTGGTAATGACAACGTCAATCTGCAACGTG
CCGGAATCGATTTGGCGATCTACTTTGATGATGCGCCGTCAGCGCAACTCACTCATCACT
TTCTGATGGATGAAGAAATCCTGCCAGTATGTAGCCCGGAATACGCTCAAAGACATGCTT
TAACCAACACGGTAATTAACCTGTGTCACTGTACGTTGCTCCATGACAGACAGGCATGGA
GCAACGACTCCGGTACGGATGAATGGCATAGTTGGGCGCAACATTATGCGGTTAATTTGC
CGACATCTTCTGGAATTGGCTTTGATCGTTCTGATTTAGCTGTTATTGCCGCGATGAATC
ATATTGGGGTGGCGATGGGAAGAAAACGCCTGGTACAAAAAAGGCTTGCCAGTGGTGAGC
TCGTCGCGCCGTTTGGCGATATGACGGTGAAATGCCATCAGCATTATTACATCACCACAT
TACCGGGCAGGCAGTGGCCAAAAATTGAAGCGTTTATTATCTGGCTAAGAGAACAGGTAA
AAACCACTTCATAATGAATAAAACCACGAGTTCCTGGTGTGCCTTATTCGGCCTGCTAGT
TCGAATTTAATTTACGGTTTTTATGTGGTTTTAGGGATAAACACAAGGATGGTGTCCCCT
GCAGACATCTACTTGAAGCAGCAGGGGATTGATTGGAATGGTGTTTTTTAGATGTGAGAA
ATATTTTACCCGCTATTTTACCCATTGGCGCGGCTTAAGAGCTTATTTTTGAATTCACAA
TGGTCACGATATAACCATCTTGCTCGCCCGTGGATAACTTTGGCTTTTGGCAGGTCGCCT
GACTTAATCCGGTCATAGATGAAGGTTTTACCAAAGCCAGTATCAGCCATGATGAATTTC
AAATCAACCAGTGAATCAGGCTGTAGTTCGTGTTGCATGAGTGCTATCTCCGAATAGGGA
ATCGAACCTGCAAATCAGGTAATAAAAATACGCTCTATGACGGCGATGGTAGATCAGGAT
ATTTTAAGAAACTGACAGGCCTCATCGAGTGTGAGGCTGTATGGCTCTATTATTTCACCT
CTTGTTGTGACATTGTTGAAAAATGGATACCAGCTCGTTGCTGCCAGATGATCCAACCGA
GAGTCATATCCCATGCCATGTATTCGTTATCGCCGTTTTTTGCTCTCCGACGATCTACTA
AGTCACCGAAACGCTTTTCCATGAATAATTCATAGGCTTCGCGTTCATCTGGCTCTACTT
CCAGAGATACGAGTGCGATTTCATAAGCACGGCGCTCAATATCGTCTCGAACCTCTAGGC
TGCTGATTCGTTCTTTGATTTCTTTAATCAGTTCTTTATTGGTAAATGTGGTCATTATGC
TCCAGCCTCCGGTGCTTTTGGCATTACTGCCCAGTGAGTGATATTGACGTTTTCAAGGTC
CCCAACCTGAAATGTCCACTGCCATTCTCCGGTTTCTTTTTGTCCCCAGGTGTACCAGAG
AGAACGCCAGCCAATCAGCCAGCCTTCTCCGTTAGCATCAAATAACAGAACACTTTCATT
TGCTGGTGGCAGTTCAGCTGACACTGGTATTATTTTGTTTTCCAGTGCCGCACATTTAGC
TTCAAGCGCGTCGAATTTACGTACCAGGTACTCAGCATTTGTTTCGTTCACTTTCAGATC
TCGCGGTACACATTTCCCGCGAAGAAACCCTTCCATTTCGAAAACATTCATGCGCATTTG
CGTAACTCCGATAAATCGTTAAAACGTTCCATAAACATCCCGTAGGCATGACCCGGTGCC
AGTGGAATCACGTTGAACATCTCTGTTGCCGGGATGCCTTCCAGTACAGGCCAGAAAGAG
CCATCATCAAGCCCGAGATCACGGCGTTCGGTTGCCAGCATAATGAGATCGGCATATTTC
ACTGGCGTGCTCATAACAGGAGGTAACCCGTATTTCTCACGGATTACTGCATCTATTTTT
TCTTCCATCCGTTTATAGTCAGGAAGAAGGCGTTTCAGTGGTGCGGGGATGTCCTGGCAA
TACGCTTCTGTTGCATCATGCATTAATGCTTCAAAAGCAAATTCCTGCGGCACCAGCTGG
CTGCAAAGCACCGCATGTTGGGCGACACTGTAGAAGTGAGAAAGATGACCGGCAAAGCGG
CAGATATTTGAAAGGGAAACCGCGATATCGTTAATCACGATGTCGTCTTTATTTATCTTG
TCATAATAAAAATGCTTCCCGGAAAAAGTTTTAATAAATGACATTTTGTTCTCCACGTAT
ATGCGCTGCACCGCGCTGAGTTTGGGTAAAAGGAAGCCCTCACCATCCGGTGATTATTGA
GTTAATTACGTTTCCATAAATGCCCCCGCAGGGGCATTTGCAGTAATGAAATCAGGCGGT
GAAAGTACCAATAAAGGTTTCTACTTTGCTGTCTTTGAATTTCTCAACAAGCAGATCACG
AAATTCGTTAGCCATATCTTCCTGCACCGCTTCCAGCTGAATAATGCGCAGAACCAGTAC
AGGACGATCGCCAGTGATAATGCTGAGGCGTAATTTAAACGGACGTTCTTTCAGACCTTC
AAACGGAACGCATTTAAATTCAAATGCCACTGGCATAATGTCTTTGGTCTTCGCTTCGAC
AGATTCCATCAGGGAGCGTTTGCCGCTGAAGTCATTATCTTCAAAATCAGCGGTCTGGTT
TGCTTCAATCGTGATTTTACGGATTGCCGCAGCCGCTTTTGTTGCCTGAATGGCGTCACC
ATTAGCATCAAAGCCCACAAGGTAGTCGGCCCAGTCTTCAATCCATTCTGCCAGTGATTT
CTGGGAGTTACGCTCGCCGTTAACAGACAACAGGGCAGAGAACGGTGCTGTCTTTTTCAG
TTTGAGAGTGGCGGTGTTATCTGCGTGACCTGGTTCATCAATAGTACCCAGGTTAAGCAC
ACTGACGGCACGCATATTATCAGCATCGATAAAGCAGCGGGTGCCTTCATCTGCAAGATC
TTTAGAATAACGGGTAAAGTCATCGATGCTGGCAGTGGAAAGCGCACCACGGAAACGGAA
GCGATTTAAATTAAATTTTTCCAGATCATGAATGCGGAAATTCTCAGGCAATGCCACAGC
ATCGGCACCAATCTTACTGATAATTTCATTAACACCCTGAGCAGAAATAAGGGCATGGAT
TTGATTAATTGCGGTTGCGTCTAAGTTCTGAGACATAATAAGTCCTCACTATATTAAGAT
ATTCAGTGATGAGATAAATAATTAGTTAATTAAGAATGATATTAATGACCTGCTGCGCGG
AGTTTTCCGTCAGGCTCACCGGCAAGAGTCAGTAATTGTCCCTGGTCTTCCTGCAGAATA
GTCAGGCGACCACCGCGATTGACATACATCGGCGTTTCGGTGGTGTCTTCTTCGGAAATT
TTCCCACGGTTAGTCGGGCGAACATATGAGAGTTTGTGTTTGATTTTCAGACGGTTCTCA
TCAAATGGTTCGATTTCCAGGTTGAGTGAGACCTTACCTTTGGTTTTCGTGTTCATCACA
CCGGAAGCGACTTCACTGAGAACTGCGCCGATTTTGGTTTCAAATACGCCGCCGTCCAGC
TCCCCGATAAATGCCTGCACATCAGTACTGCGTTCGCTAGCCATTTTGCTGCTCCTCATC
ATAACCGCAATGCGTCGAATGTTTATCAGCTTAACGTTGCGAAGCTTCAGGCAGCGGCAT
TTTCTCAACTGTCAGACTCTGACCCGTCAAAATCTGACGCATCAAAATCTGACCCGTCAA
AATTTGATGCGTCGAAATCTGGCAAAAAATCGGGTTTTCACCCGTCAGAATCTGGCGGGG
ATCCGTCAGTAAAATCAAAACATGATCCGTCAGATAAAAAACCTTCTCGTCCGGACGCTT
CGCAACCGGACACGCAGACGGATGAACAGGATTTTTTAACTCGCCATCCTGATGCGGTTG
TATTCAGCCCTAAAAAGCGCCAGTGGGGAACGCAGGATGATTTGACCTGCGCACAGTGGC
TCTGGAAAAAAATCATCGCCCTGTACGAGCAGGCCGCCGAATGTGACGGCGAGGTGGTTC
GTCCCAAAGAACCGAACTGGACAGCCTGGGCAAACGAAATTCGCCTGATGTGTGTGCAGG
ATGGTCGTACTCACAAACAAATCTGCGAGATGTACAGCCGCGTCAGCCGCGATCCGTTCT
GGTGCCGTAACGTGCTCAGCCCGTCGAAGCTGCGGGAAAAATGGGATGAGCTTTCCCTGC
GCTTATCGCCGTCCGTCAGCACGTACACAGAAAAACGCGAAGACCCGTACTTCAAAGCCA
GTTACGACAATGTGGACTACAGCCAGATCCCGGCAGGATTCAGGGGGTGAGCATGAGTCT
TTTGAATGACGTTCAGAAATTCATTGAAGCCCATCCGGGCTGTACTTCCGGAGACATTGC
GGATGCTTTTGCAGGTTACTCACGGCAGCGCGTTCTGCAGTCAGCAAGCAAGTTACGTCA
GAGTGGGCGTGTGGCTCACCGTTGTGAAGGAGATACACACAGACATTTCCCGCGCCTGAC
TGAGAGAGCGCAGGATCCGGAACCACAACCAGTTCGTGAAACCAGACCTGTGCGCAATTT
CTATGTCGGCACTAACGACCCGCGGGTGATTTTGTGCCTGACCCGCCAGGCGGAAGAACT
GGAGTCCAGGGGCTTATACCGTCGTGCTGCAACGGTGTGGATGGCGGCATTCCGTGAAAG
CCACTCCCAGCCAGAACGAAACAATTTTCTGGCGCGTCGTGAACGGTGTTTACGGAAAAG
CAGTAAGCGGGCTGCATCAGGTGAAGAGTGGTATCTCTCAGGGAATTACGTGGGGGCTTA
ATGAGTAATAAATATTGCCAGGCGCTGGTGGAGCTGCGGAACAAACCAGCCCATGAACTG
AAGGAAGTGGGCGATCAGTGGCGCACGCCGGACAACATTTTCTGGGGAATTAACACCCTG
TTTGGCCCGTTTGTTCTGGATCTGTTTACTGATGGTGATAACGCCAAATGTGCCGCGTAT
TACACTGCGGAAGACAACGCGCTGGCGCATGACTGGTCAGAACGTCTTGCGGAGCTTAAA
GGTGCTGCCTTTGGTAATCCCCCGTACCCGTGGTAACCCCCAGACCGGCACGCCTGCCAC
CGATCTGGATGATGACTACTTTGACATGTTGCAGGAGGAGCTTTGCAGCGTTGTGGAGGC
CTCCGGTGCCAGCCTGGAGAAGGGGCGGCATGACCAGCTGCTTACCGCGCTTCGTGCGCT
GCTGTTAAGCCGCAAGAATCCGTTTGGCGATATCAAATTGGACGGCACGGTGCAAAAGGC
TCTCGAAAACCTTGGTTTGGGAGAAGCGGCTAAAAGAAATGTAGGGACAGGGGCGAATCA
GATACCTGATATGGGTAGTTTTATGCTTTCTGCTTCAGTTCCTGGATATCAAAAATTGCC
ATCCGGTTTAATTATTCAATGGGGGCCAATTGATGTTCCGCTGACGTCTCAGGACACAGT
AACCTATTTTCCGATTGCATTTCCGAATAGATGTCTGCGGGTATTTGCGACTCAGGATTA
CACTCCCGGCAGTGCAAATGTTGGCTATATAGCTTGTGCCGGTTATAACCAGGACCCGGT
GAAATTTATTTCCAGAGCAGGCGTACCCGGTATCGGTGCTTCATTTTTCGCATTAGGGTG
TTAATTTCTTTTAACTTTATGGAGTGAAAAATGAATTACATATATTCCGCGACTACAAAC
TCTTTCTATCCCTTGGAGATGAAAGAGGATTACACGCAAGCTGGCTCATGGCCAGATGAT
GCTGTTGAAGTTGATGAGCAAGTGTATATTGAGTTTTCCGGATTACCGCCGAAAGGAAAA
ATCCGTATCGCTGGAGAAAATGGTTTTCCTGCATGGTCTGAAATTCCACCACCAACACAT
GAGGAACAGATTGCTGCAGCCGAACTGAAAAAGCAGCAATTGATTAATCAGGCCAACGAT
TATATGAACAGTAAACAATGGGCTGGTAAAGCGGCTATTGGTCGTCTGAAAGGTGAGGAA
CTGGCGCAATATAATTTGTGGCTGGATTATCTGGACGCACTGGAGCTGGTCGATACTTCC
AGTGCGCCAGATATTGAATGGCCTACTCCTCCGGCAGTTCAGGCCAGATGACATCCGGCG
CGGTGCTGGTATCTGTTGCCGTCACCGCGTCAATGTAATCCAGCACAGTGTTAAGTCGGG
AGGTCTCTGCCTGCATCAGCTTCCGCCCAGCCTGTAATTTCAGTTGAATCAGACTAATGG
AAGCCATTGCAGTATCAATCAGCGACTGGCGCTGTGCTTCTGCTGCATCTACTGCGACGC
TATGCTGTGCCTCGGTATCCGTCACCCATTTCTCACCATCCCATTTATCGTATGGCGTTA
ATGGGGCGATAGTCGCGGGACGCATACAAACATAACCCCTGGATGTTATGTGTCTATCGA
GAATCAAAGTGGAAGTCCTTATGTTAAGTATAAGACAGGAATCACTTATAACGATAATCA
GTTAGTATATGTATCTATCACTGTTGATGATAATATCAGCACTTGGTTCTGGAGGGGGTT
TGTTGTGGGCAATGATGCATTTAAGTTATCGTCTGCAGATAGAGGAGATATTACAATAAA
CAACGAATCAGGGCATTTGATAGTCAATACCGCAATTCTATCAGGAGATATAGTCACTCT
AAGAGGAGGAGAAATTAGGTTGGTATTATAGCTTGTGCGCGCCATGATTGGCGCGCAATT
TAAACTTAGTGCTTTACATCGCTATTGTCTTGATTTCTTTGAATTATTTTATAAATTAAA
AAAACGACTGTTATGTATAAGCAAAGGTCGAACGAAAAATACATTCCAAATAAATGCTTG
CTTAAATCTCTATATCCTTCCCCGAAAAATGACACATAAAATTGAGATATTCCAAAAAGA
GATACTACAAATAAAGATGCCTTTATTTTATTATTTCTAATAAAAATAGAAGCAATAAAA
AATAATAACAATGATATAAATCTAATGTTTTTAAATATATTGTCTTTTATGTTAGTAATA
GTCGTTAGTATGTTTGATTCTCCATATATTACGTGTAGTTTTTTATATACATGGAAATAA
TTTTCTTTATACTGAGACATCACACCATCATCAAATGGAAGTTTGAAGATGGTGCTTGGT
TTGCTAACCAATAAAAAGAGTGCATTCGAAAACGTTTCATCTTTATGAGATTCGAAACAT
TCCGTTCCAACTTCTGTTGGGGTTGCGCCAAATGATATGTCGAATTTATTACCCCAGGCA
TCTAACCCAACACACTTATCATCAACATACGATGGCATTTTATACCCGTTGTTTTTCATA
TAAAGATAACTACCGAAGTATGTTGCATGGTACTTATTTAATTCAACAACACCTTTTGAA
TAAGATATTGCAAATATTGACGCAAGCAAGCACACCACGCATATTACAGATTTAATAATT
AGTTTGTGTCTATCAAAAAAAATATAATATGAATACACTATTAGTGGGGTTAATATAAAT
TGATTTTTAGCAGTAGATATTATTAGCAACGAAAAAAATAGCAAAAGCATAGATTTATTG
TTTTTGCATGTTAATGAATACACCAAAAATGGAAGGAAAATTATAACTATTTGCTCTTGA
TAGAATGATGCAAACATTGACAGTGTTGATGAAGAACACATAAGAAAAGCTAAAATAAAG
AATGTAAATAAAGTTACATACCTTTCTGTTTTTATATATGAAGTAAATATCGCATATAAT
GAATAAATATATATTACTTTTAGAAATAACGATAACACCCTAGCATCAAGATATTCAGTA
AAAATGCTAATAAACAGGACGTATGTATACAAAATATAACTATATGAACTTATATACTCA
TAGCTATCAATTGAATCAATATGACCTTTCAATTTATACAATAAAGGTAAGTCATATGTA
AATGCTGGTATGTCTTCAATTAATGGCTTAATGGCTCTTCCGAAATCAGATGTATTTAAC
ATCATTATGTTTTTAGATAAGGCGCAAATAATCAAAACAAAAGATATATACAATGATACT
TTTATTGCTTTATTCATTTTTTGACTCTCTTGATGATGTATTTCGGGCGTTTTTTGGTTT
CAATGTATGTGCGTCCAATATATTCACCTAATACTCCTATTCCAATCATCTGAATTCCAC
CTAAAAACAGTATTGAAACAAGTAGTGAAGGATATCCCCTAACAGCATTTCCAAATATGA
TAGTATCTAAAATCATCCACGCCCCATAAATAAATGCTACACTGGCTACCACTAACCCTA
TGTATGTCCAGATGCGAAGAGGGAATGTGGAAAAGCTTGTAATACCCTCAAGTGCTAAAT
TCCAAAGTTTCCATCCATTAAATTTTGTATCTCCAGCAATTCTTTCCGCTCGCACGTATT
CAACAATATCTGTCTTTCCTCCTACCCAGCTCAGAATACCTTTCATGAAAAGGTTTCGTT
CTGGCATAAGTTTAATATTTTCGACAACATCACGGCTCATCAGCCTGAAATCACCAACAT
TCTCTTCAATTTTAGGATTGCTTATTTTATTGTGGAGCTTATAGAACCACTCAGCCGTTT
TTCGCTTCAGGCGTCCATCAGTTGAGCGGTCAGATCTTTTAGCAAGAACCATATCAGCAC
CTGCTTGCCATTTTTCAATAAGATGAGGAATAACCTCAATCGGGTCTTGCAGGTCAACAT
CAATTGGGATTATCGCATCCCCGGTTGCATGGTCTAACCCTGCAAACAATGCTGGTTCTT
TACCAAAGTTGCGTGTAAATGACAGCGGAACAACTAGAGGATCTGAAACAGCCAGAGCAT
TAATGATTGACTCCGTAGCGTCTTTGCTGCCGTCATTTATGAAAACGATTTCCACTTCAT
ATGACTTCAATTCTTCGAATTCACGTACCGTTTTATAAAAAATTGGTATCGCTTCTTCTT
CATTGAAGACAGGAACTACAAGAGATATCTTCATTTCGCATCCCTAAAGACAATGAACTT
TGAATAGACGAAACCGCACACCAGGCTGATGGCGGAGAAGGTGACAAGAGTTATCATCGG
GGGAAGTGCGCATCTATCAGCAGCCCATCCAACAGTAGCACTCAGTGTCCCCATGAACCC
AACATATAGCATGTAGCGCATCGTTGTAGTCGATGCCTTGAATGTGAATTTTGCATTCGC
GAAGAAGCTAAAGCTCACAGCCACAACGAAACCTGCGAAGTTTGCAAGAGCTTGGTTTGT
ATGCGCGACATAGATACAAACACCAAAAACCACCCAGTGTATAAGGGTGTTCAGCACACC
AATAGAGGTGTACTTTGCAAATAGCTTTAACATTTCTTCTATCAGCTAATAATCAAAGGA
ATGAAGTCTATCATCCAAGTCTTAATCGATCGATACTTGCTGTGGTTGATGAGACAAAAC
TTATACACACAAAGCTTTGCACTGGATTGCAAGACTTTGTGCTATTCGATAGTTGTTAAG
GTCGCTCACTCCACCTTCTCATCAAGCCAGTCCGCCCACCATTGCATCATTTCTCTGCGT
TTATCGAGATACTGAGCATGGTTGTAAATCCCACGCACAGATCCGCCGTTTGCATGTGCC
AGTTGCACTTCAATAGCGTCAGCAGGCCATTCGTGCTCGTTCATAATCGTGCTGAATTCA
TGCCTGAATCCGTGACCGCTTTCCAGACCCTCATAGCCGATTTGTTTGATCACAAGCAGT
ACCGCGTTCTCGCAGATTGGCTTCTTCTTATCGTTGCGCCCGGCAAAAACAAACTCTGAG
ACTGGTTTGGTGATGGAGCTTAGCGTAGTGAGAAGTTCAACTACCTGGTCTGACATAGGA
ACCACATGAATTTTGCGTCCTTTCATCACACTGGCGTCGATGGTGATAATCCTATTTTCA
AAATCGACGTTCTTCCATAGCATGGAACGAAGCTCTTTCGTTCTTAGGGCTGTGTAGCGT
AAAACTTTGGTCGCAATGAGCGATACGATACTTCCTGAAAATGTTGCCAGTGCTTTGTTG
AATGCCGGGATCTGGTCTGCAGGAAGAAACGGGAAGTTCTTCTTGCGGTATCCCTTCATG
GCGTCAGCAAGGTCAGGTGCCGGGTTATATTTAGCCCTTCCGGTGACAATAGCGTAACGG
AAAACCTCGCCGCATCTTCTGCGTGCTTTGTTGGCTCGTTCCATTGCACCGCGATCTTCA
AACCTGCGGATTACTTCCAGCAGTTGCATCGGCTCAATATCCTGAATTTCAAGGCCGCCA
ATGATAGGTAAAATGTCGTCGTCAAACATTTTGGCAAGTTCAGTTGCATACCCTACTGAC
CATACTTGCTTCTTGTGCTCGTACCATTCCTTGTAAATCGCACTAAAGGAATTGTTGTTA
GACGAAGCCTTTTTCGCCTTTACAGGATCGATGCCAACCGAGATGTCTTTCCTCGCAGTC
CATGCTTTATCCCTTGCCTCCTGCAAAGTCATAAGCGGATATTTTCCGACGGTCAGGATT
TTCTCCTTACCGTCAATCTTGTAGCGAAGCTGCCATACCTTTTTCCCTGACACAGGGACA
TAAAGGTACAGGCCATTACCATCGAGAAGGCGGTATGGTTTTTCTTTCGGCTTTGCTGCT
TCAATCTGCTTAACGGTGAGCATGGGTAAAAATCCGGTGGGTAAAATTATTTTATCCACT
TTTTACCCGTCATGGAGTGCGGCTGTCAACGATCTGAAGCGAACCATGACGAACTGTAAA
TCTACGGAATGCTTGATATTCAGGGGATTTTGCGGACTGGTACGGATGGGAGCGAACTGA
TAAATGGTGTCCCCTGCAGGAATCGAACCTGCAATTAGCCCTTAGGAGGGGCTCGTTATA
TCCATTTAACTAAGAGGACAATGCGGCATGAGTATACCCGCTAATGGAGTGCGGGGTAAG
TACGCTGCCGCTCGATTGCTTAAACCCTCGCCATTTATGCCGGGTTTTTATAATTTTTCT
TAATGTTTTCCGCACGTTCTGCTTTTTGGCGTGCTTCTGCTTTACGCTTATTGCTCATGT
CGTTACGAATCTGTGCATGACTCATTAACGCGAAGATAAAGGTGCCGCCGCAGATGTTCC
CCGCTAAAGTAGGTAGTGCGAAGGGCCAGATGAAATCGCTCCAGTGCAGCGTACCGTTAA
ACACCAGATAGAGGATTTCAACAGAACCGACCACGATATGGGTGGTGTCACCCAGGGCAA
TAAGCCAGGTCATCAATATAATCACCACAATCTTTGCCGCACCCGCTGCAGGAAACATCC
AAACCATAGTGGCGATCAGCCAGCCGGAAATGATCGCGTTGGCAAACATCTCGCTGGGGG
TGTTCTTCATCACATCCATGCCGATTTTGACAAATGCATCGCGAGTTTCTTCATTGAAGA
TAGGCATATATTCAAATGCCCACGCCGCAATACCTGTCCCGAGAATATTACCCAGCAGCA
CGACGCCCCATAACCGTATAAGTAAGCCGACGTTGCTCATTGTCGGTTTTTGCATGACGG
GTAGTACCGCAGTCACGGTATTTTCGGTAAATAATTGCTGGCGGGCCATAATGACGATAA
TAAAACCAAAGGTATAACCGAGATTCTCCAGCAAGAAGCTGCCCGGCACACCTTCCAGTT
CGACTTGAAATATCCCTTTTGCCAGTAACGAAGCGCCCATCGACAGACCCGCCGCAATGG
CTGACCACAGTAGCGCCATTGCGTCGCGTTCCAGCTCTTTTTCACCATCCTGGCGGATAT
GCTCATGAATTGCCATCGCCCGGGAGGGGAGTCGGTCTTCATCTATTTCTATTTTTTTGC
CGCGCTCTTTTTCTTCGCTCTCAACTTCAATTTCGTCGCTGTGTTGATCAATTTTGTCGT
TGTCCATGGTCTCTTCTCTTGAATTAGCACGTATAGCTAAAGCGTAGCGGCTTTTTTGCT
CGCAACTGACGGGAGTTACTCTGAAAATGTAGAAAAGGCTGCGTTTGCCTTTTTCTGTTT
CTATAGAATCAAGTAGCCTACAGGGCGGCGATTACCAGGCTATGATCAAATCAGCAAATC
AGGGCGTCTGGACATCAGTTGACGTGCTGTTACAATCGCCCACACCTAAACAGGCGGATA
CGGTATCGTTCCGTCATGGATGGCAAACTGCATAAGCCATAAAAAAACAGGGAGACATTT
ATGAAGCTTCGCCTGTCGGCGCTTGCTCTGGGAACTACGCTTCTGGTGGGGTGTGCGAGT
TCCGGTACAGATCAGCAAGGGCGTTCTGACCCGTTAGAAGGGTTCAACCGCACCATGTAC
AACTTCAACTTCAATGTATTAGACCCGTATATTGTTCGACCGGTCGCTGTCGCCTGGCGT
GATTATGTTCCGCAACCGGCGCGTAACGGTTTGAGCAACTTTACTGGCAACCTTGAAGAA
CCTGCGGTGATGGTTAACTACTTCTTGCAGGGCGACCCTTATCAGGGGATGGTCCACTTT
ACCCGCTTTTTCCTGAACACCATTTTGGGGATGGGCGGTTTTATTGATGTTGCAGGGATG
GCGAACCCGAAACTGCAACGGACTGAACCTCACCGCTTCGGTAGTACGCTTGGTCATTAT
GGCGTGGGTTATGGGCCTTACGTTCAGTTACCGTTCTACGGTAGCTTCACGCTGCGTGAT
GACGGTGGTGATATGGCGGATGGTTTTTACCCGGTTCTTTCCTGGCTGACCTGGCCGATG
TCTGTGGGTAAATGGACGCTTGAAGGGATCGAAACCCGCGCTCAGCTGCTGGATTCCGAT
GGTCTGCTGCGTCAGTCGTCCGATCCTTATATTATGGTGCGCGAAGCGTACTTCCAGCGT
CATGATTTCATCGCTAATGGCGGCGAACTCAAACCGCAGGAAAATCCGAACGCACAAGCG
ATTCAGGATGATTTAAAAGATATTGATTCTGAATAAGAAACAAATAAAAAAGGTGAGTCG
CAAAACTCACCTTTTTTGTTGTTATCCCTCAATTACCACAAGTAAAAGGAGATAAACCGA
CAATGACCTAGACGTAATTATGTAAAAATACTGATGTTCGTCACTGACTATTTCCGATAT
TCAGCTGTTGAAAAATCAAAAAACTGGAAAAATAATTTTAAATATCATCAAAATTAACAC
CTGGCGCAGATGGTTGATTAATTTCATTTTGATATTCAGCCTGGCGATTTTGAAGCCTTT
CTTCAATTTTACCTTCGAGATCCTTAAAATGCTTATATATTTTTTGAGAATGGCCAACGT
TAATTTTGTTACCGACTAAAGTAGAAACTATTTCTTTTAGATGGTCGCATTTATATTTTG
CATCGTCCACTTGAAAATCATATCTTATTGCTCGACCATAACGTTTAAAAACGTCGTTTG
GTTCTCTCAGTCTTTCCCCGTTGAGCTCGTTTACAACCTGATGATCGGAACCAGTTGCAA
ATGATTCTGCCATGATAGCTTTACTGCTTTCAAACCACGCTGAAGCACTCCTGGCGTTTT
CACTACAATATTGGGTGAGACTATCACCATTAATACGAATTCCTCTTTGAATGTGGTAGT
CGTCCTGATCGTAGTAACCGAGAGATAAGTAATCATTTCCGTTTTTATTTTTAATTACAA
TAGCGAGAGAGTCGCCTTTTTTATCTTTACCGTACCAGGTAAATAAGTCCGTTGGTTCGC
TTTTCCCGCTCTCATCAAATTCCGTTACCGTATGTCTGAGTTTGTGTGATATCTTATCGA
AGATAAAACCAGGATCTCCATCATATATTTCTTTTAATGCGCTGAAGATCATTTCCTTGT
TATTGATATCATGAGTCTTCTCAACTATGTTGTCATTAATGATAGTACGGACGAGTTCTT
TGTCTTTATAGTTCGCAGGTAATTCTATTGGTTCTTGGTTGTCGATACCAATAGTAATAT
GGTCTGTATCATTGGAGTCAATATCAATATAAGTAACTGAGGAATTATTAATATTAAATC
TATAAGGATCGTCGTTTACTCGTATGGCGTTTTTTATAAGCTCAAGTAGATGTTTAATAC
AGGTGCTTATTCCTTCCTTACCATTAAAAAGGTTTTTGAACTCTTGTACTAATCCATTAA
CTTCATCATTGTTATTTTCATTGATGGATTCTGGGTAAGCTGCGCTGGTATTGTTGATTG
AAATAGATGGTAGCATGATTTTATTCCATTTTGATTGATTTGTTACAAATATATATTACC
TAATGAAATAGACTATCAAAAAACGCTCATTTATTTAGAACCTATCTTTAATTTGAGTGT
ATGAGCGCACAATAGCCAGGGGGGGGGAGTATCCTGGAAATGCAGAAAAGTAAACTCTTT
GAGAAGGACGAGCAGAACGCCTGAAAATATGCCTTTCCCTTCAGGTTTGTCTGTGGATAC
CGCTTATTGATTTGAAAGGGCAAGCTGCCAACAGGCTGTTTGCAAAACTCAGGAGGTAAG
CAATGAGGACACTACTTTCGGTGAAGTGGGGGAGTTAAAGTCACCTGCTATGCAGGTGAC
TTTATCCAGGCGAACGCGTTATCAGAACGCGTAGTTAAAGTTAGTACCGAACAGCCAGGC
TTTACCTTCAGACTCGAACTGGTATGGGCCTTCGTTAATTTTCACGCTCTGACCGTGCAT
ATAAGAAACACCAACGTCGACTGAAGCATCTTTATTAAATGCGTAAGTCGTACCTGCACT
CAGCCAGAAACGGTCCTGGTCCGGAATGGAGATAGAACGATTCTGTGCAGGAACTGGGCT
GTCATCAAAGGCGATACCGGTACGGAAGGTCCAGTTATCATCGTAGTAATAAGTGGTACC
CAACGCGATGCGGTAAGCATCTTTAAAGCCTTCATGTTTCTGGAACAGCGTGTCGCCACT
GGTTGAGGTCGCTTTCAGCTGCTGGAACTGACTCCAGCTGGTGTAAGCCAGGCTATAGTG
AATCGCCCACTGTGGATCAACACGGTTATAACCTGACACTTCCCACATTTCAGGCAGGTT
CAGCGTCAGATAACCCGATTGCGTTGCGCCACCTGTCGCGGTAGGAATTGGCAAACCGTA
GTTATTAAACGCACGATTAAGATCGCTGCTGTAGTTACCTTTGAAGTCAATTTTCACTTC
AGAACGGTAGGTCAGTGCATAGCGGTTATTTTTATCCAGTTCATACAGGATTCCGGCGTT
CCAGCCAAAGCCCCACTGGTTACCGTTCAGATGAGCGATTTTGGTATTACTGTCAATACC
GTTGGCGGTAGCTGCCAATGCTTGCCCTTGCTGAGTTTGGCCAGCAGGAGATTGCATAAT
TTGGCCAGCAACCAACTGCCCCAGATCGCCTGCGAAACGTTCAATTTTCGCGCGAGCGTA
GACGGCGTTGAAACCAAGACCAAAGCTCCATGCATTATTTAAGCGATACGCACCGCTTAA
GTTCAGGTTCATGGTTTCAAGGTCGGTTGTACCCCCGACAGAGCCGCCTGCATAAGTATC
GTTAAACTCTGTAGCCAGACCATAGTTAGAGGTAATAGAAGCGCCCCAACCAAATTGGTC
GTTAATCGGTGCAACAAAGTGCATGTTCGGAACCCATGCCGTAGGCGCGATGTTATCGGC
TTTCAGGCTACGACCAGATGGAGACGTTCCGCTGATATTTACATCCGGGTCAATATAAAC
CGCACCCGCAGAAAATGTCGGGCGGTCAAACATAGTAATCAATGCGGGGTTACGGCTGAC
GTTACCTGCATCATCGGCAATTGCGCCTTCCCCTGAATAAGCCCGGCCCAGGCCAGAGGA
AGAAAATTCGTTTAACTGAAAGCCTGCCGACCAGGCCTGGGTGGAGATAAGTGCCACTGC
GACTGCGAGAGCAGACTTTGTAAACAGGGTTTTCTGGCTCATGACCATAACCTCAATGAT
TTATTTTTATACAAACTATGTTACGTGCTGTAACAGGAGCGCGAAGTGTAGGGTCTGAGG
TACATCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTGGAATGTTGCAA
GTATGTTTCTATCTTTTTTCAAATATGATCTAAGAAACGCGATCCAGCTGGCAAAATTTG
GAGGTGGCGCACTCATGGATTCGGGTGAATTTTGTTTTAGATCATTTTTAAGTGTGATTT
CGGTCACTTATCCGATTTTGCAGAATTAACAACTGGAGCAGCACTTTCCGGAAGCGTAAA
ATATCCACAACGTTTATCTGGCACCTTGGGTGCACATACAGAGGAAATCAACGATGAGTA
AATGTAGTGCTGATGAAACCCCGGTTTGCTGCTGTATGGATGTTGGCACCATTATGGACA
ACTCCGACTGCACCGCGTCTTACAGCCGCGTGTTTGCAAACCGCGCAGAAGCAGAGCAAA
CGCTGGCGGCGCTGACTGAAAAAGCCCGTAGCGTGGAATCTGAACCTTGCAAAATCACCC
CGACTTTCACTGAAGAGTCTGACGGTGTGCGCCTGGATATCGATTTCACTTTTGCCTGCG
AAGCTGAAATGCTGATTTTCCAGCTGGGTCTGCGTTAATTCCTCTCGGGTACGTACGCCC
CTGTCAGTTGCTGGCAGGGGCGTTTTCTTTTCTCTTCTTCTTTTCTCTCTGTGTCATAGC
TCCCACTTTCCCTTTTCTCCACTTGGCTAAATGTAAAAAAATGGTTAAGACTATGATCAG
GTCAGACCACTTTATTTATTTTTTTACAGGGGAGTGTTATGGGTCAGGTTTTACCGCTGG
TTACCCGCCAGGGCGATCGTATCGCCATTGTTAGCGGTTTACGTACGCCTTTTGCCCGTC
AGGCGACGGCTTTTCATGGCATTCCCGCGGTTGATTTAGGGAAGATGGTGGTAGGCGAAC
TGCTGGCACGCAGCGAGATCCCCGCCGAAGTGATTGAACAACTGGTCTTTGGTCAGGTCG
TACAAATGCCTGAAGCCCCCAACATTGCGCGTGAAATTGTTCTCGGTACGGGAATGAATG
TACATACCGATGCTTACAGCGTCAGCCGCGCTTGCGCTACCAGTTTCCAGGCAGTTGCAA
ACGTCGCAGAAAGCCTGATGGCGGGAACTATTCGAGCGGGGATTGCCGGTGGGGCAGATT
CCTCTTCGGTATTGCCAATTGGCGTCAGTAAAAAACTGGCGCGCGTGCTGGTTGATGTCA
ACAAAGCTCGTACCATGAGCCAGCGACTGAAACTCTTCTCTCGCCTGCGTTTGCGCGACT
TAATGCCCGTACCACCTGCGGTAGCAGAATATTCTACCGGCTTGCGGATGGGCGACACCG
CAGAGCAAATGGCGAAAACCTACGGCATCACCCGAGAACAGCAAGATGCATTAGCGCACC
GTTCGCATCAGCGTGCCGCTCAGGCATGGTCAGACGGAAAACTCAAAGAAGAGGTGATGA
CTGCCTTTATCCCTCCTTATAAACAACCGCTTGTCGAAGACAACAATATTCGCGGTAATT
CCTCGCTTGCCGATTACGCAAAGCTGCGCCCGGCGTTTGATCGCAAACACGGAACGGTAA
CGGCGGCAAACAGTACGCCGCTGACCGATGGCGCGGCAGCGGTGATCCTGATGACTGAAT
CCCGGGCGAAAGAATTAGGGCTGGTGCCGCTGGGGTATCTGCGCAGCTACGCATTTACTG
CGATTGATGTCTGGCAGGACATGTTGCTCGGTCCAGCCTGGTCAACACCGCTGGCGCTGG
AGCGTGCCGGTTTGACGATGAGCGATCTGACATTGATCGATATGCACGAAGCCTTTGCAG
CTCAGACGCTGGCGAATATTCAGTTGCTGGGTAGTGAACGTTTTGCTCGTGAAGCACTGG
GGCGTGCACATGCCACTGGCGAAGTGGACGATAGCAAATTTAACGTGCTTGGCGGTTCGA
TTGCTTACGGGCATCCCTTCGCGGCGACCGGCGCGCGGATGATTACCCAGACATTGCATG
AACTTCGCCGTCGCGGCGGTGGATTTGGTTTAGTTACCGCCTGTGCTGCCGGTGGGCTTG
GCGCGGCAATGGTTCTGGAGGCGGAATAATGGAAATGACATCAGCGTTTACCCTTAATGT
TCGTCTGGACAACATTGCCGTTATCACCATCGACGTACCGGGTGAGAAAATGAATACCCT
GAAGGCGGAGTTTGCCTCGCAGGTGCGCGCCATTATTAAGCAACTCCGTGAAAACAAAGA
GTTGCGAGGCGTGGTGTTTGTCTCCGCTAAACCGGACAACTTCATTGCTGGCGCAGACAT
CAACATGATCGGCAACTGCAAAACGGCGCAAGAAGCGGAAGCTCTGGCGCGGCAGGGCCA
ACAGTTGATGGCGGAGATTCATGCTTTGCCCATTCAGGTTATCGCGGCTATTCATGGCGC
TTGCCTGGGTGGTGGGCTGGAGTTGGCGCTGGCGTGCCACGGTCGCGTTTGTACTGACGA
TCCTAAAACGGTGCTCGGTTTGCCTGAAGTACAACTTGGATTGTTACCCGGTTCAGGCGG
CACCCAGCGTTTACCGCGTCTGATAGGCGTCAGCACAGCATTAGAGATGATCCTCACCGG
AAAACAACTTCGGGCGAAACAGGCATTAAAGCTGGGGCTGGTGGATGACGTTGTTCCGCA
CTCCATTCTGCTGGAAGCCGCTGTTGAGCTGGCAAAGAAGGAGCGCCCATCTTCCCGCCC
TCTACCTGTACGCGAGCGTATTCTGGCGGGGCCGTTAGGTCGTGCGCTGCTGTTCAAAAT
GGTCGGCAAGAAAACAGAACACAAAACTCAAGGCAATTATCCGGCGACAGAACGCATCCT
GGAGGTTGTTGAAACGGGATTAGCGCAGGGCACCAGCAGCGGTTATGACGCCGAAGCTCG
GGCGTTTGGCGAACTGGCGATGACGCCACAATCGCAGGCGCTGCGTAGTATCTTTTTTGC
CAGTACGGACGTGAAGAAAGATCCCGGCAGTGATGCGCCGCCTGCGCCATTAAACAGCGT
GGGGATTTTAGGTGGTGGCTTGATGGGCGGCGGTATTGCTTATGTCACTGCTTGTAAAGC
GGGGATTCCGGTCAGAATTAAAGATATCAACCCGCAGGGCATAAATCATGCGCTGAAGTA
CAGTTGGGATCAGCTGGAGGGCAAAGTTCGCCGTCGTCATCTCAAAGCCAGCGAACGTGA
CAAACAGCTGGCATTAATCTCCGGAACGACGGACTATCGCGGCTTTGCCCATCGCGATCT
GATTATTGAAGCGGTGTTTGAAAATCTCGAATTGAAACAACAGATGGTGGCGGAAGTTGA
GCAAAATTGCGCCGCTCATACCATCTTTGCTTCGAATACGTCATCTTTACCGATTGGTGA
TATCGCCGCTCACGCCACGCGACCTGAGCAAGTTATCGGCCTGCATTTCTTCAGTCCGGT
GGAAAAAATGCCGCTGGTGGAGATTATTCCTCATGCGGGGACATCGGCGCAAACCATCGC
TACCACAGTAAAACTGGCGAAAAAACAGGGTAAAACGCCAATTGTCGTGCGTGACAAAGC
CGGTTTTTACGTCAATCGCATCTTAGCGCCTTACATTAATGAAGCTATCCGCATGTTGAC
CCAAGGTGAACGGGTAGAGCACATTGATGCCGCGCTAGTGAAATTTGGTTTTCCGGTAGG
CCCAATCCAACTTTTGGATGAGGTAGGAATCGACACCGGGACTAAAATTATTCCTGTACT
GGAAGCCGCTTATGGAGAACGTTTTAGCGCGCCTGCAAATGTTGTTTCTTCAATTTTGAA
CGACGATCGCAAAGGCAGAAAAAATGGCCGGGGTTTCTATCTTTATGGTCAGAAAGGGCG
TAAAAGCAAAAAACAGGTCGATCCCGCCATTTACCCGCTGATTGGCACACAAGGGCAGGG
GCGAATCTCCGCACCGCAGGTTGCTGAACGGTGTGTGATGTTGATGCTGAATGAAGCAGT
ACGTTGTGTTGATGAGCAGGTTATCCGTAGCGTGCGTGACGGGGATATTGGCGCGGTATT
TGGCATTGGTTTTCCGCCATTTCTCGGTGGACCGTTCCGCTATATCGATTCTCTCGGCGC
GGGCGAAGTGGTTGCAATAATGCAACGACTTGCCACGCAGTATGGTTCCCGTTTTACCCC
TTGCGAGCGTTTGGTCGAGATGGGCGCGCGTGGGGAAAGTTTTTGGAAAACAACTGCAAC
TGACCTGCAATAAGAAGGTCAAAGCTATATGAATCCGCGCTGAATGGCGGAGTGTTGGTC
AAAATGTAAACGCATATTGACTATACTTACGCCATTGAGGTAAAAAACAGCGTTTCATTC
GGTGAATGGATAAGGCACAATGCCGGCCACCGTTTTCTTTCTCTGGTTTCAGATGAAAGA
AAACGGGCGAATCTGGTTAACAAAAGCGGTGCAATATGCAAGTTTTTATCATGCGTCACG
GCGACGCAGCCCTCGATGCCGCCAGTGATTCCGTTCGTCCTCTGACCACTAATGGTTGTG
ACGAATCTCGCCTGATGGCGAACTGGCTGAAAGGTCAAAAAGTGGAAATCGAACGCGTTC
TGGTGAGCCCGTTCCTGCGAGCCGAGCAAACACTGGAAGAAGTAGGGGATTGTCTGAACC
TGCCTTCCAGTGCAGAAGTTCTGCCGGAGTTAACGCCCTGCGGCGATGTTGGTCTGGTCA
GTGCCTATTTGCAGGCGTTGACCAATGAAGGTGTTGCTTCGGTACTGGTGATCTCTCACT
TACCGTTAGTCGGGTATCTGGTTGCCGAGTTATGTCCGGGCGAAACGCCGCCTATGTTTA
CCACCTCGGCCATTGCCAGCGTAACGCTTGATGAAAGCGGAAACGGCACATTCAACTGGC
AGATGAGCCCGTGTAATCTGAAGATGGCAAAAGCTATCTGATGAGTTCCAAATTATGCCC
AATGAGGTAGATTCATTGGGCATAATTGCTCATCAGGCAGCGGATATCTGTCAACCTCAC
TACTATCGAAGACTCTCCCCATCTATAAATAAAACACCTTTAACTTTCATTCGGAAAGTA
TTCTTCTGCGCGTATCTTGATTTTGCCCAAAGTTACATGTTGAAATGAATAATGTCTGTT
TGACACTCATTATCATTTATTAATACAGATAATGGAGAAAATAGAGTTGAATAATCAGGC
AGGACGTAATTGAAACTTGATTAAATTCTGGCTATAGTGTTTATATATTATATCGACAAA
AGCGGGTTAATGCCAATCGCATTATATGTTCATTGTTTGTTTTTTAAGCTATTGGCATTC
ATTGTTGATATGCTTCCTGTTTTTTCTAAATATATATTTCGTGTTTTTTTAGAAGATCCT
TAAGATAATCTTTCCCCTATCAATATATTAATTAAATCTACATTTACTCATTAGTAAAAT
TAAATTGAATCAGGGGAGTGAAAACATCACTATTCGACCCCACACCAACGAATACATTTT
TTACGACCTGTTTTTTTGGATCGCATGCCGTATTCAATGGCTGGGTATAAACATTGGCTA
TTGACTGAATCAATGTATTGCAATGTTTATATTTTAATTATTTATAGTTTAAGGACAAAT
AATGAGTAAGTTTGTTAAAACAGCTATTGCTGCGGCAATGGTGATGGGCGCGTTCACCTC
TACGGCAACAATCGCTGCGGGTAACAACGGTACTGCACGTTTTTACGGCACCATTGAAGA
CTCAGTGTGTTCTATCGTTCCGGACGATCACAAACTGGAAGTTGATATGGGTGATATCGG
TGCCGAAAAACTGAAAAATAACGGCACCACCACGCCGAAAAATTTCCAGATTCGCCTGCA
AGATTGCGTATTTGATACTCAGGAAACAATGACCACTACCTTTACTGGTACCGTTTCTTC
TGCAAATAGCGGCAATTATTACACCATTTTCAATACCGATACCGGTGCGGCATTTAACAA
TGTTAGCCTGGCGATCGGTGACTCTCTGGGTACCTCTTACAAAAGCGGCATGGGTATTGA
CCAGAAAATCGTGAAAGATACTGCCACTAATAAAGGCAAAGCGAAGCAGACTCTGAACTT
TAAAGCCTGGCTGGTCGGCGCAGCTGATGCGCCAGATCTGGGTAATTTCGAAGCAAATAC
CACCTTCCAGATTACTTACCTGTAAGGCATACCCCCATAGCGACACTGCTATGGGGTATT
TAAATGGATTTTGACCGAACAAGAATAAAAACGGATAAAAACGTGTATGCCTGACCATTC
TCTTTTTCGATTACGGATTCTTCCGTGGTGCATTGCGCTGGCAATGTCAGGGAGTTATAG
CAGTGTCTGGGCTGAAGACGACATTCAGTTTGATTCCCGTTTTCTGGAATTAAAAGGCGA
CACAAAAATTGATCTGAAGCGTTTTTCCAGCCAGGGGTATGTTGAGCCCGGAAAATACAA
TTTACAGGTTCAACTAAATAAACAGCCATTGGCGGAAGAGTACGATATTTACTGGTATGC
TGGTGAAGATGACGTTAGCAAAAGCTATGCTTGTCTGACACCGGAACTGGTGGCGCAGTT
TGGTTTAAAAGAAGACGTGGCGAAAAATCTGCAATGGAGCCACGATGGTAAATGCCTGAA
GCCCGGTCAACTGGAAGGCGTGGAAATTAAGGCTGATTTAAGCCAGTCCGCATTAGTCAT
TTCACTACCGCAGGCTTACCTCGAATATACCTGGCCCGACTGGGATCCACCTTCTCGTTG
GGATGATGGCATCTCCGGGATCATTGCGGACTACAGCATCACTGCGCAAACACGACACGA
AGAAAATGGCGGCGATGACAGTAACGAGATCAGCGGCAACGGGACGGTCGGGGTTAACCT
GGGGCCATGGCGTATGCGCGCTGACTGGCAGACCAACTATCAACATACGCGCAGTAATGA
TGATGACGATGAATTTGGCGGCGATGACACACAAAAAAAATGGGAGTGGAGTCGCTATTA
TGCCTGGCGGGCGTTACCGTCATTAAAAGCCAAACTGGCGCTGGGCGAAGATTACCTCAA
TTCCGATATTTTCGACGGTTTTAATTATGTTGGTGGCAGTGTCAGCACTGACGATCAAAT
GTTGCCTCCCAATCTGCGCGGCTACGCGCCAGACATTTCCGGCGTGGCACACACCACAGC
AAAAGTGACCGTCAGCCAGATGGGGCGTGTGATTTACGAAACGCAGGTTCCGGCTGGACC
GTTTCGTATTCAGGATCTTGGTGATTCCGTCTCCGGTACGTTGCATATTCGCATTGAAGA
ACAGAACGGCCAGGTGCAGGAATATGACATCAGCACCGCCTCGATGCCATACCTCACTCG
CCCAGGCCAGGTTCGCTATAAGATCATGATGGGACGTCCGCAAGAGTGGGGCCACCATGT
CGAGGGGGGATTTTTCTCTGGTGCTGAAGCCTCCTGGGGCATCGCTAACGGCTGGTCGTT
ATATGGCGGTGCGCTGGGTGATGAAAACTATCAGTCTGCGGCGCTGGGCGTCGGTCGCGA
TTTGTCTACCTTCGGCGCGGTCGCGTTTGATGTTACTCATTCGCATACCAAACTGGATAA
AGACACCGCTTATGGCAAAGGTTCGCTGGACGGTAACTCCTTCCGTGTGAGTTATTCCAA
AGACTTTGACCAGCTCAACAGCCGCGTCACTTTCGCTGGATATCGCTTCTCGGAAGAGAA
CTTTATGACCATGAGCGAGTATCTGGATGCCAGTGACAGCGAAATGGTCCGTACGGGCAA
CGACAAAGAGATGTACACCGCCACTTATAACCAGAACTTCCGCGATGCGGGTGTTTCGGT
TTATCTCAACTATACCCGCCATACCTACTGGGATCGTGAGGAGCAGACAAACTACAACAT
CATGCTCTCCCACTATTTCAATATGGGCAGCATTCGTAATATGAGCGTTTCCCTGACTGG
CTACCGCTACGAGTATGACAACCGGGCGGATAAGGGCATGTAGATTTCGCTCAGTATGCC
GTGGGGCGACAACAGTACCGTTAGCTATAACGGCAACTATGGCAGTGGGACGGACAGCAG
CCAGGTCGGTTATTTTAGCCGTGTCGATGACGCGACTCACTATCAGTTGAACATCGGCAC
CAGTGACAAACACACCAGCGTTGATGGCTACTACAGCCATGATGGTTCGCTGGCGCAGGT
TGACCTCAGTGCGAACTACCATGAAGGGCAATACACCTCTGCGGGCTTGTCGTTACAGGG
CGGCGCAACGCTTACTACCCACGGCGGCGCACTTCACCGTACCCAGAATATGGGCGGGAC
ACGCCTGCTGATTGATGCCGATGGCGTTGCCGATGTTCCGGTGGAAGGTAACGGGGCTGC
TGTTTATACCAATATGTTTGGTAAAGCCGTCGTTTCTGACGTTAACAATTATTATCGCAA
TCAGGCGTATATCGACCTCAACAAATTGCCGGAAAACGCCGAAGCAACCCAGTCGGTGGT
GCAAGCCACGCTAACTGAAGGAGCCATTGGCTACCGCAAATTTGCCGTCATCAGTGGTCA
AAAAGCGATGGCGGTGCTGCGTTTACAAGATGGCAGCCATCCACCGTTTGGCGCAGAAGT
AAAAAATGATAACGAGCAGACAGTGGGCCTTGTCGATGATGACGGTAGTGTCTATCTGGC
TGGGGTGAAACCTGGCGAACATATGAGTGTGTTCTGGAGTGGTGTTGCGCATTGCGATAT
CAACCTGCCGGACCCGCTGCCTGCCGATCTGTTTAACGGCTTGTTACTGCCATGCCAGCA
TAAAGGCAACGTCGCGCCGGTTGTTCCTGATGACATAAAGCCTGTCATTCAGGAGCAGAC
GCAACAGGTGACACCCACCGATCCCCCTGTTTCTGTTTCAGCTAACCAATAACGTGATTA
AGGAATGATCCATGTCTGATTTACTTTGCTCTGCCAAATTGGGTGCTATGACGCTGGCGT
TACTGCTTAGCGCTACCAGTTTGTCTGCCCTGGCGTCTGTAACGCCAGATCGTACCCGTT
TGATATTTAATGAAAGCGACAAATCAATCAGCGTGACGCTGCGTAATAACGATCCGAAAC
TCCCTTATCTGGCTCAAAGCTGGATTGAAGATGAAAAGGGTAACAAGATCACCTCGCCGT
TAACTGTGCTGCCGCCAGTGCAACGCATCGATTCAATGATGAACGGGCAGGTAAAAGTGC
AGGGAATGCCGGATATCAACAAATTGCCAGCCGATCGTGAAAGCATGTTCTACTTTAACG
TGCGCGAGATCCCGCCAAAATCAAACAAACCCAATACCCTGCAAATCGCGCTGCAAACGC
GTATCAAGTTGTTCTGGCGACCAAAGGCGCTGGAAAAGGTCAGTATGAAAAGTCCGTGGC
AGCACAAGGTGACGCTCACCCGCAGCGGTCAGGCATTTACCGTCAATAACCCAACGCCGT
ACTACGTGATTATCAGCAACGCCAGTGCGCAGAAAAACGGTAATCCAGCTGCAGGGTTCT
CGCCTCTGGTCATTGAGCCGAAAACCACGGTACCGCTGAATGTGAAAATGGATAGCGTAC
CGGTGCTGACTTACGTCAACGACTTTGGCGCACGGATGCCGCTGTTCTTCCAGTGCAATG
GCAACAGCTGCCAGGTGGATGAAGAGCAGAGCCGCAAAGGCTGATGACGGGGGGAGTTAT
GAGTCAAAAGTTTGTAGTGGGCGCAGGGCTGCTGGTATGCAGTGTCTGTAGTTTATCTGC
TATGGCTGGTAGTAAACCCGTGGATTTAATTCTGCGCGTGTTGGTCGATGCTCCGCCACC
CTGTTCAATCAAGGGCAGCCAGGTAGAGTTCGGCAATATGATTGCTGATAACGTTGATGG
CACCAATTATCGGCAAGATGCGAAATACACGTTGAACTGCACAAACAGTCTTGCTAACGA
CTTGCGGATGCAACTTAAGGGCAATACCTCAACGATTAACGGCGAAACGGTACTCAGTAC
CAATATCACCGGGCTGGGCATTCGGATAGAAAATAGCGCCGATAACTCATTGTTTGCCGT
CGGTGAAAATAGCTGGACGCCATTTAATATCAATAACCAGCCACAGTTGAAGGCTGTACC
TGTGAAGGCAAGCGGGGCGCAACTTGCTGCGGGCGAGTTTAACGCCAGTTTGACCATGGT
GGTGGACTATCAATGAGAAAGACTTTCTTAACCCTGCTTTGTGTCAGTAGCGCCATAGCT
CATGCTGCTGATGAAGACATCACCTTTCACGGGACATTATTGTCACCGCCAACCTGTAGC
ATCAGCGGTGGTAAAACCATTGAAGTCGAATTTCGCGATCTCATTATCGACGACATCAAC
GGCAACTATGGTCGTAAAGAGGTGCCATATGAACTCACTTGTGACTCGACGACCCGTCAT
CCAGATTGGGAGATGACCCTCACCTGGACTGGTACACAAACCAGTTTTAATGATGCAGCA
ATTGAAACTGATGTACCCGGTTTTGGTATCGAGCTTCAGCACGATGGTCAGCGTTTTAAA
CTCAATACTCCGCTTGCTATCAACGCCACTGATTTTACGCAAAAGCCGAAGCTGGAGGCC
GTACCGGTAAAAGCGAGTGATGCTGTGTTAAGCGATACGAATTTTTCGGCTTACGCAACA
TTACGGGTGGATTATCAATGAATAAATCAATGATTCAGTCCGGTGGTTACGTCCTGTTAG
CGGGGCTGATATTGGCAATGAGTAGCACGTTATTCGCGGCAGATAATAATCTGCATTTCT
CCGGTAATTTATTAAGTAAATCCTGTGCGCTGGTGGTGGATGGCCAATATCTGGCAGAGG
TGCGCTTTCCCACGGTCAGTCGTCAGGATTTGAACGTTGCAGGCCAGTCCGCTCGTGTAC
CCGTAGTCTTTAAGCTGAAAGATTGCAAAGGGCCGGCGGGATACAACGTAAAAGTCACGC
TCACGGGGGTAGAAGACAGCGAACAACCCGGTTTTCTGGCACTGGATACGTCATCAACCG
CTCAGGGAGTGGGAATTGGCATGGAAAAAACCGACGGAATGCAGGTTGCCATCAACAATA
CAAATGGGGCGACCTTTGCGCTAACCAATGGCAATAACGATATCAATTTCAGAGCCTGGC
TACAGGCGAAAAGCGGCCGTGATGTGACGATCGGTGAATTTACCGCCTCTTTAACTGCGA
CATTTGAGTATATTTAAAATGAAAATACTACGATGGTTGTTCGCTCTGGTCATGCTTATT
GCTACTACAGAAGCTATGGCTGCCGGGCATAGCGTTGACGTTTACTACGGTTACAACGGT
GATTCGCGTAATATTGCGACTTTTAATTTAAAAATAATGATGCCATCCGCAGTGTACGTT
GGTGAATATAAAAGTAGTCAATGGCTCATGACTGGGGAAATATTGCAAAATGTGAGCTGG
AGTGGTCCTCCTCCTGCCCCTTCGGTTAAGCTGATTGGCTACCATCAAAATATCAACAAA
GCAAGTTGTCCTGGATTACCGTCTGGGTGGAACTGCGGGTATTATACATTTGAGGTTATT
GTCTCTGCAGAGATTGAATCTTACTTTTCTTGTCCATGGTTGGTTATTATGAATGACTCT
GAAGCCTCTCCAGGGGGCGTGACGTATCAGGGGCCTGATAGTCACGACACGATTTGTCCA
TCCGTTTCTGTTCAACCTTATGACGTTTCATGGAATGAGAATTATGTCAGTAAGTCAAAA
CTGCTCACCCTGCAGTCGACGGGCGGTGTGGTTGAGAAAACGCTTTCAACGTATTTGATG
AAAGATGGGAAGTTGTGCGACAGTACGCAGATGAATGAAACAGGTGGTTACTGCCGCTGG
GTTGCACAGATGATAACTTTTACCGCGTCGGGATGTGACAAGGCGGAAGTCTCGGTCACG
CCAAATCGACACCCTATAACGGACAAACAGTTACACGATATGGTCGTGCGTGTTGATACC
AGCAGTATGCAGCCAATCGATTCTACTTGCCGGTTCCAGTACATACTGAATGAGTTGTAG
CCCTTAGATACACCAGGCAGGGGCATTCGCCCCTGCCATTACCCGTACCTGGCGCAACGC
GCTCAACTCCTCAGGGCAACTCCGGCGGCAGCCACTCTTCGACTTCAATCAACACCAACA
ACGCCGCATCACCGCCATACTCTTTTGGTGCCTGATGAAAGGCCATCACATGCGGATGTT
GTGCCAGCCACAGCGGTGTTTGTTGCTTCAAAATATGCTTCCCGTGCCCATGCATCACGC
AGGCGCAAAACACATGTTCACGGCGGCAGGCGGCAATCAACGCCCCCAGTTCCTGCTTGG
CCTGCAGCTGCGTCAGACCGTGTAAATCCAAAAACAACTCCGGCGAATAATCGCCACGGC
GCAGTTTCTTCGCCTCAAAATGGCTGACATCCGGGCGAACATATTTCACCGGACCTTCGG
TATTTAATAACGGCTGAAACTCATCGGAGAAATAATGGCTGGCATCAGCCTGCTCCTGGA
TCAAGCGTTTCACCGGCACTTCGCTGATTTTTTTACGCTGCGGTCGGTGGACAATCGTGT
CCTGCTTAATCTTGCGAGTCCCCGCCATCAACTGGCGAAACAGAGCCTGGTCCTCCTCGC
TAAGTGTTGTTTTCTTTTTCATTTATCTGTCTCTATTTCTAATTTTCCTACAGTTTACCC
GACTCGTAGCGCAATCGATCGTTTTAAACGTATTTTTCCTCACTCACCGCGCGTGAATGC
TGATTTATCGTCATCTTCATGGCAAACTAGCCGCCGAAATTATTGCGATCATGCCCTGGA
GGAATACGTGGATAAAATTTTCGTTGATGAAGCAGTAAATGAGCTGCAAACCATTCAGGA
CATGTTGCGCTGGTCGGTGAGCCGCTTCAGCGCGGCAAATATCTGGTACGGTCACGGTAC
CGATAACCCGTGGGATGAAGCCGTACAGCTGGTGTTGCCTTCGCTCTACCTGCCGCTGGA
TATTCCGGAAGATATGCGCACCGCGCGTCTGACCTCCAGCGAAAAACACCGTATTGTTGA
ACGCGTGATCCGCCGCGTCAATGAACGCATTCCGGTGGCTTACCTGACCAACAAAGCGTG
GTTCTGCGGCCATGAATTTTACGTCGATGAACGCGTGCTGGTGCCGCGCTCGCCGATTGG
TGAACTGATCAACAATAAATTTGCCGGACTTATCAGCAAGCAACCGCAGCATATTTTAGA
TATGTGTACTGGTAGCGGCTGCATCGCCATTGCCTGTGCTTATGCCTTCCCGGATGCAGA
AGTCGACGCGGTGGATATCTCTCCAGACGCGCTGGCGGTTGCTGAACAGAACATCGAAGA
ACACGGTCTGATCCACAACGTCATTCCGATTCGTTCCGATCTGTTCCGCGACTTGCCGAA
AGTGCAGTACGACCTGATTGTCACTAACCCGCCGTATGTCGATGCGGAAGATATGTCCGA
CCTGCCAAACGAATACCGCCACGAGCCGGAACTGGGCCTGGCATCTGGCACTGACGGCCT
GAAACTGACGCGTCGCATTCTCGGTAACGCGGCAGATTACCTTGCTGATGATGGCGTGTT
GATTTGTGAAGTCGGCAACAGCATGGTACATCTTATGGAACAATATCCGGATGTTCCGTT
CACCTGGCTGGAGTTTGATAACGGCGGCGATGGTGTGTTTATGCTCACCAAAGAGCAGCT
TATTGCCGCACGAGAACATTTCGCGATTTATAAAGATTAAGTAAACACGCAAACACAACA
ATAACGGAGCCGTGATGGCTGGAAACACAATTGGACAACTCTTTCGCGTAACCACCTTCG
GCGAATCGCACGGGCTGGCGCTCGGCTGCATCGTCGATGGTGTTCCGCCAGGCATTCCGC
TGACGGAAGCGGACCTGCAACATGACCTCGACCGTCGTCGCCCTGGGACATCGCGCTATA
CCACCCAGCGCCGCGAGCCGGATCAGGTCAAAATTCTCTCCGGTGTTTTTGAAGGCGTTA
CTACCGGCACCAGCATTGGCTTGTTGATCGAAAACACTGACCAGCGCTCTCAGGATTACA
GTGCGATTAAGGACGTTTTCCGTCCAGGCCATGCCGATTACACCTACGAACAAAAATACG
GTCTGCGCGATTATCGCGGCGGTGGACGTTCTTCCGCCCGCGAAACCGCCATGCGCGTGG
CGGCAGGAGCTATTGCCAAAAAATATCTCGCCGAGAAATTTGGTATTGAAATCCGTGGCT
GCCTGACCCAGATGGGCGACATTCCGCTGGATATCAAAGACTGGTCGCAGGTCGAGCAAA
ATCCGTTTTTTTGCCCGGACCCCGACAAAATCGACGCGTTAGACGAGTTGATGCGTGCGC
TGAAAAAAGAGGGCGACTCCATCGGCGCTAAAGTCACCGTTGTTGCCAGTGGCGTTCCTG
CCGGACTTGGCGAGCCGGTCTTTGACCGCCTGGATGCTGACATCGCCCATGCGCTGATGA
GCATCAACGCGGTGAAAGGCGTGGAAATTGGCGACGGCTTTGACGTGGTGGCGCTGCGCG
GCAGCCAGAACCGCGATGAAATCACCAAAGACGGTTTCCAGAGCAACCATGCGGGCGGCA
TTCTCGGCGGTATCAGCAGCGGGCAGCAAATCATTGCCCATATGGCGCTGAAACCGACCT
CCAGCATTACCGTGCCGGGTCGTACCATTAACCGCTTTGGCGAAGAAGTTGAGATGATCA
CCAAAGGCCGTCACGATCCCTGTGTCGGGATCCGCGCAGTGCCGATCGCAGAAGCGATGC
TGGCGATCGTTTTAATGGATCACCTGTTACGGCAACGGGCGCAAAATGCCGATGTGAAGA
CTGATATTCCACGCTGGTAAAAAATGAATAAAACCGCGATTGCGCTGCTGGCTCTGCTTG
CCAGTAGCGCCAGCCTGGCAGCGACGCCGTGGCAAAAAATAACCCAACCTGTGCCGGGTA
GCGCACAATCGATAGGCAGTTTTTCTAATGGCTGTATTGTCGGCGCTGACACGCTGCCGA
TACAGTCCGAACATTATCAGGTCATGCGTACCGATCAGCGTCGCTATTTCGGTCACCCGG
ATCTGGTGATGTTTATCCAGCGTCTGAGTAGCCAGGTGAGCAATCTGGGCATGGGTACGG
TGCTGATTGGCGATATGGGGATGCCCGCTGGTGGGCGTTTCAACGGCGGTCATGCCAGCC
ACCAGACCGGACTGGATGTCGATATCTTTCTGCAACTGCCGAAAACTCGCTGGACCTCCG
CGCAGCTCTTGCGCCCGCAAGCACTGGACTTAGTTTCCCGCGACGGTAAACACGTTGTCT
CCACGCTGTGGAAGCCAGAAATTTTCAGCTTGATCAAACTCGCCGCCCAGGACAAAGACG
TCACGCGCATTTTTGTTAATCCGGCGATTAAACAACAACTTTGCCTTGATGCGGGCACCG
ATCGCGACTGGTTGCGCAAAGTGCGACCCTGGTTCCAGCATCGCGCGCATATGCATGTAC
GATTACGTTGCCCTGCCGATAGTCTGGAGTGTGAAGATCAACCTTTACCGCCATCAGGCG
ATGGTTGCGGGGCAGAACTGCAAAGCTGGTTTGAACCTCCAAAACCGGGAACAACAAAGC
CTGAGAAGAAGACACCGCCTCCGTTGCCGCCTTCCTGCCAGGCGCTACTGGATGAGCACG
TGATCTAATGGAAACGTTTAATAGCCTGTTTATGGTTTCCCCGCTGTTGCTGGGAGTTCT
CTTTTTTGTCGCCATGCTGGCGGGATTTATCGACTCGATTGCCGGTGGCGGTGGGTTACT
CACCATTCCGGCATTGATGGCAGCGGGGATGTCTCCCGCTAATGCGCTGGCAACCAATAA
ACTGCAAGCCTGCGGCGGCTCTATTTCCGCTACTATCTACTTTATTCGCCGCAAAGTGGT
TAGTTTAAGCGATCAGAAACTCAATATCGCCATGACCTTTGTCGGCTCAATGAGCGGCGC
ACTGCTGGTGCAATACGTTCAGGCTGATGTCTTACGGCAGATTTTGCCCATTCTGGTAAT
TTGTATCGGCCTCTATTTCTTGCTGATGCCAAAGCTAGGTGAAGAAGACCGCCAGCGCCG
GATGTACGGTTTACCCTTCGCGTTAATAGCCGGTGGCTGCGTCGGTTTTTATGATGGATT
CTTTGGCCCGGCTGCCGGGTCGTTTTACGCGCTGGCCTTCGTTACGCTGTGCGGATTTAA
CCTCGCCAAAGCCACGGCTCACGCCAAATTACTCAACGCAACGTCAAACATCGGCGGTTT
ACTGCTGTTTATTCTCGGCGGCAAAGTGATTTGGGCGACGGGCTTTGTCATGCTGGTGGG
GCAGTTCCTCGGCGCGCGCATGGGTTCACGACTGGTGTTGAGCAAAGGACAAAAGCTGAT
CCGCCCGATGATTGTTATCGTCTCGGCGGTGATGAGTGCCAAATTACTTTACGACAGCCA
CGGACAGGAGATCCTCCACTGGTTGGGGATGAACTAATGAACAGTACACACCACTACGAG
CAGTTGATTGAAATTTTTAATAGCTGCTTTGCCGATGATTTTAATACCCGTCTGATTAAA
GGCGACGACGAACCGATCTATCTTCCTGCTGATGCGGAAGTACCGTATAACCGAATCGTC
TTTGCTCATGGCTTTTATGCCAGCGCAATTCATGAGATTTCGCACTGGTGTATTGCCGGG
AAAGCGCGCCGTGAGCTGGTTGATTTCGGCTACTGGTATTGCCCGGACGGACGCGATGCC
CAAACGCAAAGCCAGTTTGAAGATGTTGAAGTGAAGCCGCAGGCGCTCGACTGGTTGTTC
TGTGTGGCGGCGGGATATCCGTTTAACGTCAGTTGCGACAATCTGGAAGGGGATTTCGAA
CCGGATCGTGTGGTGTTTCAACGGCGAGTACATGCGCAGGTGATGGATTATCTGACAAAT
GGCATTCCGGAACGTCCGGCACGCTTCATTAAAGCACTACAAAATTATTATCACACGCCG
GAACTTACGGCGGAACAGTTCCCGTGGCCGGAAGCGCTCAACTGAAGCCAGCGCCACGTT
TTACAATGAGGAAAGAAGATGATCGCGGAGTTTGAATCACGCATTCTGGCATTAATCGAC
GGTATGGTTGACCATGCCAGTGATGATGAGTTGTTTGCCAGTGGGTATTTGCGTGGCCAC
CTGACATTAGCCATCGCAGAACTGGAAAGTGGTGATGACCACTCCGCTCAGGCGGTGCAT
ACGACCGTTAGCCAGAGTCTGGAAAAAGCCATTGGTGCTGGTGAATTGTCGCCGCGTGAC
CAGGCGCTGGTGACCGATATGTGGGAAAACCTGTTTCAGCAGGCGTCACAGCAGTAAGTT
GCGGCGTCTGGAGCAGCATGCCTGATGCGACGCTTATCGCGTCTTATCAGGCCTACACGT
CACACGTAGGTCGGATAAGGCGTTCACGCCGCATCCGGCAAACACTGCGAGAGCAGATTA
CCCCGCCTTAACCGCTTTACCCTTCAACAATTTCCGCACCCATAACCGATTCGGGTTTAA
CGCCGCCAGCGTACTGGCATCCATCGGAATCGGTTCGTCGCTCATCTGCGCCGCCAGAAT
CTCGGCACACAGCGGGGCAGAACACAAACCGCGAGAACCTAAAGCCGCAAACATAAAGAG
ATCGTCAAAAACCGGCGCGCTTACCGCCTCATCTTTCTGCTCCGCCAACGACGCATATTC
CACGAGTGTTGCCTCATAATCGGGAACATTGCCTACCATTGGCAGATGATCGCGGGTGGC
ACAACGCACACCGCAGCGCGCCTCTTTATCACTGACATCAACCTCTTTTGCCCACTGTGC
CTGCGGGAAACAATCAATCAACCGCTGGCGATTCTGCTGCTGATCGTCCTCACTGTACGC
CGTATCTTCGCTGCCGCGATGATAACTGGCACCAATACAATGATGTTGATTCGCCGGATT
TTGTGGCGTGAGATAACCGTCATAGCACAGCACCTGCTTCAGCTCTGCCAATTCCGGCGT
TGTCGGAATATGGCTGACCTGCCCGGCAACCGAATACACCGGGAGAGTCGACGTTTGGCT
GAATCGGCTGATTTGATGCCCGTTCGCCAGTACCACTACGCTGTGTGTTGCTTGCTGATC
TCCTGCAAAATTCAACAACCAACAGTCATCCTTACGGGATAAATTCTGTAACTGATATTG
ATAATAAATCTGCAAACCCTGCTGTTGCGCCAGTTCCAGCACATTACGGGTCAGTTCTGC
TGGGCACAGCCAACCACCTTGCGGATAAGTAATGCCGCTGCAATTTGTCGCAACGCCCGT
AATTTGTTCAACCGCATTTGCCTCAACGGCTACAGCCAGTTCTGCGGGTAAATCCATTGA
CAACATCTGTGCGATTTTATGCTGGCTTTTCTCATCCCAGCCTAACTGCGTGACGCCGCA
CCAGTCATGATCAAATTTAACGGGTAATTGGTCGTAAAACCGACGAGCAAAAGTAAACGC
ATTAGAGAAAAAGCGGTTTAGCGCCTCATCGTGTTTGCTTAATAACGGATACAGCGCCCC
CTGGCGATTGCCGGAAGCACCCAGTGCGGGGGCCTCATCCGCGCAATAAAGCGTTACCTG
CCAGCCGCGCCGTAATAGCGCCAGCGACAACAACGCGCTGGCAATACCACCGCCGATAAT
CGCCGCTTCCCGTTTGCTGCTGCCCGTGCGGTTAAACCACGGCGCGGAGCAGGGGAGCGG
TAATGTCTGTTCCATCACCCCGCAAAGCATTTCCCGTTTGCGCCCAAAGCCCTTACGTTT
TTGCATCGTGAATCCGGCGTCCTGCAAACCGCGGCGGACAAAACCGGCAGACGTAAATGT
CGCCAGCGTGCCGCCCGGACGCGCCAACCTTGCCATGGCGTTAAACAGATTTTGCGTCCA
CATATCCGGGTTTTTCGCTGGCGCAAAGCCGTCCAGAAACCAGGCATCTACTTTTTGATT
TAGCGAATCGTCCAGTTGGCTGGTCAGTTCGTTAATATCGCCAAACCATAAATCCAGCGT
CACGCGGCCTTCATCGAGCAATAAACGATGGCAACCGGGCAAGGGCATTGGCCACTGCGC
CTGAAGTTGTTCTGCCCACGGAGCCAGTTCCGGCCAGTGTTGATGCGCTAAGGCTAAATC
CGCACGGGTGAGGGGAAATTTCTCAAAACTAATGAAATGTAAGCGTTGTAATTGCGCTTG
CGGATGCGCTTCGCGAAACTGATCAAATGCCTGCCATAGCGTCAGGAAGTTTAATCCGGT
GCCGAAGCCGCTCTCTGCTACCACAAACAGAGGATGTGGATGCTCAGGAAAGCGTACCTC
TAATTGGTTGCCTCCCAGAAAAACATAACGCGTCTCTTCCAGCCCGTTATCGTTGGAAAA
ATAGACATCGTCAAAATCTCGGGAAACAGGTGTACCCTCAGCATTAAATTCGAGGTTGGC
AGGTTGTATGGAGTAGTGTTTCACGTAAGTTACTCGTCTTACAGGCGGTGGCTCGATCTT
AGCGATGTGTGTAAGGCTGCGCAAATTTCTCTATTAAATGGCTGATCGGACTTGTTCGGC
GTACAAGTGTACGCTATTGTGCATTCGAAACTTACTCTATGTGCGACTTACAGAGGTATT
GAATGAAACGTGCAGTGATTACTGGCCTGGGCATTGTTTCCAGCATCGGTAATAACCAGC
AGGAAGTCCTGGCATCTCTGCGTGAAGGACGTTCAGGGATCACTTTCTCTCAGGAGCTGA
AGGATTCCGGCATGCGTAGCCACGTCTGGGGCAACGTAAAACTGGATACCACTGGCCTCA
TTGACCGCAAAGTTGTGCGCTTTATGAGCGACGCATCCATTTATGCATTCCTTTCTATGG
AGCAGGCAATCGCTGATGCGGGCCTCTCTCCGGAAGCTTACCAGAATAACCCGCGCGTTG
GCCTGATTGCAGGTTCCGGCGGCGGCTCCCCGCGTTTCCAGGTGTTCGGCGCTGACGCAA
TGCGCGGCCCGCGCGGCCTGAAAGCGGTTGGCCCGTATGTGGTCACCAAAGCGATGGCAT
CCGGCGTTTCTGCCTGCCTCGCCACCCCGTTTAAAATTCATGGCGTTAACTACTCCATCA
GCTCCGCGTGTGCGACTTCCGCACACTGTATCGGTAACGCAGTAGAGCAGATCCAACTGG
GCAAACAGGACATCGTGTTTGCTGGCGGCGGCGAAGAGCTGTGCTGGGAAATGGCTTGCG
AATTCGACGCAATGGGTGCGCTGTCTACTAAATACAACGACACCCCGGAAAAAGCCTCCC
GTACTTACGACGCTCACCGTGACGGTTTCGTTATCGCTGGCGGCGGCGGTATGGTAGTGG
TTGAAGAGCTGGAACACGCGCTGGCGCGTGGTGCTCACATCTATGCTGAAATCGTTGGCT
ACGGCGCAACCTCTGATGGTGCAGACATGGTTGCTCCGTCTGGCGAAGGCGCAGTACGCT
GCATGAAGATGGCGATGCATGGCGTTGATACCCCAATCGATTACCTGAACTCCCACGGTA
CTTCGACTCCGGTTGGCGACGTGAAAGAGCTGGCAGCTATCCGTGAAGTGTTCGGCGATA
AGAGCCCGGCGATTTCTGCAACCAAAGCCATGACCGGTCACTCTCTGGGCGCTGCTGGCG
TACAGGAAGCTATCTACTCTCTGCTGATGCTGGAACACGGCTTTATCGCCCCGAGCATCA
ACATTGAAGAGCTGGACGAGCAGGCTGCGGGTCTGAACATCGTGACCGAAACGACCGATC
GCGAACTGACCACCGTTATGTCTAACAGCTTCGGCTTCGGCGGCACCAACGCCACGCTGG
TAATGCGCAAGCTGAAAGATTAATTCGCAGTAGGTCGGAGTAGACGCGCCAGCGTCGCAT
CCGACGTTACGCGCCAATGCGGCCTCCGGCACTAACGCAAAAGGGAACCTGATGGTTCCC
TTTTTCACATCATTGACAATCGCCGCCAGTTCCAGGCAAACTTCCCGCTTTGTCGATTTC
CTTCTGAAAAGACGTACGCGTTAAATCCTGCCAACGCACCGTAACCCTGAAACCAGAGAG
ATGAGACGGGGATACTCCTCGCCTTGCGCTGCATTCTGGAGTAATGCATGACTGCTGTAA
GCCAAACCGAAACACGATCTTCTGCCAATTTTTCGCTCTTCCGCATCGCTTTTGCGGTTT
TTCTCACCTACATGACCGTAGGGTTGCCGTTGCCGGTTATCCCGCTGTTTGTTCATCATG
AACTGGGCTATGGCAATACCATGGTCGGCATTGCCGTCGGGATTCAGTTTCTGGCTACGG
TGCTGACGCGTGGTTACGCCGGGCGACTGGCCGATCAATATGGTGCAAAACGTTCGGCGC
TTCAGGGAATGTTAGCTTGTGGTCTGGCTGGCGGCGCGTTGCTGCTGGCGGCGATTTTGC
CTGTCTCCGCACCGTTCAAATTTGCTCTGTTGGTCGTCGGGCGTTTGATTCTTGGCTTTG
GTGAAAGCCAGTTACTGACAGGCGCTCTGACCTGGGGACTAGGCATCGTAGGGCCAAAAC
ACTCTGGCAAAGTGATGTCATGGAACGGAATGGCGATTTACGGTGCCCTCGCTGTTGGTG
CTCCGCTTGGCCTGTTGATTCATAGCCATTACGGTTTTGCCGCACTGGCGATCACCACAA
TGGTATTACCCGTACTGGCGTGGGCCTGTAACGGCACAGTGCGCAAAGTACCGGCCCTGG
CGGGAGAACGTCCATCGCTGTGGAGCGTTGTCGGGCTTATCTGGAAACCAGGGTTAGGTC
TGGCACTACAAGGCGTTGGTTTTGCTGTTATCGGGACTTTCGTTTCGCTCTACTTTGCCA
GCAAAGGATGGGCGATGGCGGGCTTTACTCTTACCGCGTTTGGCGGCGCATTTGTCGTGA
TGCGCGTCATGTTTGGCTGGATGCCGGACCGTTTTGGCGGCGTGAAAGTGGCGATTGTCT
CTCTGCTTGTAGAAACGGTGGGCTTGTTGCTGCTCTGGCAAGCCCCAGGTGCATGGGTCG
CATTAGCGGGCGCGGCGTTAACCGGAGCCGGATGTTCGCTTATCTTTCCTGCGCTGGGCG
TGGAGGTGGTTAAACGCGTCCCCTCACAAGTTCGCGGCACCGCACTGGGCGGTTACGCCG
CGTTTCAGGATATCGCCCTCGGCGTCTCCGGGCCGCTGGCGGGAATGCTGGCGACCACGT
TTGGTTACTCTTCGGTATTTCTTGCCGGGGCGATCTCTGCGGTGCTGGGTATTATTGTCA
CGATACTGTCATTTCGTCGGGGTTAACGAACCAGCCAGACCAGCATCAGGATAATCGCGA
CTAACAGTATCCACAGCGCGGGACGCGTTGCCATATTTTGCAACGTGTCCATCATCGGTG
GAAAAGGATTAAGCAGCGGTTGCATAACACGCGGATCAATCCCTTTAACCCGCCGTTGAT
AAAGCTGATTAAGAATATCCTCGGCCTGGGCAGAAGAAAGCGATGATTGCGCAGAAAGAC
CATATTTTTGCTGGATATATGCCGATAACGCCGCCAGTTCACTGGCATCTAAAGGTTGTT
TTAGCGTCATCTGTAGTGATTCCAGCGTCGGCGTATTTTGCTGGCTTAGCGTCTGACGCG
CCTGTAGCCAGGTCACCAGATGGTTAAACAGTTTCGCTGGAATTAACTCGCCATCTTTCA
CCCCGGAAAGTTCCAGCATCGATTGCCAGATCTGTTTGCTGGGTTCCCCCGTTGCCGCCG
CAAGTTTGGTCACCAGCTGTTTTAGCGCATTGTGCTCCGCCGGTAATAAAGGACGGTCGG
TCGCCTCGCGCTGCTGTGGTTGCGGAATAACCATCTTCCCTTCCTGCAACAGGGTGAGAA
TGGTTTTTAATTGCTCCGGTGAGAGCTGATTCAGCGGCGTCTGACCAAAGTTATGACGGA
TATAATCCGTGACCGCCTGACGATTATTCCCCAGACGTAAATACTCCCCTAATTGCGCTA
AAAGCTGGCGGGCAGAATGGCTTTTTTGCGCGGCCAGCAGACGTTGCGCCAGATTATGCT
CAGCGGCAGGGAAGTGACGCGAAAGCAGCGGTGAATCTCCCGACAGACCAATATCGTGCC
TGATACCCGCCCACAGTTCTGCTCTTTGCTGTTGCGTCAGTGAGGTCACTTTCGTCATTA
AGCTTTCCAGCGAAGTACGTTGCTGACTGGATAAAGGCTGATTGCCCGTGCCAGACGGCA
GATTATCTCCCTGACCTGGTGGTTGCCCAGGAGGAGGGCCGGAAATAGGTTGTATCATTA
CGTATCCTTATACCTGAAATCTTCGCAAGTATGCCTGGCCGCGAGATTATGGCACACTTG
TCCGGTTAACTCTCGTCTCATACAGGTAACACAAACGTGAAAATCCTTGTTGATGAAAAT
ATGCCTTATGCCCGCGACTTATTTAGCCGTTTGGGTGAGGTGACCGCGGTTCCCGGGCGT
CCAATCCCCGTCGCTCAACTGGCAGACGCGGATGCGCTGATGGTGCGTTCGGTCACGAAA
GTGAATGAATCTTTGCTGGCAGGAAAACCCATTAAATTTGTTGGCACTGCCACTGCGGGG
ACCGACCATGTCGATGAAGCATGGTTGAAGCAGGCGGGAATTGGTTTTTCCGCTGCACCT
GGCTGTAATGCGATTGCGGTGGTGGAATATGTTTTCTCCTCCCTGCTGATGCTTGCCGAA
CGCGATGGATTTTCACTGTACGACCGTACGGTGGGGATCGTGGGCGTTGGTAACGTTGGA
CGTCGATTGCAGGCGCGACTGGAAGCGTTAGGGATTAAAACCTTACTTTGCGATCCGCCT
CGCGCCGACCGTGGGGATGAGGGTGATTTCCGCTCGCTGGATGAGTTAGTCCAGCGCGCG
GATATTCTGACTTTCCATACGCCACTCTTTAAAGATGGTCCGTACAAAACGCTACATCTG
GCGGATGAAAAACTGATCCGTAGCCTGAAGCCCGGAGCGATTCTGATTAACGCCTGCCGT
GGCGCAGTCGTCGATAATACTGCGTTGCTGACCTGCCTGAATGAAGGCCAGAAGTTAAGC
GTAGTGCTGGATGTCTGGGAAGGCGAACCGGAACTCAACGTCGAGCTGCTGAAAAAAGTG
GATATCGGCACGTCGCATATCGCAGGCTATACCCTGGAAGGTAAAGCACGCGGTACTACG
CAAGTGTTTGAAGCTTATAGCAAGTTTATTGGGCATGAACAGCACGTTGCGCTGGATACA
TTACTGCCTGCGCCAGAGTTTGGTCGCATTACGCTGCATGGCCCGCTCGATCAACCGACG
CTGAAAAGGCTGGTGCATTTGGTGTATGATGTGCGCCGCGATGACGCACCGCTGCGTAAA
GTCGCCGGGATACCGGGTGAGTTCGATAAACTGCGCAAAAACTATCTTGAGCGCCGTGAA
TGGTCATCTCTGTATGTAATTTGTGATGACGCCAGTGCGGCATCATTGCTGTGTAAACTG
GGTTTTAACGCCGTTCATCATCCGGCACGTTAATCTCTTCTTCATGCTCTCTGCTGTAAC
ATTGGCAGGGAGCTTTGCTATTTCTGGAGTAAACCACCATGTCTGAAGGCTGGAACATTG
CCGTCCTGGGCGCAACTGGCGCTGTGGGCGAAGCCCTGCTTGAAACGCTGGCTGAACGTC
AGTTCCCGGTTGGGGAAATTTATGCACTGGCACGTAACGAAAGCGCAGGCGAACAACTGC
GCTTTGGTGGTAAGACAATCACCGTGCAGGATGCCGCTGAATTCGACTGGACGCAGGCGC
AGCTGGCATTTTTTGTCGCAGGCAAAGAAGCTACCGCTGCCTGGGTTGAAGAAGCGACCA
ACTCAGGTTGCCTGGTGATCGACAGCAGTGGATTGTTTGCTCTCGAACCCGACGTACCGC
TGGTGGTGCCGGAAGTAAACCCGTTTGTACTGACAGATTACCGGAACCGGAATGTCATCG
CCGTACCAGACAGTCTGACCAGCCAGCTGCTGGCGGCACTGAAACCGTTAATCGATCAGG
GCGGTTTATCACGTATCAGCGTTACCAGCCTGATTTCAGCCTCCGCCCAGGGCAAAAAAG
CGGTCGATGCGTTAGCGGGGCAGAGTGCGAAATTGCTCAACGGCATTCCGATTGACGAAG
AAGATTTCTTCGGGCGTCAGCTGGCGTTCAACATGCTGCCGTTACTGCCGGATAGCGAAG
GTAGCGTGCGTGAAGAACGTCGTATCGTTGACGAAGTACGCAAAATCCTGCAGGACGAAG
GGCTGATGATTTCGGCTAGCGTCGTCCAGGCACCGGTATTCTACGGTCATGCCCAGATGG
TCAACTTTGAAGCTCTGCGTCCACTGGCAGCAGAAGAAGCGCGTGATGCGTTTGTTCAAG
GCGAAGATATTGTGCTCTCTGAAGAGAACGAATTCCCAACTCAGGTAGGTGATGCTTCGG
GTACGCCGCATCTTTCTGTTGGCTGCGTGCGTAATGACTACGGTATGCCGGAGCAAGTCC
AGTTCTGGTCGGTGGCCGATAACGTTCGCTTTGGCGGCGCGCTGATGGCAGTAAAAATCG
CCGAGAAACTGGTGCAGGAGTATCTGTACTAATGTCCGACCAGCAACAACCGCCAGTTTA
TAAAATTGCGCTGGGCATTGAGTACGACGGCAGTAAGTATTACGGCTGGCAACGGCAGAA
CGAAGTCCGCAGTGTGCAGGAGAAGCTGGAAAAGGCGCTCTCCCAGGTGGCGAACGAACC
CATCACCGTCTTCTGCGCCGGGCGTACTGACGCAGGGGTACACGGTACCGGGCAGGTTGT
GCATTTCGAAACAACCGCGCTGCGCAAAGACGCGGCGTGGACCTTGGGCGTAAATGCGAA
TTTACCTGGTGACATCGCTGTGCGTTGGGTTAAAACTGTACCTGATGATTTTCATGCCCG
ATTTAGCGCCACGGCTCGCCGTTATCGCTACATCATCTACAATCATCGGCTGCGCCCGGC
GGTACTGAGTAAAGGGGTAACCCATTTTTACGAACCGCTGGACGCTGAACGGATGCATCG
GGCTGCGCAATGCTTGCTGGGCGAGAATGATTTCACCTCGTTCCGTGCGGTGCAGTGCCA
GTCCCGAACCCCGTGGCGCAACGTTATGCATATTAATGTCACGCGTCACGGTCCTTATGT
GGTGGTAGATATTAAAGCGAATGCTTTTGTACATCATATGGTCAGGAATATTGTCGGCAG
CCTGATGGAAGTCGGTGCCCACAACCAGCCGGAGAGCTGGATAGCAGAGTTGCTGGCGGC
AAAGGACAGAACGCTGGCGGCAGCAACGGCAAAAGCGGAAGGGCTGTATCTGGTCGCGGT
GGATTACCCTGACCGGTATGATCTTCCAAAACCGCCAATGGGCCCGCTATTTCTGGCGGA
CTAACGAGAATAATGCTCGGAACATTTCAGGCTGTAGCCAACGTAGTTACAGCCTGAAAG
ATGACGAGTACAAGGCATAGGCAAATATGGACCTGATTTATTTCCTCATCGATTTTATCC
TGCACATTGACGTGCATCTGGCAGAGCTGGTCGCGGAGTACGGCGTCTGGGTTTATGCCA
TTTTGTTCTTAATTTTGTTCTGTGAAACCGGTCTGGTGGTAACGCCGTTTTTACCGGGTG
ATTCATTGCTGTTTGTTGCCGGAGCGTTGGCATCACTGGAAACCAACGATCTCAACGTCC
ATATGATGGTGGTGCTGATGCTGATCGCCGCGATTGTGGGTGACGCGGTCAATTACACTA
TCGGGCGGTTGTTCGGTGAAAAGTTGTTCAGTAATCCCAATTCGAAAATTTTCCGTCGCA
GTTATCTCGACAAAACCCATCAGTTTTATGAGAAACATGGCGGCAAAACGATTATTCTCG
CCCGTTTTGTGCCGATCGTCAGAACGTTCGCCCCGTTTGTTGCGGGAATGGGCCACATGT
CGTACCGTCATTTCGCCGCTTATAACGTGATCGGCGCACTGTTGTGGGTACTGCTTTTTA
CCTACGCAGGCTATTTCTTCGGTACAATCCCGATGGTTCAGGATAACCTTAAGCTGCTGA
TCGTCGGGATTATTGTGGTTTCTATTTTGCCGGGCGTCATCGAAATAATCCGTCACAAAC
GCGCTGCGGCACGCGCCGCAAAATAAAAAGTAACTCCGCGGTTCGACCACTTTTTTATCC
AAAGTTTCGGGCTGTTATGTTTTAATGTGCAACATTCATGGTCTGTTGGGGGCAAAAATG
GCATTATGCGTCCCCAAAGATAAAACTGGCATCGAACCAGGTTCAGACAGAAAGGTCCCT
AATGAGCTGGATTGAACGAATTAAAAGCAACATTACTCCCACCCGCAAGGCGAGCATTCC
TGAAGGGGTGTGGACTAAGTGTGATAGCTGCGGTCAGGTTTTATACCGCGCTGAGCTGGA
ACGTAATCTTGAGGTCTGTCCGAAGTGTGACCATCACATGCGTATGACAGCGCGTAATCG
CCTGCATAGCCTGTTAGATGAAGGAAGCCTTGTGGAGCTGGGTAGCGAGCTTGAGCCGAA
AGATGTGCTGAAGTTTCGTGACTCCAAGAAGTATAAAGACCGTCTGGCATCTGCGCAGAA
AGAAACCGGCGAAAAAGATGCGCTGGTGGTGATGAAAGGCACTCTGTATGGAATGCCGGT
TGTCGCTGCGGCATTCGAGTTCGCCTTTATGGGCGGTTCAATGGGGTCTGTTGTGGGTGC
ACGTTTCGTGCGTGCCGTTGAGCAGGCGCTGGAAGATAACTGCCCGCTGATCTGCTTCTC
CGCCTCTGGTGGCGCACGTATGCAGGAAGCACTGATGTCGCTGATGCAGATGGCGAAAAC
CTCTGCGGCACTGGCAAAAATGCAGGAGCGCGGCTTGCCGTACATCTCCGTGCTGACCGA
CCCGACGATGGGCGGTGTTTCTGCAAGTTTCGCCATGCTGGGCGATCTCAACATCGCTGA
ACCGAAAGCGTTAATCGGCTTTGCCGGTCCGCGTGTTATCGAACAGACCGTTCGCGAAAA
ACTGCCGCCTGGATTCCAGCGCAGTGAATTCCTGATCGAGAAAGGCGCGATCGACATGAT
CGTCCGTCGTCCGGAAATGCGCCTGAAACTGGCGAGCATTCTGGCGAAGTTGATGAATCT
GCCAGCGCCGAATCCTGAAGCGCCGCGTGAAGGCGTAGTGGTACCCCCGGTACCGGATCA
GGAACCTGAGGCCTGATAACTGATAAGGGCAGGGCCACTGGCTCTGCCCTTTTGCTATTC
TCACCGTAACGAATCAGCGGATACCATGATTATCAAACGCACTCCTCAAGCCGCGTCGCC
TCTGGCTTCGTGGCTTTCTTATCTGGAAAACCTGCACAGTAAAACTATCGATCTCGGCCT
TGAGCGCGTGAGCCTGGTCGCGGCGCGTCTTGGCGTCCTGAAACCAGCGCCATTTGTGTT
TACCGTTGCGGGTACGAATGGCAAAGGCACCACCTGCCGTACGCTGGAGTCGATTCTGAT
GGCGGCAGGGTACAAAGTGGGCGTCTACAGTTCGCCTCATCTGGTGCGTTATACCGAGCG
CGTACGTGTGCAGGGCCAGGAATTGCCGGAATCGGCCCACACCGCCTCTTTTGCGGAGAT
TGAATCGGCACGCGGTGATATTTCCCTGACCTATTTCGAGTACGGTACGCTGTCGGCGTT
GTGGCTGTTCAAGCAGGCACAACTTGACGTGGTGATTCTGGAAGTAGGGCTGGGCGGTCG
TCTGGACGCAACCAATATTGTCGACGCCGATGTCGCGGTAGTAACCAGTATTGCGCTGGA
TCATACCGACTGGCTGGGTCCAGATCGCGAAAGTATTGGTCGCGAGAAAGCAGGCATCTT
CCGCAGCGAAAAACCGGCAATTGTCGGTGAGCCGGAAATGCCTTCTACCATTGCTGATGT
GGCGCAGGAAAAAGGTGCACTGTTACAACGTCGGGGCGTTGAGTGGAACTATTCCGTCAC
CGATCATGACTGGGCGTTTAGCGATGCTCACGGCACGCTGGAAAATCTGCCGTTGCCGCT
TGTCCCGCAACCGAATGCCGCAACAGCGCTGGCGGCACTGCGTGCCAGCGGGCTGGAAGT
CAGTGAAAATGCCATTCGCGACGGGATTGCCAGCGCAATTTTGCCGGGACGTTTCCAGAT
TGTGAGCGAGTCGCCACGCGTTATTTTTGATGTCGCGCATAATCCACATGCGGCGGAATA
TCTCACCGGGCGTATGAAAGCGCTACCGAAAAACGGGCGCGTGCTGGCGGTTATCGGTAT
GCTACATGATAAAGATATTGCCGGAACTCTGGCCTGGTTGAAAAGCGTGGTTGATGACTG
GTATTGTGCGCCACTGGAAGGGCCGCGCGGTGCCACGGCAGAACAACTGCTTGAGCATTT
GGGTAACGGCAAATCATTTGATAGCGTTGCGCAGGCATGGGATGCCGCAATGGCGGACGC
TAAAGCGGAAGACACCGTGCTGGTGTGTGGTTCTTTCCACACGGTCGCACATGTCATGGA
AGTGATTGACGCGAGGAGAAGCGGTGGCAAGTAAGTTTCAGAATCGGTTAGTGGGCACGA
TCGTGCTGGTGGCGCTGGGGGTGATTGTACTTCCAGGGCTGCTGGACGGGCAGAAAAAAC
ATTATCAGGATGAGTTCGCGGCTATCCCGCTGGTGCCGAAAGCGGGCGATCGTGATGAGC
CTGATATGATGCCAGCCGCCACCCAGGCGTTACCGACGCAGCCGCCGGAAGGCGCAGCGG
AAGAGGTGCGGGCAGGTGATGCCGCAGCACCGTCGCTCGATCCGGCCACTATTGCAGCCA
ATAACACCGAGTTTGAACCGGAACCTGCACCGGTCGCCCCACCGAAGCCGAAACCGGTGG
AGCCGCCTAAACCAAAGGTTGAAGCACCACCTGCGCCGAAGCCAGAACCGAAGCCGGTCG
TGGAAGAAAAAGCTGCACCGACGGGTAAAGCCTATGTTGTGCAACTGGGTGCGCTGAAAA
ATGCCGATAAAGTGAATGAGATTGTCGGTAAGCTGCGCGGTGCCGGTTATCGGGTTTATA
CGTCGCCATCCACGCCAGTGCAGGGTAAAATTACCCGTATTCTGGTTGGGCCGGATGCCT
CGAAAGATAAGCTGAAAGGTTCGCTGGGTGAGTTGAAGCAACTTTCTGGCTTAAGTGGCG
TGGTAATGGGCTATACGCCGAATTAATACGGTCTTGCCTGATGCGACGCTGGCGCGTCTT
ATCAGGCCTACGCAGGGGTAGAACCGTAGGTCGGATAAGGCGTTTACGCCGCATCCGACA
CGCATTGCCCGATGCCGCAAAGGCATAAAAAGTCGATGGCGTTGAATATTTTTTCAGCGC
CATTTTTATTGATGCGCGGGAAGGAAATCCCTACGCAAACGTTTTCTTTTTCTGTTAGAA
TGCGCCCCGAACAGGATGACAGGGCGTAAAATCGTGGGACACATATGGTCTGGATTGATT
ACGCCATAATCGCGGTGATTGCTTTTTCCTCTCTGGTTAGCCTGATCCGCGGCTTTGTTC
GTGAAGCGTTATCGCTGGTGACATGGGGTTGTGCTTTCTTTGTTGCCAGTCATTACTACA
CTTACCTGTCAGTCTGGTTTACGGGCTTTGAAGACGAACTGGTTCGAAATGGGATTGCCA
TCGCGGTACTGTTTATCGCTACCCTGATCGTTGGTGCTATCGTGAACTTCGTGATAGGCC
AGTTGGTGGAGAAAACGGGGTTGTCAGGCACCGATCGGGTGCTGGGCGTCTGTTTCGGTG
CGTTGCGCGGTGTGTTGATTGTTGCTGCCATTCTCTTCTTTCTCGACTCCTTTACCGGGG
TGTCGAAAAGCGAAGACTGGAGCAAATCACAGCTGATCCCGCAATTCAGTTTTATCATCA
GATGTTTTTTTGATTATCTGCAAAGCTCGTCAAGTTTCTTGCCCAGAGCGTAAGTGCTCT
GAGATGTGGCTTAACGAGGAAAAAGACGTATGTGCGGTATTGTCGGTATCGCCGGTGTTA
TGCCGGTTAACCAGTCGATTTATGATGCCTTAACGGTGCTTCAGCATCGCGGTCAGGATG
CCGCCGGCATCATCACCATAGATGCCAATAACTGCTTCCGTTTGCGTAAAGCGAACGGGC
TGGTGAGCGATGTATTTGAAGCTCGCCATATGCAGCGTTTGCAGGGCAATATGGGCATTG
GTCATGTGCGTTACCCCACGGCTGGCAGCTCCAGCGCCTCTGAAGCGCAGCCGTTTTACG
TTAACTCCCCGTATGGCATTACGCTTGCCCACAACGGCAATCTGACCAACGCTCACGAGT
TGCGTAAAAAACTGTTTGAAGAAAAACGCCGCCACATCAACACCACTTCCGACTCGGAAA
TTCTGCTTAATATCTTCGCCAGCGAGCTGGACAACTTCCGCCACTACCCGCTGGAAGCCG
ACAATATTTTCGCTGCCATTGCTGCCACAAACCGCTTAATCCGCGGCGCGTATGCCTGTG
TGGCGATGATTATCGGCCACGGTATGGTTGCTTTCCGCGATCCAAACGGGATTCGTCCGC
TGGTACTGGGAAAACGTGATATTGACGAGAACCGTACAGAATATATGGTCGCTTCCGAAA
GCGTAGCGCTCGATACGCTGGGCTTTGATTTCCTGCGTGACGTCGCGCCGGGCGAAGCGA
TTTACATCACTGAAGAAGGGCAGTTGTTTACCCGTCAATGTGCTGACAATCCGGTCAGCA
ATCCGTGCCTGTTTGAGTATGTATACTTTGCCCGCCCGGACTCGTTTATCGACAAAATTT
CCGTTTACAGCGCGCGTGTGAATATGGGCACGAAACTGGGCGAGAAAATTGCCCGCGAAT
GGGAAGATCTGGATATCGACGTGGTGATCCCGATCCCAGAAACCTCGTGTGATATCGCGC
TGGAAATTGCTCGTATTCTGGGCAAACCGTACCGCCAGGGCTTCGTTAAAAACCGCTATG
TTGGCCGCACCTTTATCATGCCGGGCCAGCAGCTGCGTCGTAAGTCCGTGCGCCGTAAAC
TGAATGCCAACCGCGCCGAGTTCCGCGATAAAAACGTCCTGCTGGTCGACGACTCCATCG
TCCGTGGCACCACTTCTGAGCAGATTATCGAGATGGCACGCGAAGCCGGAGCGAAGAAAG
TGTACCTCGCTTCTGCGGCACCGGAAATTCGCTTCCCGAACGTTTATGGTATTGATATGC
CGAGCGCCACGGAACTGATCGCTCACGGTCGCGAAGTTGATGAAATTCGCCAGATCATCG
GTGCTGACGGGTTGATTTTCCAGGATCTGAACGATCTGATCGACGCCGTTCGCGCTGAAA
ATCCGGATATCCAGCAGTTTGAATGCTCGGTGTTCAACGGCGTCTACGTCACCAAAGATG
TTGATCAGGGCTACCTCGATTTCCTCGATACGTTACGTAATGATGACGCCAAAGCAGTGC
AACGTCAGAACGAAGTGGAAAATCTCGAAATGCATAACGAAGGATGATGCCTTCGCTGAG
GGTGCCGGTCTGGCACCCTGACTTGCAACTCCCGCCGAAATCCTGCAAAGTCTGCCTGCA
AGTCTGACAGGGCAACTATTTATGAAACGACTCATTGTAGGCATCAGCGGTGCCAGCGGC
GCGATTTATGGCGTGCGCTTATTACAGGTTCTGCGCGATGTCACAGATATCGAAACGCAT
CTGGTGATGAGCCAGGCAGCGCGCCAGACCTTATCCCTCGAAACGGATTTTTCTCTGCGC
GAAGTGCAGGCATTAGCCGATGTCACGCACGATGCGCGCGATATTGCCGCCAGCATCTCT
TCCGGTTCTTTCCAGACGCTGGGGATGGTGATTTTACCCTGTTCAATCAAAACCCTTTCC
GGCATTGTCCATAGCTATACTGATGGCTTACTGACCCGTGCGGCAGATGTGGTGCTGAAA
GAGCGTCGCCCGTTGGTGCTCTGCGTGCGTGAAACACCATTGCACTTAGGCCATCTGCGT
TTAATGACTCAGGCGGCAGAAATCGGTGCGGTGATTATGCCTCCCGTTCCGGCGTTTTAT
CATCGCCCGCAATCCCTTGATGATGTGATAAATCAGACGGTTAATCGTGTTCTTGACCAG
TTTGCGATAACCCTTCCTGAAGATCTCTTTGCCCGCTGGCAGGGCGCATAACTCCGCTGT
TGCCCTGTTTCAGGGCAATTTTGCAACCGCGATCAAATCCTCGACATTTTGTTTCTGCCA
TTCAATCGAAACGCTGCGATTCAACCGCTATACCTGCTATCTTCAACTTCAGGACAATAA
TGCAACGTCTTATTAACATATTTAACGTTGAATGTTACTGTTGTCGTCAAGATGGCATAA
GACCTGCATGAAAGAGCCTGCAAACACACAACACAATACACAACATAAAAAAGCCATTTT
CACTTGAGGGTTATGTATGAAGAAGTCGATTCTCGCTCTGTCTTTGTTAGTCGGTCTCTC
CACAGCGGCTTCCAGCTATGCGGCGCTACCGGAGACGGTACGTATCGGAACCGATACCAC
CTACGCACCGTTCTCATCGAAAGATGCTAAAGGTGATTTTGTTGGCTTTGATATCGATCT
CGGTAACGAGATGTGCAAACGGATGCAGGTGAAATGTACCTGGGTTGCCAGTGACTTTGA
CGCGCTGATCCCCTCACTGAAAGCGAAAAAAATCGACGCTATTATTTCGTCGCTTTCCAT
TACCGATAAACGTCAGCAGGAGATTGCCTTCTCCGACAAGCTGTACGCCGCAGATTCTCG
TTTGATTGCGGCCAAAGGTTCACCGATTCAGCCAACGCTGGATTCACTGAAAGGTAAACA
TGTTGGTGTGCTGCAGGGATCAACCCAGGAAGCTTACGCTAACGAGACCTGGCGTAGTAA
AGGCGTGGATGTGGTGGCCTATGCCAACCAGGATTTGGTCTATTCCGATCTGGCTGCAGG
ACGTCTGGATGCTGCGTTACAAGATGAAGTTGCTGCCAGCGAAGGATTCCTCAAGCAACC
TGCTGGTAAAGATTTCGCCTTTGCTGGCTCATCAGTAAAAGACAAAAAATACTTCGGTGA
TGGCACCGGTGTAGGGCTACGTAAAGATGATGCTGAACTGACGGCTGCCTTCAATAAGGC
GCTTGGCGAGCTGCGTCAGGACGGCACCTACGACAAGATGGCGAAAAAGTATTTCGACTT
TAATGTCTACGGTGACTGATACGTCGCTGGGAAGCTGTACCTGATGGAATGATCATCATG
GTGCACGCCAGGTTTGTTGCACTATCGTGGTGCATTGAAATGCATACTTAAGCATTTTTA
ATGAAAAATAATACGTCTAACGGGGCGGGATATTTTGCCTTGATGGTCAATTTTATGGCA
CGATAAGTGTAACAAACCTGTAAATATTCCCTATAAAAAGACTGTCAGTTGAGGACATTA
TGAAAAAACTGGTGCTATCGCTCTCTCTGGTTCTGGCCTTCTCCAGCGCAACTGCGGCGT
TTGCTGCGATTCCGCAAAACATCCGCATCGGTACCGACCCGACCTATGCGCCATTTGAAT
CAAAAAATTCACAAGGCGAACTGGTTGGCTTCGATATCGATCTGGCAAAGGAATTATGCA
AACGCATCAATACGCAATGTACGTTTGTCGAAAATCCGCTGGATGCGTTAATCCCGTCCT
TAAAAGCGAAGAAGATTGACGCCATCATGTCATCGCTTTCCATTACGGAAAAACGTCAGC
AAGAAATAGCCTTCACCGACAAACTGTACGCTGCCGATTCTCGTTTGGTGGTGGCGAAAA
ATTCTGACATTCAGCCGACAGTCGAGTCGCTGAAAGGCAAACGGGTAGGCGTATTGCAGG
GCACCACCCAGGAGACGTTCGGTAATGAACATTGGGCACCAAAAGGCATTGAAATCGTCT
CGTATCAGGGGCAGGACAACATTTATTCTGACCTGACTGCCGGACGTATTGATGCCGCGT
TCCAGGATGAGGTCGCTGCCAGCGAAGGTTTCCTCAAACAACCTGTCGGTAAAGATTACA
AATTCGGTGGCCCGTCTGTTAAAGATGAAAAACTGTTTGGCGTAGGGACCGGCATGGGCC
TGCGTAAAGAAGATAACGAACTGCGCGAAGCACTGAACAAAGCCTTTGCCGAAATGCGCG
CTGACGGTACTTACGAGAAATTAGCGAAAAAGTACTTCGATTTTGATGTTTATGGTGGCT
AATCGCCATCGGTGAAAGAAAGCCCGCTCCCTTCGGGTAACCGGAGGGAGACAAGAGGCG
GTAATTCACCACACACGACAGGACAGGCAGCATGTTGTATGGGTTTTCAGGTGTTATTTT
ACAGGGTGCGCTCGTCACGCTGGAGCTGGCTATCAGCTCTGTAGTGCTCGCTGTAATCAT
CGGTTTAATTGGCGCTGGCGGTAAGCTCTCGCAAAATCGGCTTTCGGGGCTGATTTTCGA
AGGGTACACCACGCTGATTCGTGGCGTGCCGGACTTAGTGTTGATGCTGCTGATTTTCTA
CGGTTTGCAGATTGCGCTAAACACGGTGACGGAGGCGATGGGCGTCGGGCAGATTGATAT
CGATCCGATGGTCGCTGGTATTATCACTCTCGGTTTTATCTACGGTGCTTATTTTACCGA
AACGTTCCGTGGTGCTTTTATGGCAGTGCCGAAAGGACATATAGAGGCGGCGACGGCGTT
CGGTTTTACTCGTGGGCAAGTGTTTCGGCGGATCATGTTTCCGTCGATGATGCGTTACGC
CCTGCCAGGCATTGGCAACAACTGGCAGGTGATCCTCAAATCTACCGCACTGGTTTCGTT
ACTCGGCCTGGAAGATGTGGTCAAAGCCACCCAACTGGCAGGCAAAAGTACCTGGGAACC
GTTCTATTTCGCCATCGTCTGTGGCGTGATTTACCTGGTTTTCACCACTGTTTCCAATGG
TGTGCTGCTGTTCCTTGAGCGCCGCTACTCCGTGGGTGTGAAGAGGGCTGACCTGTGATC
GAAATCTTACATGAATACTGGAAACCGCTGCTGTGGACCGACGGTTATCGCTTTACTGGT
GTGGCGATCACTCTGTGGCTGCTTATTTTGTCGGTAGTGATAGGCGGAGTCCTGGCGCTG
TTTCTGGCGATTGGTCGTGTCTCCAGTAATAAATACATCCAGTTTCCAATCTGGTTATTT
ACCTATATTTTTCGCGGTACGCCGCTGTATGTTCAGTTGCTGGTGTTCTATTCCGGCATG
TACACGCTTGAGATTGTTAAGGGAACCGAATTCCTTAACGCTTTCTTCCGCAGTGGCCTG
AACTGTACCGTGCTGGCGCTGACGCTTAACACCTGCGCTTACACTACCGAGATTTTTGCT
GGGGCAATCCGTTCGGTTCCGCATGGGGAAATTGAAGCCGCCAGAGCCTATGGCTTCTCG
ACTTTTAAAATGTATCGCTGCATTATTTTGCCTTCTGCGCTGCGTATTGCGTTACCGGCA
TACAGCAACGAAGTGATCCTGATGCTGCACTCTACTGCGTTGGCATTTACTGCCACGGTG
CCGGATCTGCTGAAAATAGCCCGCGATATTAACGCCGCCACGTATCAACCTTTTACCGCC
TTCGGCATTGCCGCGGTGCTCTATTTAATCATCTCTTATGTCCTGATCAGCCTCTTTCGC
AGAGCGGAAAAACGCTGGTTGCAGCATGTGAAACCTTCTTCAACGCACTGAGAATACGAT
GTCCGAGAATAAATTAAACGTTATCGATTTGCACAAACGCTACGGCGAACATGAAGTGCT
GAAAGGGGTATCACTGCAAGCGAATGCCGGAGATGTAATAAGCATCATCGGATCGTCGGG
ATCGGGGAAAAGTACCTTTCTGCGCTGCATTAACTTCCTCGAAAAACCGAGTGAAGGGTC
GATCGTGGTCAATGGCCAGACGATCAATCTGGTGCGCGACAAAGACGGTCAACTCAAAGT
CGCCGATAAAAATCAACTGCGCTTACTGCGCACACGCCTGACGATGGTATTCCAGCACTT
CAATCTCTGGAGCCATATGACGGTGCTGGAAAACGTCATGGAAGCGCCGATTCAGGTGTT
GGGCCTGAGCAAGCAGGAAGCGCGCGAGCGGGCGGTGAAGTATCTGGCAAAAGTCGGGAT
AGACGAACGTGCGCAGGGGAAATATCCGGTGCATCTTTCCGGCGGTCAGCAACAGCGTGT
TTCTATCGCGCGGGCGCTGGCGATGGAACCGGAAGTTTTACTGTTTGATGAACCTACCTC
GGCGCTCGATCCTGAACTGGTAGGCGAAGTGTTGCGTATTATGCAGCAACTGGCAGAAGA
GGGGAAAACCATGGTGGTAGTGACTCACGAAATGGGCTTTGCTCGCCATGTTTCTACTCA
TGTCATTTTCCTCCATCAGGGGAAAATAGAAGAAGAGGGCGCGCCGGAGCAGTTATTTGG
CAACCCGCAAAGCCCTCGTCTGCAACGGTTCCTTAAGGGATCGCTGAAATAATTTCCTCT
CCGGTGGCTAACGCTGCCGGAGTATTTTCATGGGGAATTTGCGAGTCAGCTTCCGCTGAA
ATGTAAAAGTTACAGTCCGCTAAAAATACTTCTGAATTCGCTGTCCAAAGATAAAAACTG
CCTGCTGCATTGGGTGTTAATCGTGGTTATTGTCGCGTCATCTTAAATTTGAGGGGTGAC
GGAACGCCATGACAATATCGACAACTTCCACGCCGCATGATGCGGTATTTAAATCTTTTT
TACGCCATCCAGACACCGCGCGGGATTTTATTGATATTCATCTTCCCGCGCCGCTGCGCA
AACTGTGTGATTTAACGACGCTTAAACTGGAACCAAACAGTTTTATTGATGAAGACCTGC
GGCAATATTATTCCGACCTCTTGTGGTCTGTGAAAACGCAGGAGGGAGTGGGTTATATTT
ATGTAGTGATAGAGCACCAAAGTAAGCCGGAAGAATTAATGGCTTTTCGCATGATGCGTT
ATTCCATTGCGGCAATGCAAAACCATCTTGATGCGGGCTATAAAGAGCTTCCATTGGTGC
TCCCGATGCTGTTTTATCATGGTTGCAGAAGTCCTTATCCTTATTCACTCTGCTGGCTTG
ATGAATTTGCCGAGCCTGCTATAGCCCGCAAAATATATTCATCGGCTTTTCCGTTGGTGG
ATATTACCGTGGTGCCGGATGACGAGATTATGCAACACCGCAAAATGGCGCTGTTGGAGT
TAATTCAGAAACATATTCGTCAGCGCGATCTGTTGGGATTAGTCGACCAAATTGTTTCGC
TGCTAGTTACAGGGAACACTAATGACAGACAGCTAAAAGCCCTGTTTAATTACGTATTAC
AAACAGGGGATGCCCAGCGTTTTCGTGCATTTATTGGTGAGATAGCGGAACGCGCACCAC
AAGAAAAGGAGAAACTGATGACCATTGCTGACAGATTACGTGAAGAAGGCGCAATGCAGG
GCAAACACGAAGAAGCCCTGCGTATTGCTCAGGAGATGCTGGATAGAGGTTTAGACAGAG
AGTTAGTTATGATGGTGACCCGACTTTCACCAGACGATCTTATCGCGCAAAGCCACTAAT
CCTGTAACACCGGGAGTTAACTGGCGGATGTTTGCTGTAAACCACATCAGCGAACGACAT
CCGCCAGCGCCTCTTCTAAATCGTACCAGCGAAACGCAAAACCCGCTTCTTCCAGCCGTT
TAGGCAGCGCGCGTTGTCCACCTAATACCAGTACTGAAGATTCGCCCATTAACAGTCGAA
TGGCGGTCGCGGGGACGCGCAAAATGGCCGGGCGATGCAGCGCATGACCGAGCGCATGGG
CAAATTGTTCATTGCGTACCGGGTAGGGCGAAACCATATTAAATGGCCCGCGCAGCTCGT
TATCCAGCAGCCAGAGAATACCGTTGACCATATCATCAATATGAATCCAGGCCAGATACT
GCCGACCAGAGCCAATCGGCCCGCCCAGGCCAAGACGAAACGGCGGCAGCATTTTACCGA
GAATACCGCCATCCGGTGCCAGCACTACACCGGTACGCAGCAGGCACACTCGCGTTTTGT
CACTTTGCGCCCGGCAGGCAATTTCTTCCCAGCGAGCGCAGAGTTTATGGGTAAATTCGT
TATGCGGCGGTTCCTCTTCGGTAACCACCACTTCACCTAAGTCACCATAATAGCCCGTTG
CCGAGCCGGAAATGAGTACCGACGGTGGCGTGTCGCTGGCATTAATCAAATCGACCAGTT
TTTGCGTGATATTCCAGCGGCTTTGGCAGAGACGCTCTTTTTGCTCGTGAGTCCAGCGTT
TATCAGCAATCGGTTCTCCGGCCAGGTTGATTACCGCATCAACGCCGTTGAGGTTGCTTT
GATCGGCAAGCCCTTGCCATAGTGTCACCCGAGGGCCGAGAACGGAACTGGCTTTCTGCG
GGTTACGCGTCACTACCGTAATTTGATGGCCCAGCTCCAGCAAACGCGGAATCAAATGGC
GACCAATTAATCCTGTCCCTCCGGTGATCACTATGTTCATGCAGCCTCCCGATATGGCGA
TTAACGCTGCCAGCTTAAGGTCATGGATACCGAATCGGCGTAGCGCAGCGCGTGCAGTTT
ATCGATCTCCACTTCAGCATACGTCACCCAGTGATGTTCACGTGCGATATCGAGCACATC
CTGAGTTAATTTTTCCAGCAAAGAGAAACGGTTATTCTCTACATGCTGAATAATGTTTTT
CGTTACGGTGCGATAATTCAGCGCATCGTTGATATCTTCGCTAGTGCGCGCTTTATCGGC
GGGGTAGTGGATCGTCACATTGATAACAATATCCTGACGGTTGTTAATTTCTTCTTCCTT
AATTCCGATAAACGTACGCAAACGAAGGTTCTTTATACGAATAATAGCGGCAGGTTGTGC
CATTGCAGGTTCTCCGTTGTTTTACTTAGGATGAAATAATACACGAGAACCTGTTTCTGT
TAACTATCCGAACGCTCATCACCGAGTTGTGCTTTTAGCAGTGCCTGCCCGGTGGCAGGG
CGCGAACGGATCCGCTCATGCCAGTTCTTGACTGCCGGATACATTGCTAGGTCAATTCGC
TGGCGAGTCCAGGCATTAACCCACGGCCAGCAGGCAATATCCGCAATGCTGTAGTTCTCG
CCTCCCAGCCAGGGCGAGTTTTCCAGCCGCTTGTTCAGTACATGGTAAAGACGCTGAGTT
TCAACCTGATAACGTTCAATAGCGTAAGGAATGGTTTGGGGGGCTGCGTGATTAAAATGA
TGATTTTGCCCAAGCATCGGCCCCAGTCCGCCTACCTGCCAGAATAACCACTGTAATGTG
GCGGCGCGCTCACGCGTTTCATGACTCAAAAAGAGTCCTGTTTTCTCAGCCAGATACAAC
AAAATGGCACCAGACTCAAAGAGGCTTAGCGGTTCGCCGCCATCGGCAGGAGAATGATCA
ACAATTGCCGGAATTTTGTTGTTGGGCGAAATGCGCAAAAATTCCGGACGAAACTGACCG
CCTTTCCCCAGGTCTACCTTAATCAAGCGATAATCCAGCTCTGCTTCTTCGAGAAACAGC
GTAATTTTGTGACCATTGGGTGTCGGGGCGAAATAGAGATCGATCATTGCAGCTCCGGTT
GTTTAATCATCTGAACACCACAAGTATAGAAAGCGCGGCGACTTACGTGAGTATTCGTCA
CGTGACAGTGACAAAAAGGCTCTATAGTTTGATAGCCAGCCCCCTTTATTGCCGAGGACA
TAATGAGTAAACCCGCTATCACGCTTTGGTCAGATGCCCACTTTTTCTCCCCTTATGTGT
TATCCGCCTGGGTGGCGTTGCAGGAAAAAGGCCTGTCGTTTCATATCAAGACCATCGACC
TCGACAGCGGTGAACATTTGCAGCCGACGTGGCAAGGTTACGGTCAGACACGCCGTGTGC
CGTTATTACAAATCGATGATTTTGAGTTGAGTGAATCTTCTGCCATTGCGGAGTATCTGG
AAGATCGATTTGCGCCACCGACCTGGGAACGTATTTATCCGCTTGATTTAGAAAATCGTG
CGCGTGCACGACAGATTCAGGCCTGGCTGCGCAGCGATCTGATGCCCATCCGCGAAGAGC
GTCCGACGGATGTTGTCTTTGCGGGGGCGAAAAAAGCGCCACTAACGGCCGAGGGAAAAG
CCAGTGCAGAGAAACTGTTCGCGATGGCAGAACATTTGTTAGTACTGGGTCAGCCGAATT
TATTTGGTGAATGGTGCATTGCTGATACTGATCTGGCGCTAATGATTAACCGCCTGGTAC
TACATGGCGATGAGGTGCCAGAACGCCTGGTGGATTATGCAACATTCCAGTGGCAGCGAG
CGTCTGTCCAGCGTTTTATTGCACTTTCGGCGAAGCAATCTGGCTGATAGCAACGACAGA
ATCCAGTATCATAGCTTACGTTTTTTCGACGAGGAGTGAGTGATGAAACTGATGTTTGCA
TCGGACATTCATGGGTCGTTACCGGCGACGGAACGTGTTCTGGAGTTGTTTGCCCAAAGC
GGTGCCCAGTGGCTGGTGATCCTTGGCGACGTGTTGAATCACGGCCCGCGTAATGCTTTA
CCGGAGGGTTACGCGCCAGCCAAAGTCGCTGAACGGCTTAATGAAGTGGCACATAAGGTT
ATCGCTGTGCGCGGCAACTGCGACAGCGAAGTGGATCAAATGCTGCTGCATTTCCCGATA
ACCGCGCCGTGGCAACAGGTATTACTGGAAAAACAACGTCTGTTTTTGACGCATGGTCAT
CTTTTTGGCCCGGAAAATCTGCCTGCTTTAAACCAGAACGATGTGCTGGTGTACGGTCAT
ACCCATCTGCCAGTGGCAGAACAGCGGGGGGAGATTTTCCACTTCAACCCCGGCTCGGTG
AGTATTCCGAAAGGCGGTAATCCGGCGAGTTATGGCATGCTGGATAATGACGTACTTAGT
GTAATCGCACTCAATGATCAAAGTATCATTGCGCAGGTCGCGATTAATCCGTAATTTACC
CACAACTCAAAATGCGCCGTAAGAGCGCCAGAAAAAGAAGGTTTCCTGATAATGGAACAG
CGTCGTTTGGCAAGTACTGAATGGGTGGATATTGTCAATGAAGAGAACGAAGTCATTGCA
CAAGCCAGCCGGGAACAAATGCGGGCACAGTGTCTGCGTCATCGTGCAACTTACATCGTC
GTGCATGATGGCATGGGCAAAATTCTGGTCCAGCGTCGTACCGAGACAAAAGACTTTTTA
CCCGGCATGTTAGATGCGACCGCAGGCGGTGTAGTCCAGGCCGATGAGCAACTGCTGGAA
TCCGCGCGTCGCGAAGCGGAAGAAGAGTTGGGCATTGCCGGTGTCCCCTTTGCCGAGCAC
GGGCAGTTCTATTTCGAAGATAAAAATTGCCGTGTCTGGGGCGCATTGTTCAGCTGCGTC
TCTCACGGTCCCTTCGCACTACAGGAAGATGAAGTCAGTGAAGTTTGCTGGCTGACGCCG
GAAGAAATCACCGCACGCTGCGATGAGTTCACTCCAGACTCGCTGAAAGCGCTAGCGTTG
TGGATGAAGCGCAATGCCAAAAATGAAGCCGTAGAGACTGAAACGGCAGAATGAAAAAAG
AGCCGCAATTGCGGCTCTTAACATTTTTAGTGGTAGCCCATCAACTGAGCGCCGATCACT
ACGACGCTGGACATAATAAACAGCAGTCCAAGTAGGGTCGCGCCCACCTTCAGCCAGTTA
CGGAAGTCCACCCTGCACACACCGAGCGTTGCCATTAACGACGCTGAGGTTGGGTAAATG
ATGTGACTGAAGCCATCACCAAACTGGAACGCCAGCACGGTAACCTGACGGTTAACACCG
ACCAGATCGCCAAGCGGTGCCAGTAACGGCATGGTTAACGCCGCCTGACCAGAACCGGAC
GTCACGAAGAAATTAAATACCGCCTGGAAGAGCAACATAAACCAGGCCGCGACCGCGTTG
TCCAGACCGCTAATGGCATTGGCAATGCTGTTGAGGATGGTATTTAACACGCTGGCATCA
CCCGCTTCACCATTACCGACCAGCAGCAAAATCCCTTTGGCGAAACCCACCAGCAGGGCA
GGGGCGATCATCATTCGCGCCCCTTCGGTAAAGGATGAAGCCATGGTATTAACCGTCATG
CCGTTAAGGCGGAAAACAACGCCGATGATGCCAATCACCAGACCCATGGTGAAGAACTGG
CTGGCAATTTCTGGAATAAACCAGGCATTAACGATCACGCCCCAAATCACCCAGACCATT
ACGGCGGTCAGGACAATCAATACCAGCCAGTCACCAAAGGTAAACGGACGTTGTTCAACA
TCAGCCTGCTTTTCACGAAAGAAGCGGTCGGACTCATGCACGCGTGACAGAAGAGGATTC
TTTTTCACTCGTGAGGCGTACACCATGGTAAAGATCAGGCCAATCAGAGTGGCGATAACC
CACACCACGATGCGCAACCCGGAGCCAGAAAGCACCGGAACGCCGGCAATCCCCTGAGCA
ACGACCACACAAAACGGGTTCATCCACGAACTGGCAAAACCGATTTGCGTGGCAATATAG
GTCACCAGGACGGTGGTAATACTGTCATAGCCCAGCCGGACCATTAGCGGTGCGATGATA
ATGGCAAAGGCGACGGCCTCTTCTCCCATACCAAATACCGCGCCGCCAAGTGAAAACAGA
ATAAACAGCGCAGGAATAAAGAGAATTTCATTCCCGCGGGTATGGCGAATAAGCGCCAGG
ATACCGTTATCAATGGTTCCTGTACGCATCACAATGCCAAACGCGCCGCCAATCACCAGC
ATAAACATGATGATGCCAACGGCTGTCCCGTATTTCGATCCTGAGGTTAATCCTTCAAAC
GGGAAGTTCATCAGGCCCGGGCGTTCATCGCCCGTCGTGAACAGCTGTACGCGGTGATAC
TCAGGTTCGCCTGCTTCGTTAGTCAGAATGCGAAATGAGTGTGGATCTACGACTTTGCGT
GTTTTTGTTTGACCATCAACCTGATACTGCACTTCCTGACTGTCAAACATCCCCACCGGA
ACTACCCAGGTGGCAAGGCTGGTTAAAATAGCAACAAAAAAGATAATCACCAACGTATCG
GGCATTGCCCATCTTCTTGTTGGTTTGGATTCAGTGATTGCGGACATAGCGCAAATATTC
CCTTGCACAAAACAAAGTGGTAAGTATGCAAAGTGGGATGGCGCAATTCATTGATGCAGC
GCAGTTAAGCAAGATAATCAGAAAGGATTAATGCAAATTAAGAGAATAAAAAACCGGAAA
TAGTGATTATTTCCGGTTCAGATATCCGCAGCGCAAAGCTGCGGATGATGACGAGATTAC
TGCTGCTGTGCAGACTGAATCGCAGTCAGCGCGATGGTGTAGACGATATCGTCAACCAGT
GCGCCACGGGACAGGTCGTTAACCGGCTTGCGCATACCCTGCAGCATCGGCCCGATGGAG
ATCAGGTCGGCAGAACGCTGTACCGCTTTGTAGGTGGTGTTACCGGTGTTCAGATCCGGG
AAGATGAACACGGTAGCGCGACCTGCAACCGGAGAGTTCGGCGCTTTGGATTTCGCAACG
TCAGCCATTACCGCAGCGTCGTACTGCAGCGGACCGTCGATCATCAGGTCAGGACGTTTT
TCCTGCGCCAGACGAGTTGCTTCGCGAACTTTTTCTACGTCGCTACCTGCACCAGAAGTA
CCGGTGGAGTAGGAGAGCATAGCAACGCGCGGTTCGATACCGAAGGCCGCAGCGGAATCA
GCGGACTGAATCGCGATTTCTGCCAGCTGTTCAGCGGTCGGATCCGGGTTGATCGCACAG
TCACCGTAAACGTAAACCTGTTCCGGCAGCAGCATGAAGAACACGGAAGATACCAGGGAG
CTGCCCGGTGCAGTTTTGATCAGCTGCAGCGGCGGACGGATGGTGTTTGCGGTAGTGTGA
ACAGCACCGGAAACCAGACCATCAACTTCATCCTGTTCCAGCATCAGCGTACCGAGCACC
ACGTTGTCTTCCAGCTGTTCGCGGGCAACGGTTTCGGTCATGCCTTTGTTCTTACGCAGT
TCGACCAGACGACCAACATAGCTTTCGCGAACCACTTCTGGATCAACGATTTCAATCCCT
GCACCCAGTTCTACACCCTGAGACGCTGCAACACGGTTGATCTCTGCCGGATTACCCAGC
AGTACGCAAGTTGCGATACCACGTTCAGCACAGATAGCGGCTGCTTTAACGGTACGCGGT
TCGTCACCTTCCGGCAGTACGATACGTTTGCCCGCTTTGCGCGCAAGTTCAGTCAGCTGA
TAACGGAACGCAGGCGGAGACAGACGACGGCTGCGCTCAGAAGTGGCAGTCAGAGATTCG
ATCCAGTCAGCGTTGATGTAGTTAGCAACGTATTCCTGAACTTTCTCGATACGTTCGTGA
TCGTCAACCGGAACTTCCAGGTTGAAGCTCTGCAGGCTCAGAGAGGTCTGCCAGGTGTTG
GTGTTCACCATAAATACCGGCAGGCCGGTAGCGAAAGCACGTTCGCACAGTTTAGAAATG
CGCGCGTCCATTTCGTAACCGCCAGTCAGCAGCAGGGCACCGATTTCTACGCCGTTCATG
GCTGCCAGGCAAGCGGCCACCAGCACGTCAGGACGGTCTGCGGAAGTCACCAGCAGAGAA
CCGGCACGGAAGTGCTCCAGCATGTGCGGAATGCTGCGTGCGCAGAAAGTGACGGATTTA
ACGCGGCGAGTATTGATGTCGCCTTCGTTGATGATGGTCGCATTCAGGTGGCGAGCCATA
TCGATCGCACGAGTCGCGATCAGGTCAAAGCTCCACGGCACAGCGCCGAGAACCGGCAGC
GGGCTGGATTCTTGCAGCTTCGCCGGATCAACATTGTTTACTTTAGCTTTGGAAGAGTCG
TCGAAAATCTCGGACAGATCCGGGCGAGTACGACCCTGTTCATCAACCGGTGCGTTCAGT
TTGTTAACGATAACGCCGGTGATGTTGGTGTTTTTGGCACCGCCGAAGCTGTTGCGGGTC
AGTTCGATACGCTCTTTCAGCTGTTCCGGGGTGTCAGTGCCCTGAGACATAACGAAGACG
ATTTCCGCATTCAGCGTTTTAGCGATTTCGTAGTTCAGAGACTGGGCAAACTGGTGCTTA
CGTGTCGGGACCAGACCTTCAACCAGAACGACTTCAGCGTCTTTGGTGTTAGCGTGGTAG
TTTGCGACGATCTCTTCCATCAGCACATCTTTCTGATTGCTGGAAAGCAGACCTTCAACG
TAGCTCATTTTCAGCGGTTCAGCGGCCGTCGTGGTGGAAGAGTTCGCACGCACGATAGTC
GTAGTCTGATCGGGCGCATCGCCACCGGTACGCGGCTGAGCGATAGGTTTGAAAACGCTC
AGACGAACGCCTTTGCGTTCCATTGCACGGATCACGCCAAGGCTGACGCTGGTCAGACCG
ACGCTGGTTCCGGTAGGGATCAGCATAATAATACGGGACACGGTTTATCCTCTTTCGTTA
CCGCCGATTTGGCGGGTTACAAAACAGCACCGCCAGCTGAGCTGGCGGTGTGAAATCAGG
CAGTCAGGCGGCTCGCGTCTTGCGCGATAACCAGTTCTTCGTTGGTTGGGATAACCACCG
CAGGACGGGTACCTTCTTTGTTGATGAAACCAGATTTGCCGAAACGTGCAGCCAGGTTGC
GTTCATGATCAACTTCAAAGCCCAGCACGCCCAGTTTGCCCAGAGACAGTTCACGAACCA
TTGCGGCATTTTCACCGATACCACCAGTGAATACAACAGCGTCCAGACGACCATCCATCA
GCGCAGTGTAGGCACCGATGTATTTCGCCAGGCGGTGGCAGTAAACGTCCATTGCGCGCT
TCGCGTCTTCTTTCGTCGCGTAGTTGTCTTCAACATAGCGGCAGTCGCTGGTCACTTCGG
TCAGACCCAGCAGGCCAGACTCTTTGGTCAGCAGTTTGTTGATTGCGTCAACGCTCATGC
CCAGGGTGTCGTGCAGGTGGAAGATGATCGCCGGATCGATATCACCAGAACGGGTACCCA
TGACCAGACCTTCCAGCGGGGTCAGGCCCATAGAGGTGTCAACGCATTTACCGTTGCGGA
TAGCAGAAACGGAACCACCGTTGCCCAGGTGGCAGGTGATGATGTTCAGTTCTTCTACCG
GTTTGTTCAGCATTTTTGCCGCTTCCTGGGTTACATAGAAGTGGCTGGTGCCGTGCGCGC
CGTAACGACGGATGCCGTGCTCTTTGTACAGGTTGTAAGGCAGGGCGTAGAGGTAAGACT
CTTCCGGCATAGTCTGGTGGAACGCGGTGTCAAATACAGCAACGTTTTTGTCTTTCAGCT
GTGGGAAAGATTTCAGAGCTTCTTCGATACCGATCAGGTGAGCCGGGTTGTGCAGCGGTG
CAAAAGAAGCTGCATCTTTGATACCCTGAATAACAGACTCATCGATCACTACGGAGCTGG
TATACTTTTCGCCGCCGTGTACGATACGGTGACCGATAGCAGTCAGCTGCGCAGACAGTT
CTGGTTTTTGTGCCAGAATAGTATTAACGATAAAGTTGAGCGCTTCGCTGTGAGCGGCGC
CTGCACCTAAAGCCGCTTCCTGTTTATTGCCGTCCATTTTCCATTTGATACGTGCTTCGG
GCAGGTGGAAACATTCGGCTAAACCAGAAAGGTACTCTTCACCATTTACTGCATCGATGA
TGGCAAATTTCAGTGAAGAACTACCGCAGTTCAGAACCAGTACTAACTTACTCGACATGG
AAGTACCTATAATTGATACGTGGCTAAAAAAACGTCAGGGAGCCATAGAGCGTAGCGCAT
GATGACACCGACATTTATGATTAACATCATGCACTGCAAATTTTTTTTGCATGATGGAAG
AAATATCTTGAGTCTATGCCATTTTGCGTAATTTTCAGCCAATGGCATAATGTATATGAA
TTTGACGACTCAATGAATATGTACTACTTAGGCCTTCAGGCTGCTAAAGGATACCTGATA
GTGGGTATGGAAGACAAAATGTTTTGAACGTTGTCCCGCTGAGTTGTGAATTTGCACAAA
TTTTTGAATCTTTATATGTGAAGTTGAGGTGAAGCATGTCAACGCCGGATAATCGTTCTG
TTAATTTTTTTAGCTTGTTTCGCCGGGGACAGCATTACTCAAAGACGTGGCCGCTGGAAA
AACGCCTTGCCCCGGTCTTTGTCGAAAATCGCGTTATCAAGATGACGCGTTATGCGATCC
GTTTTATGCCGCCGATCGCCGTATTTACTCTCTGCTGGCAGATTGCCCTGGGCGGTCAGC
TTGGGCCGGCAGTTGCCACTGCCCTGTTCGCCTTAAGTTTACCCATGCAGGGATTGTGGT
GGCTGGGCAAGCGTTCTGTCACGCCATTACCCCCTGCAATCCTTAACTGGTTTTATGAAG
TTCGCGGTAAATTGCAGGAGTCTGGACAGGTGTTGGCACCCGTTGAAGGCAAGCCTGATT
ACCAGGCATTAGCTGACACGCTTAAGCGCGCCTTCAAACAACTGGATAAAACTTTCCTTG
ATGATTTGTAATTGACCCCTGATTACGCATATAAAAGAAGGCATACTCAGCCTTCTTTTT
TTTCACCGTAGTAGAGTGATACAGGAGTCAACAATGGAAATGACCAACGCGCAACGTCTT
ATTTTGTCTAATCAGTACAAGATGATGACTATGCTCGATCCGGCAAATGCTGAACGTTAC
CGTCGCCTGCAAACAATTATTGAGCGTGGTTACGGATTACAGATGCGTGAATTGGATCGC
GAGTTTGGCGAGCTGAAAGAAGAAACCTGCCGCACTATCATCGACATTATGGAGATGTAT
CATGCGTTGCATGTTTCCTGGTCTAATTTGCAGGACCAGCAATCCATCGATGAACGTCGT
GTCACCTTCCTCGGCTTTGACGCCGCCACTGAAGCACGTTACCTCGGTTATGTCCGCTTT
ATGGTTAATGTGGAAGGGCGCTATACCCATTTTGACGCCGGAACTCACGGTTTTAACGCC
CAGACGCCAATGTGGGAAAAATATCAGCGCATGCTTAATGTGTGGCATGCCTGCCCGCGT
CAGTACCATTTGAGCGCCAACGAAATTAATCAAATTATCAATGCCTGAGGAGGCCCGCGT
GCGGTGCAAAGGTTTTCTGTTTGATCTTGATGGAACGCTGGTGGATTCCCTGCCTGCGGT
AGAACGGGCGTGGAGCAACTGGGCCAGACGTCATGGGTTAGCGCCGGAAGAGGTGCTGGC
TTTCATTCACGGTAAACAGGCGATCACCTCTCTGCGCCATTTTATGGCGGGCAAATCCGA
GGCTGATATTGCCGCCGAGTTTACGCGTCTGGAGCACATCGAGGCCACGGAAACCGAAGG
TATTACCGCGCTTCCGGGGGCAATCGCCTTACTCAGTCATTTGAATAAAGCAGGTATTCC
GTGGGCCATTGTGACTTCTGGCTCCATGCCGGTAGCGCGAGCGCGCCATAAAATAGCTGG
GCTTCCCGCACCAGAGGTGTTTGTAACCGCTGAGCGAGTGAAGCGCGGAAAACCAGAACC
TGATGCGTATCTGTTAGGCGCGCAGCTGCTGGGGCTTGCGCCGCAGGAGTGTGTGGTGGT
GGAAGATGCTCCCGCTGGCGTGCTTTCTGGCCTGGCGGCGGGTTGTCATGTCATTGCGGT
TAACGCTCCGGCAGATACCCCGCGCCTGAATGAGGTCGATTTGGTCCTCCACAGTCTGGA
GCAAATTACTGTGACCAAACAGCCAAATGGCGATGTTATTATTCAGTGAAACACCTGATC
ATGATTTAGCCCCGTCTCGTCGGGGCTTTTTTATGGCAGAATCAAGTCATCCCCCTCAAT
TAACAAGGATAAGTTGTGAACGGTGAATTGATTTGGGTTCTTTCATTACTGGCCGTTGCC
ATCGTCTTGTTTGCGACGGGCAGAGTGCGTATGGATGCGGTCGCTTTGTTTGTTATTGTC
GCGTTTGCATTAAGCGGAACGCTGACAGTCCCAGAAGTATTTTCCGGCTTTTCTGATCCT
AACGTTGTCCTGATTGCCGCCTTGTTTATTATTGGCGATGGTTTGGTCCGTACCGGTGTT
GCCACCGTAATGGGAACATGGCTGGTCAAAGTTGCGGGCAATAGTGAAATCAAAATGTTG
GTTTTGTTGATGCTGACCGTCGCGGGGCTTGGCGCGTTTATGAGTTCAACCGGCGTTGTC
GCTATCTTTATTCCCGTGGTGTTAAGCGTTGCCATGCGTATGCAAACGTCGCCGTCACGT
CTGATGATGCCGTTAAGTTTTGCCGGGCTGATTAGCGGCATGATGACGCTGGTGGCGACG
CCGCCGAACCTGGTAGTCAACAGTGAATTGCTGCGTGAAGGCTATCACGGCTTCAGTTTC
TTTAGCGTAACACCTATTGGCCTGGTCGTGCTGGTGCTGGGTATTTTGTATATGTTAGTG
ATGCGTTTCATGCTGAAAGGGGATACCCAGACCCCGCAGCGCGAAGGCTGGACGCGTCGA
ACCTTTCGCGATCTTATCCGTGAATATCGACTGACCGGGCGTGCGCGACGTCTGGCTATT
CGCCCCGGATCGCCAATGATTGGTCAACGGCTGGATGATCTCAAATTACGTGAGCGTTAT
GGCGCTAACGTCATCGGTGTTGAACGCTGGCGGCGTTTTCGTCGCGTTATCGTGAACGTT
AATGGGGTTTCTGAATTTCGCGCGCGTGACGTTTTGCTTATTGATATGTCTGCGGCTGAT
GTCGATCTCCGGCAATTTTGTAGTGAGCAATTGCTGGAGCCGATGGTACTGCGCGGCGAG
TATTTTTCTGACCAGGCCCTTGATGTGGGCATGGCAGAGATTTCATTAATTCCTGAGTCA
GAACTGATTGGTAAATCGGTGCGCGAAATTGGTTTTCGTACCCGCTACGGACTGAATGTG
GTGGGGCTAAAGCGCAATGGCGTGGCGCTGGAAGGTTCGCTGGCGGATGAGCCTCTGCTG
CTGGGCGATATCATCCTGGTTGTGGGTAACTGGAAACTGATCGGTATGCTGGCCAAACAG
GGCCGCGACTTCGTAGCGCTGAACTTACCGGAAGAGGTGAGTGAAGCATCACCCGCGCAC
AGCCAGGCACCCCATGCCATTTTCTGTCTGGTGCTAATGGTGGCGTTAATGCTGACAGAT
GAAATTCCTAATCCTGTTGCCGCTATCATCGCCTGCCTGCTGATGGGGAAATTCCGCTGT
ATAGATGCTGAAAGCGCCTATAAATCCATTCACTGGCCGAGCATTATTTTGATCGTTGGG
ATGATGCCGTTTGCTGTGGCATTACAGAAAACGGGAGGTGTCGCGCTGGCGGTGAAAGGG
CTGATGGACATTGGCGGTGGTTACGGGCCACATATGATGCTGGGGTGTTTGTTTGTCTTG
TCGGCGGTTATTGGGCTATTTATCTCTAATACCGCGACGGCGGTGTTGATGGCTCCGATT
GCGCTGGCTGCTGCCAAAACGATGGGGGTGTCGCCTTATCCATTCGCGATGGTCGTGGCG
ATGGCAGCATCCGCCGCCTTTATGACACCGGTTTCTTCACCTGTTAACACACTGGTTTTA
GGTCCGGGAAATTACAGCTTCAGTGACTTTGTGAAGTTGGGGGTACCGTTCACCATTATC
GTGATGGCGGTTTGTGTGGTGATGATCCCGATGCTGTTTCCGTTTTGACAAGAGCCTGAT
GTCGCATCCGGCGCTTATTGCCTGATGCGACGCAGACTCCGGCTGCTTACAGCGGTGAAT
CCTGGCTAATCTCATCGAGCGAAAGATGGAAGCTGGGAACAAATATTTCCATGAAGTAGT
CCATCTCCTGGCTGCGACGCGCTTCAAGCGTCGCTTCCAGTCGCGTTTTTGCCAGCAAGA
ATTCATTATTTCCGGCCGCGAGTTCTTCCAGACATTTCAGATATGCACACAGTGCATCTG
CCTGTTTCACCAGCGATTTTTCTTCATCGCTATATGCATGCTCGTCAATTAACGGCGCAA
AGATATCCCGCAGCTCTTCCGGAACCATATCGACCAGTTTTTGCTGAGCGATTTTTTCAA
TAGCCTTGTACTCCTGAGCGATTTGCGAATTGAAGTATTTCACCGGAGTAGGGAGATCGC
CGGTGAGCACTTCTGAGGCATCGTGGTACATCGCCAGTAAAGCGATACGTTCGGCGTTGA
CATTACCGCCAAATTTTCGATTTTTGATAGCTGCCAGCGCATGGGCGACCATCGCTACCT
GCAAACTGTGTTCGGACACATTTTCCGTCCGCACGTTGCGCATGAGCGGCCAGCGGTTAA
TGAGTTTCAGGCGGGAGAGATGGGCAAAAAAATGGCTCTGTTTCATAGTGACCTTACGTA
TGATGACATCATCAGGTCATTGTGGCGGGATAACGCTGCCGGATGCAATCTCCGGCAGTG
AAATTAAGATTACAGCTGATGATAACCAGAAAGGAAACGCGCGAACTTGCTCAAAGACAG
CTCGATATCATCGACACGCGGTAGCGTGACAATGCGGAAGTGATCCGGCCACGGCCAGTT
GAATGCCGTCCCTTGCACCAACAGAACTTTTTCCTGCAACAGGAAATCCAACACCATTTT
CTGATCGTCGTGAATGTTAAAGCGTTTGGCGTCGATTTTCGGGAACATATACAGCGCACC
ACGAGGTTTCACGCAGGAAACGCCCGGAATATCGTTGATCAGTTCCCACGCGCGGTTACG
CTGCTCATAAAGACGACCGCCAGGGGTAATAAATTCACTGATGCTCTGATAACCACCTAG
CGCGGTCTGAATGGCGTGTTGCGCAGGAACGTTAGCACACAGGCGCATTGAAGCCAGCAT
TTCCAGACCTTCGATGTAGCCTTTGGCGTGTTTTTTCGGCCCGTTCAACACCATCCACCC
CTGACGGAAGCCTGCAACGCGGTACGTTTTCGACAGTCCGTTAAAGGTAATGGTCAGCAG
GTCAGGTGCCAGCGGCGCAATTGAGTGATGCTCAGCGTCGTCGTAGAGAATTTTGTCATA
AATTTCATCGGCGAAGATAATGAGATTATGCTGACGTGCAATCTCCACAATCTCCATTAA
AAGCTCTTTGGAATATACCGCGCCGGTTGGGTTATTTGGGTTGATAATAACGATCCCACG
CGTACGAGGCGTAATTTTAGCGCGAATATCATCGAGGTCCGGGAACCAGTCAGAGGATTC
ATCGCAAAGATAATGCACCGCTTTACCGCTGGAAAGCGAAACCGCCGCGGTCCAGAGTGG
GTAATCTGGTGCAGGAACCAACATTTCGTCCCCGCTGTTCAGCAATGCCTGCATTGCCTG
AACGATAAGCTCCGATACACCATTGCCGATGTAAATATCTTCCACGGTAACATCACGCAT
GCCACGAGCCTGGTAGTGCTGCATGATGGCTTTACGCGCGGAGTAAAGACCTTTGGAATC
GCAATACCCTTGAGCGGTAGGCAGGTTGCGTATCACGTCAACGAGGATTTCATCTGGCGC
GTCAAAACCGAACGGGGCTGGGTTGCCGATGTTCAGTTTCAGTACCTTGTTACCTTCTTC
TTCCAGGCGTTTTGCTTCTTTCAGCACCGGACCACGGATGTCATAACAGACATTCTCTAA
TTTGCTGGATTTTTCAATGGGGGACATGAATCTTGACCTTTTTTGCTGTTATCGCCACTC
CCTGCCGTGGAAGTCAGCTTAGAACAATGTACTCCCCCAGGACGGTGTTTTGAAGGTCTG
CAGAATAAGATTTTGCCAGAGGGGAAGGCTCGATTGTGCTGTTAATAACTTAATAATGAC
AAAATAATGAGGTGTATATGCTTTACATGCAATGTTATATAGTGAATTGTTCTGATTCTT
AATTGTAAGTCTGGTTTTTTTATCTGTAAGATAATTGTGTGAAAATGCCTCATTTAAGAA
TTCACTAATGAAACGCGATGATGATATTTCCTCATTACGGAGAGTTTAACTGCGTGATGA
TTTCCGAGGTGTCGCAATGGGGGCAAGGTGTGAAACTATTGTTAAGCGGAATTAATGAAT
GAGGATGATGCTAATTAATTATTATTTAATATTCAAAAAGGTTTTGATGTGCTTATTAAT
AATAGAAGATTACTTTGCCTAACATAACATAACTTTGCATCAGATAATTCGCAATGACCC
TTATAAATAAAAGGTTTTTGGGGTAAAATGCTCGGATAAATGACGGATCCCTGCTCTTGA
TGCCGCCTCACCATTGCTGTTGGTACGTGTTCGCGTATGACCAGCGATGCTGCACGAGAG
TGGAACAAGGACTCACATTTACATTTATACAAACACGCGCATGTCATAAATAGAAAAGAG
TGAGTAACTTAATAGATATGCGATCCCTGAAGATATATTCTGTGATCTACTTCAGGCATT
ATAACGGAACAATGTGAGTCGCTTTTTTAGTGCAACTCATATGCATTTTTACTTTCGTCC
GGGTTCCGGATGAAACTGCCAGGGAGGCACATTACAAATGGAATTGCTTGTTTGTGTGTG
CACAGCATTAACCAGCTCAGTATGAGCCGCCAGTAAGTGATAATATATGATAAGTGCAAA
TCGTCCGATAATTAACCTCGACCTCGATCTGCTGAGAACATTTGTTGCTGTTGCCGATCT
GAACACTTTTGCTGCCGCAGCTGCCGCTGTGTGTCGTACTCAGTCCGCCGTAAGTCAGCA
AATGCAGCGTCTGGAACAACTCGTTGGGAAAGAACTGTTCGCTCGTCACGGTCGCAACAA
ACTGTTAACTGAACATGGCATTCAACTTCTTGGTTACGCCAGGAAAATCCTGCGTTTTAA
TGATGAGGCCTGCTCATCATTAATGTTCAGTAATCTTCAGGGCGTATTAACTATCGGTGC
TTCAGATGAATCTGCCGATACGATCTTACCTTTCCTGTTAAATCGCGTGAGTTCGGTTTA
TCCGAAATTAGCGCTGGATGTCCGCGTTAAACGTAATGCCTATATGGCAGAAATGCTGGA
ATCCCAGGAAGTGGATTTGATGGTAACCACCCATCGTCCTTCAGCGTTTAAGGCATTGAA
CCTGCGTACCTCGCCAACACACTGGTACTGCGCAGCGGAATACATATTGCAAAAAGGCGA
GCCGATCCCTCTTGTATTGCTGGATGATCCTAGCCCGTTTCGCGATATGGTGCTGGCGAC
GCTTAATAAAGCAGATATTCCATGGCGACTGGCTTATGTCGCCTCGACGCTTCCGGCCGT
TCGTGCGGCAGTGAAAGCCGGTCTTGGCGTGACGGCAAGGCCGGTTGAGATGATGAGCCC
GGACCTGCGTGTGCTGAGTGGAGTAGATGGCTTACCGCCGCTACCTGATACCGAATATTT
GCTGTGCTATGATCCGTCCAGTAATAATGAGCTGGCCCAGGTGATCTATCAGGCGATGGA
GAGCTACCATAATCCGTGGCAATACAGCCCAATGTCTGCTCCGGAAGGGGATGATTCATT
GTTGATTGAAAGGGATATCGAGTAATCGACGGACGATAGATAATTCCTGAGACAATAGTG
TAAAAAACGAGCCGCTGGGGGTGTTTTAAACCCCAGCGGCTTTTTTTTAGTAAAAATCCT
TCATCGCATAGTGCAGAACGTACAAAACTGTTCATTTTTCAACCACCAGAGATTCACGTC
CCGAACGCACAAATAATCGCCTGAAAAAAATCACCTGCTACAATGATGTTAAAAAATACG
TAAATTTGTTGCTGCGTTTTTGTTATGGAATGACAAAAGCGTGTCACAGATCAAGAAAAT
ACTCTCTTTTGGGGGGAGGAATCGACACAAATTCCTGTCAAAATAGACCCGTATTTTTTC
CATTGCTTCACAACGGACACGATTCAACAACATCTAATTATCCTGGAGTCGTCAAGGATC
TGGGGTGAAAGGGCATTAAATGCTAATGGTGTTGATATTATGTAAACTAATGTGAAGAAA
CTTTTGTTAAAGTTGACAAAAGGTTATAGAAAGGAGTAAAAAACCACATCAATTAGCTGT
ATAAAAGAATTTCTACAGTGATTGTAAGGTTTTTTTTATTCCTCCCCATGAATCGATGTG
GCGTCCATCTGCCGTGAAGAGCAGTGAATCTGGCGCTACTTTTGATGAGTAAGCAATGAG
TATGTCAACATCCACTGAAGTCATCGCTCATCACTGGGCATTCGCTATCTTTCTTATCGT
TGCCATTGGCCTGTGTTGCCTGATGCTGGTAGGCGGTTGGTTTTTAGGCGGTCGCGCACG
CGCGAGGTCGAAAAACGTGCCGTTTGAATCCGGTATCGACTCGGTCGGCTCCGCCCGCTT
ACGCCTGTCCGCCAAGTTTTATCTGGTGGCCATGTTCTTCGTTATCTTCGACGTTGAAGC
GCTGTATCTGTTCGCATGGTCAACCTCTATCCGCGAAAGCGGCTGGGTAGGCTTTGTGGA
AGCTGCAATTTTTATTTTTGTGTTACTGGCAGGTCTGGTTTATCTGGTGCGTATTGGCGC
GCTGGACTGGACGCCCGCGCGTTCACGCCGCGAGCGTATGAACCCGGAAACGAACAGTAT
CGCTAATCGTCAACGCTAACCGCGAGGCATTAAGATGGATTATACGCTCACCCGCATAGA
TCCCAACGGTGAGAACGACCGTTACCCCCTGCAAAAGCAGGAGATCGTAACCGACCCTCT
GGAGCAAGAAGTTAACAAAAACGTGTTTATGGGCAAGCTCAATGACATGGTTAACTGGGG
TCGTAAAAACTCAATTTGGCCGTATAACTTCGGTCTTTCCTGCTGTTACGTTGAGATGGT
GACTTCGTTTACCGCGGTGCATGACGTGGCGCGTTTTGGCGCAGAAGTATTGCGTGCTTC
GCCGCGTCAGGCTGACCTGATGGTGGTTGCAGGAACCTGCTTTACCAAAATGGCACCGGT
TATTCAGCGTCTGTATGACCAGATGCTGGAACCAAAATGGGTTATCTCAATGGGTGCCTG
TGCCAACTCTGGTGGTATGTACGATATTTATTCCGTTGTGCAGGGCGTCGATAAATTCAT
CCCGGTTGATGTGTATATCCCGGGCTGCCCGCCGCGTCCTGAAGCGTACATGCAGGCACT
GATGCTGTTGCAGGAATCTATCGGCAAAGAACGTCGTCCGCTCTCCTGGGTGGTTGGCGA
TCAGGGCGTTTATCGCGCCAATATGCAATCAGAGCGCGAACGCAAGCGCGGTGAACGCAT
TGCCGTAACTAACCTGCGTACACCTGACGAGATTTAATTTGCGCCTGTCGGCAAAGGGAT
TTTTCTTCGCTTATTCCTAAATCTATTTCGCGAAGCTTACTGCGCCGACAGTCACCACGG
ACCATTTGCAATGGTGAACAATATGACCGACTTAACCGCGCAAGAACCCGCCTGGCAGAC
CCGCGATCATCTTGATGATCCGGTGATTGGCGAACTGCGCAACCGTTTTGGGCCGGATGC
CTTTACTGTTCAGGCGACTCGCACCGGGGTTCCCGTTGTGTGGATCAAGCGTGAACAATT
ACTGGAAGTTGGCGATTTCTTAAAGAAACTGCCGAAACCTTACGTCATGCTGTTTGACTT
ACACGGCATGGACGAACGTCTGCGCACACACCGCGAAGGGTTACCTGCCGCGGATTTTTC
CGTTTTCTACCATCTGATTTCTATCGATCGTAACCGCGACATCATGCTGAAGGTGGCGCT
GGCAGAAAACGACCTGCACGTACCGACCTTCACCAAACTGTTCCCGAACGCTAACTGGTA
TGAGCGTGAAACCTGGGATCTGTTTGGCATTACTTTCGACGGTCACCCGAACCTGCGACG
CATCATGATGCCGCAAACCTGGAAAGGTCACCCGCTGCGTAAAGATTATCCGGCGCGCGC
TACCGAATTCTCGCCGTTTGAGCTGACCAAAGCCAAACAGGATCTGGAGATGGAAGCCCT
GACCTTCAAACCGGAAGAGTGGGGGATGAAGCGCGGCACCGAAAACGAGGACTTCATGTT
CCTCAACCTCGGTCCGAACCACCCGTCGGCGCACGGGGCTTTCCGTATCGTTTTGCAACT
CGATGGCGAAGAGATTGTCGACTGCGTACCAGACATCGGTTACCACCACCGTGGTGCGGA
GAAAATGGGCGAACGCCAGTCCTGGCACAGCTACATTCCGTATACTGACCGTATCGAATA
CCTCGGCGGCTGCGTTAACGAAATGCCTTACGTGCTGGCGGTAGAGAAACTGGCCGGGAT
CACCGTGCCGGATCGCGTTAACGTCATTCGCGTTATGCTCTCCGAACTGTTCCGCATCAA
CAGTCACCTGCTGTATATCTCGACCTTTATTCAGGACGTCGGCGCAATGACGCCAGTGTT
CTTCGCCTTTACCGATCGTCAGAAAATTTACGATCTGGTGGAAGCAATCACTGGTTTCCG
TATGCACCCGGCGTGGTTCCGTATTGGCGGCGTAGCGCACGACCTGCCGCGCGGCTGGGA
TCGCCTGCTGCGTGAGTTCCTCGACTGGATGCCGAAACGTCTGGCGTCTTACGAGAAAGC
GGCGCTGCAAAACACCATTCTGAAAGGTCGTTCCCAGGGCGTTGCCGCCTATGGCGCGAA
AGAGGCGCTGGAGTGGGGCACCACTGGCGCGGGCCTGCGTGCTACCGGGATCGACTTCGA
CGTGCGTAAGGCGCGTCCTTATTCTGGCTATGAAAACTTCGACTTTGAAATCCCGGTGGG
TGGTGGCGTTTCTGACTGCTACACCCGCGTAATGCTTAAAGTGGAAGAGCTGCGCCAGAG
TCTGCGCATTCTTGAGCAGTGCCTCAACAACATGCCGGAAGGCCCGTTCAAAGCGGATCA
CCCGCTGACCACGCCGCCGCCGAAAGAGCGCACGCTGCAACATATCGAAACCCTGATCAC
CCACTTCCTGCAAGTGTCGTGGGGTCCGGTGATGCCTGCCAATGAATCTTTCCAGATGAT
TGAGGCGACCAAAGGGATCAACAGTTACTACCTGACCAGCGACGGCAGCACCATGAGTTA
CCGCACCCGTGTTCGTACCCCGAGCTTTGCGCATTTGCAGCAAATTCCGGCGGCGATCCG
CGGCAGCCTGGTGTCTGACCTGATTGTTTATCTGGGCAGTATCGATTTTGTTATGTCAGA
TGTGGACCGCTAATTATGCACGAGAATCAACAACCACAAACCGAGGCTTTTGAGCTGAGT
GCGGCAGAGCGTGAAGCGATCGAGCACGAGATGCACCACTACGAAGACCCGCGTGCGGCG
TCCATTGAAGCGCTGAAAATCGTTCAGAAGCAGCGTGGCTGGGTGCCGGATGGTGCGATC
CACGCGATCGCCGATGTGCTGGGTATTCCGGCAAGCGACGTCGAAGGTGTGGCAACGTTC
TACAGTCAGATCTTCCGCCAGCCGGTTGGTCGCCATGTGATCCGTTATTGTGACAGCGTG
GTCTGTCATATCAACGGTTATCAGGGTATTCAGGCGGCGCTCGAGAAAAAGCTGAACATC
AAACCAGGGCAAACGACATTTGATGGCCGCTTTACGCTGCTGCCAACTTGCTGCCTGGGG
AACTGTGATAAAGGGCCAAACATGATGATCGATGAGGACACTCACGCGCATCTGACCCCG
GAAGCGATCCCTGAACTGCTGGAGCGGTATAAATGAAAAACATTATCCGTACTCCCGAAA
CGCATCCGCTGACCTGGCGTCTGCGCGATGACAAACAGCCAGTGTGGCTGGACGAATACC
GCAGCAAAAACGGTTACGAAGGCGCGCGTAAGGCGCTGACCGGGCTGTCTCCGGACGAAA
TCGTTAATCAGGTAAAAGACGCTGGTCTGAAAGGGCGCGGCGGCGCGGGCTTCTCGACTG
GCCTGAAATGGAGCCTGATGCCGAAAGACGAATCCATGAACATCCGTTACCTGCTGTGTA
ATGCCGATGAAATGGAGCCGGGCACCTATAAAGACCGCCTGTTGATGGAGCAACTGCCGC
ACCTGCTGGTGGAAGGTATGCTCATCTCCGCGTTTGCGCTGAAAGCTTACCGTGGCTACA
TCTTCCTGCGTGGCGAATATATCGAAGCGGCAGTTAATCTGCGCCGTGCCATTGCCGAAG
CCACCGAAGCGGGTCTGCTTGGCAAAAACATTATGGGAACAGGTTTCGATTTCGAACTGT
TCGTCCATACCGGGGCAGGGCGCTACATCTGCGGGGAAGAAACAGCGTTAATCAACTCCC
TGGAAGGACGTCGTGCTAACCCACGCTCGAAGCCACCCTTCCCGGCAACCTCCGGCGCAT
GGGGTAAACCGACCTGTGTCAACAACGTCGAAACCCTGTGTAACGTTCCGGCGATCCTCG
CTAACGGCGTGGAGTGGTATCAGAACATCTCGAAAAGTAAAGATGCTGGCACCAAGCTGA
TGGGCTTCTCCGGTCGGGTGAAAAATCCGGGACTGTGGGAACTGCCGTTCGGCACCACCG
CACGCGAGATCCTCGAAGATTACGCCGGTGGTATGCGTGATGGTCTGAAATTTAAAGCCT
GGCAGCCAGGCGGCGCGGGGACTGACTTCCTGACCGAAGCGCACCTTGATCTGCCGATGG
AATTCGAAAGTATCGGTAAAGCGGGCAGCCGTCTGGGTACGGCGCTGGCGATGGCGGTTG
ACCATGAGATCAACATGGTGTCGCTGGTGCGTAACCTGGAAGAGTTTTTCGCCCGTGAGT
CCTGCGGCTGGTGTACGCCGTGCCGCGACGGTCTGCCGTGGAGCGTGAAAATTCTGCGTG
CGCTGGAGCGTGGTGAAGGTCAGCCGGGCGATATCGAAACACTTGAGCAACTGTGTCGAT
TCTTAGGCCCGGGTAAAACTTTCTGTGCCCACGCACCTGGTGCAGTGGAGCCGTTACAGA
GCGCCATCAAATATTTCCGCGAAGAATTTGAGGCGGGAATCAAACAGCCGTTCAGCAATA
CCCATTTGATTAATGGGATTCAGCCGAACCTGCTGAAAGAGCGCTGGTAACCGAATTTCG
ATTAACGCTCAGTCTCTGACTGAGAAAACTGGAAGCATGCTAATGGCTACAATTCATGTA
GACGGCAAAGAATACGAGGTCAACGGAGCGGACAACCTGCTGGAAGCTTGTCTGTCTCTG
GGCCTTGATATTCCTTACTTTTGCTGGCATCCGGCGCTGGGAAGTGTCGGTGCTTGCCGC
CAGTGTGCGGTGAAGCAATACCAAAACGCGGAAGACACGCGTGGTCGCCTGGTGATGTCC
TGTATGACACCGGCTTCCGATGGCACCTTTATTTCCATTGACGACGAAGAAGCGAAACAG
TTCCGTGAAAGCGTGGTCGAGTGGTTGATGACCAACCACCCGCACGACTGTCCGGTATGT
GAAGAGGGCGGTAACTGCCATCTTCAGGATATGACTGTGATGACCGGACACAGCTTCCGT
CGCTACCGTTTCACCAAACGTACCCACCGTAATCAGGATTTGGGGCCATTCATCTCTCAC
GAAATGAACCGCTGCATCGCCTGCTACCGCTGTGTGCGTTACTACAAAGATTACGCTGAC
GGTACAGATCTGGGCGTTTACGGTGCGCACGACAACGTCTACTTCGGTCGCCCGGAAGAC
GGCACGCTGGAAAGCGAATTTTCCGGTAACCTGGTCGAAATTTGCCCGACCGGCGTATTT
ACCGACAAAACGCACTCCGAGCGTTACAACCGTAAATGGGATATGCAGTTTGCGCCGAGC
ATCTGCCAGCAATGTTCCATCGGCTGTAACATCAGCCCCGGTGAACGTTACGGCGAACTG
CGTCGTATCGAAAACCGTTACAACGGTACGGTAAACCACTACTTCCTCTGCGACCGTGGT
CGTTTCGGTTACGGTTACGTCAACCTGAAGGATCGTCCGCGTCAGCCAGTACAGCGTCGT
GGCGATGATTTCATTACCCTCAACGCCGAACAGGCAATGCAGGGCGCGGCAGATATTCTG
CGTCAGTCGAAGAAAGTGATCGGTATTGGTTCTCCGCGTGCCAGCGTGGAAAGCAACTTT
GCGCTGCGTGAACTGGTGGGCGAAGAAAACTTCTACACCGGTATCGCTCACGGTGAGCAG
GAACGTCTGCAACTGGCGCTGAAAGTGCTGCGTGAAGGCGGCATTTATACTCCGGCTCTG
CGCGAAATCGAATCTTACGATGCGGTACTGGTGCTGGGCGAAGACGTTACCCAGACCGGC
GCGCGCGTCGCGCTGGCAGTGCGTCAGGCTGTGAAAGGTAAAGCGCGCGAAATGGCGGCA
GCACAGAAAGTGGCTGACTGGCAGATTGCGGCAATCCTCAACATCGGTCAACGTGCGAAG
CATCCGCTGTTTGTTACCAACGTTGATGACACCCGTCTGGATGATATCGCGGCGTGGACT
TACCGCGCACCGGTTGAAGATCAGGCGCGTTTAGGTTTTGCCATCGCCCATGCGCTGGAT
AACTCTGCACCAGCGGTTGACGGTATCGAACCTGAGCTGCAAAGCAAAATCGACGTCATC
GTGCAGGCACTGGCAGGTGCGAAGAAACCGTTGATTATCTCCGGGACGAACGCCGGTAGC
TTAGAGGTGATTCAGGCGGCGGCTAACGTCGCGAAAGCCCTGAAAGGTCGCGGCGCTGAC
GTCGGTATCACCATGATTGCCCGTTCCGTCAACAGCATGGGGCTGGGCATTATGGGTGGC
GGTTCGCTTGAAGAAGCGTTAACCGAACTGGAAACCGGACGCGCCGACGCGGTGGTGGTG
TTGGAAAACGATCTGCATCGTCACGCTTCTGCTATCCGCGTGAATGCTGCGCTGGCTAAA
GCACCGCTGGTGATGGTGGTTGATCATCAACGCACAGCGATTATGGAAAACGCCCATCTG
GTACTTTCTGCTGCCAGCTTTGCTGAAAGCGACGGTACGGTGATCAACAACGAAGGCCGC
GCCCAACGTTTCTTCCAGGTTTACGATCCTGCTTATTACGACAGCAAAACTGTCATGCTG
GAAAGCTGGCGCTGGTTACACTCGCTGCACAGCACCCTGCTGAGCCGTGAAGTGGACTGG
ACGCAGCTCGACCATGTGATTGACGCTGTTGTGGCGAAAATCCCGGAACTGGCAGGTATC
AAAGATGCTGCGCCGGATGCGACATTCCGTATTCGTGGGCAGAAACTGGCCCGTGAACCG
CACCGTTACAGCGGTCGTACCGCCATGCGCGCCAATATCAGCGTTCATGAGCCGCGTCAG
CCGCAGGATATTGACACCATGTTCACCTTCTCGATGGAAGGTAACAACCAGCCGACTGCG
CACCGTTCGCAAGTGCCGTTTGCCTGGGCGCCGGGCTGGAACTCCCCGCAGGCGTGGAAC
AAATTCCAGGACGAAGTGGGCGGCAAACTGCGCTTTGGCGATCCGGGCGTGCGTCTGTTT
GAAACCAGCGAAAATGGTCTGGATTACTTCACCAGCGTACCGGCACGCTTCCAGCCGCAG
GACGGGAAATGGCGTATCGCGCCGTATTACCACCTGTTTGGCAGCGATGAATTGTCACAG
CGTGCTCCGGTCTTCCAGAGCCGTATGCCGCAGCCGTACATCAAACTCAACCCAGCGGAT
GCCGCGAAGTTGGGTGTGAACGCAGGTACACGCGTCTCCTTTAGTTACGATGGCAACACG
GTCACGCTGCCGGTTGAAATCGCCGAAGGACTGACGGCAGGGCAGGTGGGCTTGCCGATG
GGTATGTCCGGCATTGCTCCGGTGCTGGCTGGCGCGCATCTTGAGGATCTCAAGGAGGCA
CAACAATGAGTTGGATATCACCGGAACTGATTGAGATCCTGCTGACCATCCTCAAAGCGG
TGGTGATCCTGCTGGTGGTTGTCACCTGCGGGGCATTCATGAGCTTTGGCGAACGTCGCC
TGCTGGGTCTGTTCCAGAACCGTTACGGACCTAACCGTGTTGGCTGGGGCGGTTCGCTCC
AGCTGGTTGCGGACATGATCAAAATGTTCTTTAAAGAAGACTGGATCCCGAAATTCTCGG
ATCGCGTCATCTTTACCCTGGCACCGATGATTGCCTTTACCTCGCTGCTGCTGGCCTTTG
CGATTGTGCCAGTCAGTCCGGGTTGGGTGGTTGCCGACCTGAACATCGGGATTTTGTTCT
TCCTGATGATGGCAGGTCTGGCGGTTTACGCGGTGCTGTTTGCGGGCTGGTCAAGTAACA
ACAAATACTCGTTGCTGGGTGCGATGCGTGCTTCTGCGCAGACCCTGAGCTACGAAGTGT
TCCTCGGGCTTTCCTTGATGGGCGTGGTGGCGCAGGCCGGTTCATTCAACATGACCGACA
TCGTCAACAGCCAGGCGCATGTGTGGAACGTTATCCCGCAATTCTTTGGTTTTATTACCT
TTGCCATCGCGGGCGTGGCGGTATGTCACCGTCACCCGTTTGACCAGCCGGAAGCCGAGC
AGGAACTGGCGGATGGTTACCACATTGAATATTCCGGTATGAAGTTCGGTCTGTTCTTCG
TGGGTGAGTACATCGGGATTGTGACCATCTCTGCATTGATGGTGACGCTGTTCTTCGGTG
GCTGGCAAGGCCCGTTGTTACCGCCATTCATCTGGTTCGCGCTGAAAACCGCGTTCTTTA
TGATGATGTTCATTTTGATTCGTGCGTCGTTACCGCGTCCGCGTTATGACCAGGTAATGT
CCTTCGGCTGGAAAATCTGCCTGCCGCTGACGCTGATCAACTTGCTGGTAACGGCGGCTG
TCATTCTCTGGCAGGCGCAATAAGGGGCAATAAGACCATGACCTTAAAAGAATTGTTAGT
AGGTTTCGGCACCCAGGTTCGTAGTATCTGGATGATCGGCCTGCACGCGTTCGCCAAACG
CGAAACGCGAATGTACCCGGAAGAGCCGGTCTATCTGCCGCCCCGTTATCGTGGTCGTAT
CGTTCTGACCCGCGACCCGGACGGCGAAGAGCGTTGCGTAGCCTGTAACCTCTGCGCGGT
AGCCTGCCCGGTCGGCTGTATCTCGCTGCAAAAAGCAGAAACCAAAGACGGTCGCTGGTA
CCCGGAATTTTTCCGCATCAACTTCTCACGCTGCATTTTCTGTGGTCTGTGCGAAGAAGC
CTGTCCGACCACGGCGATTCAGTTAACCCCGGATTTCGAAATGGGGGAATACAAGCGCCA
GGATCTGGTTTACGAGAAAGAGGATCTGCTGATCTCCGGTCCGGGCAAATACCCGGAATA
TAACTTCTACCGGATGGCAGGTATGGCAATCGACGGCAAAGATAAGGGCGAAGCAGAGAA
CGAAGCCAAGCCTATCGACGTCAAGAGCCTGTTACCGTAAGGAGAGGGGCAATGGAGTTC
GCTTTTTATATCTGTGGCCTGATAGCCATACTTGCGACCTTGCGAGTGATCACCCATACC
AATCCGGTACACGCACTGCTGTACCTGATTATTTCGCTGCTGGCGATTTCCGGGGTGTTC
TTCTCACTGGGCGCTTACTTCGCCGGTGCGCTGGAAATTATCGTCTACGCGGGTGCCATT
ATGGTGCTGTTCGTGTTCGTGGTGATGATGCTCAACCTGGGCGGTTCAGAAATCGAACAG
GAACGCCAGTGGCTGAAACCGCAGGTGTGGATTGGTCCGGCAATTTTGTCGGCCATCATG
CTGGTGGTGATTGTTTACGCCATCCTCGGTGTTAACGATCAGGGTATCGACGGTACGCCA
ATCAGTGCTAAAGCAGTGGGTATTACGCTGTTCGGGCCTTACGTACTGGCGGTGGAACTG
GCTTCTATGCTGCTGCTCGCAGGTCTGGTTGTGGCCTTCCACGTCGGTCGTGAAGAGCGT
GCGGGTGAAGTGCTGAGCAATCGTAAAGACGACAGCGCGAAAAGAAAAACGGAGGAGCAC
GCATGATCCCCTTACAACATGGACTGATCCTCGCGGCAATCTTATTCGTTCTTGGCTTAA
CCGGTCTGGTTATCCGTCGCAATCTGCTGTTTATGTTGATTGGTCTGGAAATCATGATTA
ACGCCTCCGCGCTGGCCTTCGTGGTCGCCGGAAGCTACTGGGGCCAGACCGACGGTCAGG
TGATGTACATTCTCGCCATCAGCCTCGCGGCGGCAGAAGCGAGTATCGGCCTTGCGCTGC
TGCTGCAACTTCACCGTCGTCGCCAGAACCTGAACATCGATTCAGTAAGTGAGATGCGCG
GATGAACATGCTTGCCTTAACCATTATTTTGCCATTGATTGGCTTCGTCCTGCTGGCATT
CTCCCGTGGGCGCTGGTCTGAAAACGTCTCGGCGATCGTCGGCGTAGGCTCTGTGGGCCT
GGCGGCGCTGGTAACCGCCTTTATCGGCGTTGATTTCTTCGCTAACGGCGAGCAGACATA
CAGCCAGCCGCTGTGGACGTGGATGTCGGTAGGCGACTTTAACATCGGTTTTAACCTGGT
GCTGGACGGCCTGTCGCTGACCATGCTCTCGGTGGTCACTGGTGTGGGTTTCCTTATTCA
CATGTACGCCTCCTGGTATATGCGCGGTGAAGAGGGCTACTCTCGCTTCTTCGCTTACAC
CAACCTGTTCATCGCCAGCATGGTGGTTCTGGTGCTTGCCGACAACCTGCTGCTGATGTA
CCTCGGCTGGGAAGGCGTGGGCCTGTGCTCCTATCTGCTGATCGGGTTCTATTACACCGA
TCCGAAGAATGGCGCAGCGGCAATGAAAGCGTTCGTCGTGACCCGTGTGGGTGACGTGTT
CCTCGCTTTCGCACTGTTCATTCTTTACAACGAACTGGGCACCCTGAACTTCCGCGAAAT
GGTGGAACTGGCACCAGCGCACTTTGCTGACGGCAATAACATGCTGATGTGGGCGACGCT
GATGCTGCTGGGCGGTGCGGTCGGTAAATCTGCGCAGTTGCCGTTGCAGACATGGCTTGC
CGACGCGATGGCGGGCCCGACGCCTGTCTCCGCGCTGATCCACGCCGCAACCATGGTAAC
CGCGGGTGTCTACCTGATCGCCCGTACCCACGGCCTGTTCCTGATGACGCCGGAAGTTCT
GCATCTGGTGGGTATTGTCGGGGCGGTTACGCTGCTGCTGGCCGGTTTTGCCGCGCTGGT
ACAGACCGACATCAAACGTGTTCTCGCTTACTCTACCATGAGCCAGATTGGCTACATGTT
CCTCGCGCTTGGCGTGCAGGCATGGGATGCGGCGATTTTCCACTTGATGACCCACGCGTT
CTTTAAAGCGCTGCTGTTCCTGGCATCCGGTTCCGTCATTCTGGCCTGCCATCACGAACA
GAACATCTTCAAGATGGGCGGTCTGCGTAAATCTATTCCGCTGGTTTATCTCTGCTTCCT
GGTGGGCGGCGCAGCACTGTCGGCACTACCGCTGGTCACTGCGGGCTTCTTCAGTAAGGA
TGAGATCCTCGCGGGTGCGATGGCGAATGGTCATATCAATCTGATGGTGGCAGGTCTGGT
CGGTGCGTTTATGACCTCGCTCTACACCTTCCGTATGATTTTCATCGTCTTCCACGGAAA
AGAACAAATTCACGCTCACGCCGTGAAAGGGGTAACTCACAGCCTGCCGCTGATTGTGCT
GCTGATCCTTTCCACCTTCGTTGGCGCACTGATTGTACCGCCGCTGCAGGGCGTGCTTCC
GCAAACGACGGAACTGGCGCACGGCAGCATGTTGACCCTGGAAATTACCTCTGGCGTGGT
CGCGGTGGTCGGCATTCTGCTGGCAGCCTGGCTGTGGCTGGGTAAACGTACTCTGGTGAC
CTCCATCGCCAACAGTGCGCCGGGCCGTCTGCTGGGCACCTGGTGGTACAACGCCTGGGG
ATTTGACTGGCTGTATGACAAAGTGTTCGTCAAGCCGTTCCTGGGTATTGCCTGGTTGCT
GAAACGCGATCCGCTGAACTCAATGATGAACATCCCGGCTGTCCTTTCCCGCTTTGCAGG
TAAAGGTCTGCTGTTAAGTGAGAACGGCTATCTGCGCTGGTATGTGGCATCCATGAGCAT
CGGTGCGGTCGTGGTGCTGGCACTGTTGATGGTACTGCGTTGAGTTAAGGATTGTGGGAT
TGCCCCTGGGCATATAAGAACGTAGGTCGGATAAGCCGCCTTCGCGGTGCATCCGACACT
ACCCCCAGTCCGAAGAGAATTTTCTGTCGTGAGAATTCGTTGAAAATCCGGTCCTGACGG
GACTTTTACAAGGAATAAAGATCGCCATGTTACTACCCTGGCTAATATTAATTCCCTTTA
TTGGCGGCTTCCTGTGCTGGCAGACCGAACGCTTTGGCGTCAAGGTGCCACGCTGGATCG
CGCTGATCACCATGGGATTGACGCTGGCGCTGTCGCTGCAACTGTGGTTGCAGGGCGGTT
ATTCACTGACGCAATCCGCCGGAATTCCGCAGTGGCAGTCTGAATTCGACATGCCGTGGA
TCCCGCGTTTTGGTATCTCTATTCATCTCGCCATTGACGGGCTGTCGCTGCTGATGGTCG
TGCTGACCGGTCTGCTCGGTGTGCTGGCGGTACTATGTTCGTGGAAAGAGATCGAAAAAT
ATCAGGGCTTCTTCCACCTCAACCTGATGTGGATCCTGGGCGGCGTTATCGGCGTGTTCC
TTGCCATCGACATGTTCCTGTTCTTCTTCTTCTGGGAAATGATGCTGGTGCCGATGTACT
TCCTGATCGCACTGTGGGGGCATAAAGCCTCTGACGGTAAAACGCGTATCACGGCGGCAA
CCAAGTTCTTCATTTACACCCAGGCGAGTGGCCTGGTGATGTTGATTGCCATCCTGGCGC
TGGTTTTTGTTCACTACAATGCGACCGGCGTCTGGACCTTCAACTATGAAGAGCTGCTGA
ATACGCCAATGTCCAGTGGTGTGGAATACCTGTTAATGCTGGGCTTCTTCATCGCCTTCG
CAGTCAAAATGCCGGTGGTTCCGCTGCATGGCTGGCTGCCGGATGCGCACTCCCAGGCTC
CGACCGCCGGTTCCGTTGACCTCGCGGGGATCTTGCTGAAAACTGCCGCTTACGGTTTGC
TGCGTTTCTCCCTGCCGCTGTTCCCGAACGCGTCGGCAGAGTTCGCGCCAATTGCTATGT
GGCTGGGTGTTATCGGCATCTTCTACGGTGCGTGGATGGCCTTCGCCCAGACCGATATCA
AACGTCTGATCGCCTACACCTCGGTTTCCCACATGGGCTTCGTGCTGATTGCTATCTACA
CCGGCAGCCAGTTGGCCTACCAGGGCGCGGTAATCCAGATGATTGCGCACGGTTTGTCGG
CGGCGGGTCTGTTTATTCTTTGTGGTCAGCTTTATGAACGTATCCATACCCGCGACATGC
GCATGATGGGCGGTCTGTGGAGCAAGATGAAATGGCTGCCAGCACTGTCGCTGTTCTTTG
CGGTGGCAACGCTTGGGATGCCTGGCACCGGTAACTTCGTCGGCGAATTTATGATTCTGT
TCGGCAGCTTCCAGGTTGTACCGGTGATTACCGTTATCTCTACCTTTGGGCTGGTCTTTG
CATCTGTTTATTCGCTGGCGATGTTACATCGCGCTTACTTCGGTAAAGCGAAAAGCCAGA
TTGCCAGCCAGGAACTGCCAGGGATGTCGCTGCGTGAGCTGTTTATGATCCTGTTGCTGG
TGGTGCTGCTGGTACTGCTGGGCTTCTATCCGCAGCCGATTCTGGATACCTCGCACTCCG
CGATTGGCAATATCCAGCAGTGGTTTGTTAATTCCGTTACTACTACAAGGCCGTAAATCG
CCATGACAATAACTCCACAAAACCTGATCGCACTGCTACCGTTGCTGATCGTCGGCTTGA
CGGTGGTGGTTGTGATGCTCTCCATTGCGTGGCGACGCAATCATTTCCTCAACGCTACGC
TCTCGGTTATTGGGCTTAACGCGGCGCTGGTTTCGCTCTGGTTTGTTGGCCAGGCGGGCG
CTATGGACGTTACGCCGCTGATGCGCGTTGATGGTTTCGCCATGCTTTACACCGGGCTGG
TATTGTTGGCGAGCCTCGCCACCTGTACTTTCGCCTACCCGTGGCTTGAAGGCTATAACG
ACAACAAGGATGAGTTCTACCTGTTGGTGTTAATTGCCGCGCTGGGCGGGATCCTGCTGG
CGAATGCCAACCATCTGGCGTCTCTGTTCCTCGGTATCGAACTGATCTCTTTGCCGCTGT
TTGGCCTGGTCGGTTACGCTTTCCGCCAGAAACGTTCACTGGAAGCCAGTATCAAATACA
CCATCCTTTCTGCCGCAGCGTCTTCTTTCCTGCTGTTTGGTATGGCGCTGGTGTATGCGC
AGTCTGGCGACCTGTCGTTTGTCGCGTTGGGTAAAAACCTTGGCGACGGTATGCTCAACG
AGCCGCTGTTGCTGGCAGGTTTCGGCCTGATGATTGTTGGCCTCGGCTTCAAACTCTCTC
TGGTGCCGTTCCACCTGTGGACGCCAGACGTATACCAGGGCGCGCCTGCGCCGGTTTCCA
CTTTCCTGGCGACGGCGAGCAAAATCGCTATCTTCGGTGTGGTGATGCGTCTGTTCCTCT
ACGCACCGGTGGGTGACAGCGAAGCGATTCGCGTGGTGCTGGCGATTATCGCCTTTGCCT
CCATCATCTTCGGTAACCTGATGGCGCTGAGCCAGACCAATATCAAACGTCTGCTCGGTT
ACTCATCTATCTCTCACCTCGGCTATCTGCTGGTAGCGCTGATTGCGCTGCAAACCGGCG
AGATGTCGATGGAAGCGGTAGGGGTTTACCTGGCCGGTTATCTGTTCAGCAGCCTCGGCG
CGTTCGGCGTGGTCAGCCTGATGTCCAGCCCGTATCGTGGCCCGGATGCTGATTCCCTGT
TCTCTTACCGCGGTCTGTTCTGGCATCGTCCGATCCTCGCGGCAGTGATGACGGTGATGA
TGCTGTCTCTGGCCGGTATCCCGATGACGCTGGGCTTTATCGGTAAGTTCTACGTGCTGG
CGGTCGGTGTCCAGGCACACTTGTGGTGGCTGGTGGGTGCCGTGGTTGTCGGTTCGGCAA
TCGGCCTCTACTACTACCTGCGCGTGGCGGTGAGCCTGTATCTTCACGCCCCGGAACAAC
CGGGTCGCGATGCACCATCAAACTGGCAGTACAGCGCGGGCGGTATCGTTGTGCTGATCT
CTGCACTGTTGGTACTGGTGCTGGGTGTATGGCCACAACCGCTGATTAGCATTGTGCGTT
TGGCAATGCCGCTGATGTAATCTGTTACTTTGTAAGTCAGAAAGCCGCCGACATGCTCGG
CGGTTTTTCTGAAAAAGAAGGGATAGTAGATAGACGCAGAGCGTTAAGTGAACTGTGTAC
GACTATCGCCAAAATACTCTAAACATAACTGCCTGAATTTTGCCCGCCATTCATCGATAT
TAAAATCATAGCGTTCCTGAAATGCAGTCGTTTCACTGGACATTATCCAGGCATAATTAT
GTAACAGGGTTAATGCCTGAAGCGGTTTTCTCTGCGCAAAATAAGTATCAACACACATCT
GCATCAAGGGGTAATTATTATTTTCCTTTGTTCCTCCAAAGCTAAGATCTAATCCTTGTT
CTTTAATGCACTGAATCACAGGATCATCCTGGAAATTCGGGACATCTGCGGCCTGTGACA
GCAAATGAATGACTTTATTGTCAGGAACACCAAATGCCCAATTGCCAAGATAAGCATTAA
GCGCAGCCTGTGCTGCAGCTTCTGTTTTTTTACATCGGCGATACTGGATTGCCAGTGCTA
ACCAATATTCGCTGACTTCAGGCAATTGTTCTGTTGCTCGCTGTAACAGTGGCAGTGCGT
CATCAAGCCTTCCCGTTGAAAGACATTTCCGAGCAACACGGAAGAGATTTGCTGCAAAGT
CTTGATCTTCGATGCTGATGCCATTTTCATGGGGATCATCATCATTCACTTCCAGCCATT
CTTCGAACTTCTTAATGCTGGAAAAGGCAGGTACGATTCGCCATTCGTCATGGTACGTTT
CGCACACTATAGGTAGTTTATGCTCCTGACCAATAGGCCAGTACAAACCGAAACAGTCTC
CGTTACCATATGCTGCATCTGTAAGTACGGTAAATCCGTTCGGAGGAAAAGGCCCCGGGC
AAATTCCATCAATGCCAGGTGAAATATCACTACTGCGAGGAATAAGTTTCATCATGTTCC
TTCACATAAAAATTTATGTAAACATCCGCTTATCTGTTTATATAAATGTTTTAATCCCAC
CAACAAGTAACCGGATGCATACCCACAGGGACTTCAACCCATCCATGCTCCGTATCTTCT
GACCATCCTTCCCAGCACTCATCAGGGGCAATTTCTTCTACAAACCAGCTCTGAACTTCT
TCTGGTGAAGCAGTGGTGATAACTAAAATACTTTCACTAAAGGGCCAGTCTGGGTCATCG
AACATCGTAATTTCTACCAAAACATCACTAACATTGTTACGCTCACGTATTTTCAGAAAA
TGGTGATAGATAGCTTGCGGAGATTGTTCTGGAATCACATTGCAACATATTGAACCATGG
ATATTATTGTCAATAAAAAAATCCTCAAGAGATAACAATGGACGAGGAGTATCAGGATTA
TTAACATCACCATTGATATTAACAAGTTGGGTAATGCGTTCTAAAGGTGTCATAATTATT
CCCTGAAATAATATATTCATCAAACGAATGACATTGTTTGAATTCATTAGCAGATAAATA
GTGACAATTCCATACGTATTATTAGTTTCAAGAGCATCATAACATGAATGTTAAGCAGGA
AAACGTGAGATATTCAGTCAGGCCGGGTCGTTATCCAGACGTTGTTATATTTAATATCAT
AAATATTTAAAGGGGTTTGACATGGAATGGTTAAGTGAAATTCGTAAACTTCGGAAGAAC
GTACCTGTCGGTATCCAGGTTGCCAGACGTTTGTTAGAGAGGACTGGCGGTGATGTTGAT
GAAGCCATCAAGTTGTTTCATATTGACCAAATCAATATATTGACGGCAAAAGCAGACGTC
ACTCATCAGGAAGCAGAGAATGTTTTGTTGGCTACAAACTATGATATTGCAGAAGCTCTT
CGGCGTATTGATGAACAACGCTATACACTGACGGAATTGATTTTGCGTAAAAATAAGGAT
GCCGGAGATGCCTTAAACAATATAGCATTGGCGATTGAATATGAGTGGGATCTCAAGCGT
AAGTTTTGGTTTGGTTTTGCAGATATCCAATTATTACCGCCAGTTTTACAAACATTTATG
CTGGTTTATGAATGGCATGAATATGTTGGTTGGGAAGGAATGGAGTGTGGGATATTTTTT
GAAAGTGATCATACTCACCAGCAATTGCAAGCTTTGGGGTTATTAGAACTCGCCCAAAAA
ATGGTTACTGCAAGAATCCGATATGATGAGCTAAAAGACAAGGCCGAAAATTTTCACGAG
ATTACAGAGGATGACATATTCAAAATGCTTATAATACATTGTGACCAACTTGCAAGAGAG
GTTGATTCTATATTACTGCAATTTGTGAAGGACAATATTGATGTTTTCCCGTGTCGCCAT
AACAGACACGAGTTATAAAAAATAATCCCAAAATTGAACAGGCTTTTTATCTACCTGGTA
ATGACAGGTTCAATTCCGTTTTCATCAAGCATGACAGATCGTTGCCAGCACAGAGGATAT
CGCTGTTACATACCGAATATACGGTATTGCATTTAACAATGCGACTAAGCAAGCATTTAG
TAATATTTATACAAGGGGATAAAAACCGGACCATGGTTAAAGATTTTTTCAAGATGATCC
TGGCGTAAATCTTAACTAATGGGTCTTTCTCCCCCAGGCATCAAGCTATATCACCCAACA
ATAACCGTCAGCGCATGATTCCCTTGTCGCAGCATACGTCGATACGCGCTAATCAGCTTT
TCCATATCAAGCATGATCGAGGCAAAGAGTTGCCCCTCTAACTCTTCTGAAAAGGTCACT
CCCGGATAAATCTCCATTTCATTGAGTCGCTTAATGGAAAACTGTTTACGCAGTTCATTT
CGATCCAGTGATTCCAGTCGGTCGATTGTCGCGGCTAACTCCTGATTCCAGGTCAATCCA
AGGAAGCCATCTATGCCATCTTCGAGGCTGTGTTCACCAAGCACGGCACGACTCAGCGGA
TCATTCTTCGCGGGATCAAAAGCAGAGGTGCCTGTCAGCCCAAAGTGTAAAAAATCCCAG
CGTTTATCAATATCCAGTCGGCGTAATCCTGAAAGCGTGTCATGTATATTATCCATCAAA
GGTTTTTCAGTAGACTCAAGCAGTTGGTTAATCTTTTCTGAGTCAATTTCTGCAAAATAG
CCAATCATTCCCATTTATTTTTCCTCCGTTGAATTTCATGTTTCGCATCTTAAAACAGAT
GAGGGAAAATAAAATGTGCATGTCGCTTTTTCTGGACCCGCCTCGAGAAATTTTTATTAT
TTACTGTTGTATAACAAAGTTATAACACCATCCACTACCTGAGCCATTTTCTGATAATTC
AATCTGTCTGCGGTATCACCGGGCAAGTGGTATTGTTTATTACGATAAAAAGCGGTGTCA
GTAATCATTATGGCGGGAATATCGTGTTGCCAATAATTCAGGTGGTCAGAGAAATCAATA
CCGGGAATAAACCCTGGGGTATTCATAGAATAAACAGATAAATCCTGAGATGACAACAAT
GCCGCTTTTACCTGACGAACGGCGTTGATATCCTGTATTCTGCCGACCACGGCAATAAAG
TCTCCCCGATCGGGATAAAGCCAGGACATTGCCGGGTAAGGGTAATTCTGGCTTCCAGGC
GCAGAGTCGTAATAGCCAATCATCTCCAGTGCTATCATTAATTTCACTGGACGCTCAAGC
GAAGCTGCATGCACCGCGCTCCCCATTTCATCGCTACGAAAGAAGGGCGGTTCTTCCGAC
GCATAGGCGACCAGCTGCACGCCTGTTTTCGGTACTTGCTGATGTAACAAACGTGCCAGT
TCGAGTAATCCTGCCACACCGCTGGCGTTATCATCCGCGCCCGGCGTATAGGTCAATTGA
TCGTTTTCATAACTGCTGGCAGAGTCATAATGCGCACCAATAATAATCAGCGGTCCATCG
GCAGGACCATAATCAGCAACAATGTTTTTGTAGGGGCCACCCGTAATGGGGACGTCCTGC
GAGGTAACTCTGGCACCGCTACTGACAAAGACCTCTTTTATATATTCTGCGGACCTATTC
AGATTATCAATATTGTCGGCACTACGTGGATGCACAGTTTGTGTAAGATAACGAACTGTT
TTTTCTAATTGCTCAGGACTTGCGTGTCGGGGCGTTGACGGTAATGCATTGACCCAGGGT
TGGTAAAAAATAATCATAGGGAGTAAAAACACAAATAATATAATAAAAGCAAAGATTATT
TTTTTCATATGCAAATTATTAATGGGTTGCGTTGTTGAATCATTATTTGCTATGGGTTTC
GATATTGTATTTTATTAAGATTAGCAGGATTATACAAAGAGTATATTTTATGTCTGGTGC
CTGAGTTTATTTAAAAGGATTTTATATGCGAAATAAAAATATAATCATGTTGCTTATGAG
TAGTTTGATTTTGTCAGGATGTGGGCCGCAACCTGAGAATAAGGAAAGTCAGCAACAACA
ACCCAGTACTCCCACAGAGCAGCAAGTGCTTGCCGCGCAGCAAGCTGCAATAAAAGAGGC
TGAGCAAAGCGCCGCCGCCGCGAAAGCCTTGGCCCAGCAAGAAGTGCAACAATATTCAGA
CAAACAGGCTTTACAGGGGCGATTGCAGGAAGCGCCAACATTTGCAAGAGCGGCTAAAGC
AAAAGCTACACATATCGCAAATCCAGGAACCGCTCGCTACCAGCAGTTCGATGATAATCC
GGTTAAGCAGGTAGCGCAAAATCCGTTGGCGACGTTTAGTCTTGACGTTGACACTGGCAG
TTATGCGAATGTAAGGCGTTTCCTCAATCAAGGGCTGTTACCTCCGCCAGACGCTGTGCG
GGTGGAGGAGATAGTCAATTATTTCCCGTCTGATTGGGATATCAAAGACAAACAATCTAT
TCCGGCCTCTAAGCCAATACCTTTCGCTATGCGCTACGAATTGGCACCTGCACCATGGAA
TGAACAGCGAACATTGCTGAAAGTTGATATCCTGGCGAAAGATCGCAAAAGTGAAGAGTT
ACCAGCTTCTAATCTGGTCTTTCTTATCGACACTTCTGGTTCAATGATTTCTGATGAACG
TTTGCCACTTATCCAGTCTTCGTTGAAATTATTGGTCAAAGAACTTCGTGAGCAGGATAA
CATTGCCATCGTGACCTACGCTGGCGACTCCCGTATTGCATTGCCTTCTATCTCCGGGAG
TCATAAGGCGGAAATTAATGCCGCAATTGATTCGCTGGATGCCGAAGGCAGTACCAATGG
CGGTGCCGGGCTGGAACTGGCTTATCAGCAGGCGACGAAGGGGTTTATTAAGGGCGGCAT
CAATCGCATTTTATTAGCCACTGACGGTGACTTTAACGTTGGCATTGACGATCCAAAATC
GATTGAATCAATGGTCAAAAAACAGCGGGAGTCTGGTGTTACTCTGTCGACGTTTGGCGT
GGGGAATAGCAATTACAACGAGGCAATGATGGTGCGAATTGCCGATGTTGGTAACGGCAA
CTACAGCTACATTGATACCCTCTCTGAAGCGCAGAAAGTATTGAATAGTGAAATGCGGCA
GATGTTGATTACCGTAGCAAAAGATGTCAAAGCGCAAATTGAGTTTAACCCCGCGTGGGT
AACGGAATACCGTCAGATTGGTTATGAAAAGCGCCAACTTCGGGTGGAACATTTTAATAA
CGACAACGTTGATGCAGGGGATATAGGCGCAGGCAAACATATAACGTTGTTATTCGAATT
AACGCTGAACGGGCAAAAAGCATCAATTGATAAGTTACGCTATGCCCCGGATAACAAATT
AGCGAAATCGGACAAAACGAAAGAACTGGCCTGGTTAAAAATTCGCTGGAAATACCCGCA
GGGAAAAGAAAGTCAGTTAGTTGAATTCCCGCTGGGGCCAACAATAAACGCGCCCTCTGA
AGATATGCGTTTTCGCGCAGCAGTAGCTGCATATGGGCAAAAGTTACGCGGTTCTGAATA
CCTGAACAATACCTCCTGGCAGCAGATCAAACAGTGGGCTCAGCAGGCAAAAGGGGAAGA
TCCACAGGGTTACAGGGCGGAATTTATTCGCCTGATTGAACTGGCGGATGGTGTGACTGA
CATCAGTCAGTGATGACTGTTTAGCAAACTATGTTCGACCAGTCAGCATATTTGCTGACT
GGTCGAATTAATTAACAATGATGTTAACTCACTCTTTTGCCGGATGCTCTATTTTTGGGT
TGTGAGTGTTTTATTTCTAAGTTTCTATAATAATGATTGATATTTGCATCGCCATATTTA
TCTAAATAACAATTTCTGTTTGCCAGTCGATGTTGAAAATCAATTTCGTACTGCTCTTCT
GCTGAATATTTTTTAAATCTGTCAGCATGGTTTTTTAATAACGTATAGGGGGCGCTGTCA
GAATTGCTTTCCCTTTGTTCAATCACTTCCTGGGCTGCCATGCACACAAATGCACCGCAA
CTTTGGCTTAAGTATTGCTGAAGATCGGCATGTAAAAATATTATCTCTGGTTCATTTAAA
TGAACTTTTATATTATTATTCGACATTTCTCCCATGAGTTCAGAATTAAAACTATTAATG
ACACGCTTAAGTGAATTTTCTTTATCATAGCCTAGTGCACGCAATGAGTTGAATATGACG
CATTTTATTTGTAGTTTATTATTTTTTTTATTTACTATTTTCTGTAGCGAAACTAATATC
CAGTGTCCGCCAGTATTTATGGGGAATAACTGGACTTCATTCGGCCATGATGGATCGCTC
TTAATATTTTCATTGAGAGCGTCTTCCAGGTGAGTTCTGGTGGAGTAGGGGACGTAGAGA
CCAGTAGGATAATTGACTTGAGTATTTTTTGCATTAGCGGCGATCTTCTGAAGATAGCAA
GCTATTTCATCTGTGGTTAATTGACGATTTTTATCCCAGAAGTTTGTACCATCACTCAGT
TCATTATTCTCATCATTTAAAAGCACCTTTGAAAGCGACTGTTTTTCAGATATAAGAGGA
ATTTCATCACCGATAATTGTCATTAATTTCGAAGGGGAGAATAGTTTTTTGAACAGGAGA
TCATCTGAATCATGTGATTTGAGGGGGGAGTTGGTTGCGATATGTGCCAGATTATATAAT
TTTAAACAAGCATTTTTGATAAGTCGGATAATCGATAGGGTCTCATTTGTTGGGGTTCTA
ACAATATGGTAAAGAATATCTTCAGCTTCTTTCCCAAATTTATCATAACCTAACGCAATA
TTATGCAGTAACTCAATGCTTTCTTCATCTCCGGATAACGCTGTTTTTTTTAAAGACTGC
AGTAATTCCTCGGTCACAGTAAATTTTTCTGCAAATGTCTGACTGAGTTGCGTTTGAGAT
AATTGACAATAATTGCTGACAACTGTAACCATCATGGGCTCCTTTTAGTTGCAAAGGTTG
TGCTGAATCAAGATGAAAAGAGGCAACTTATTGCTCTGAATATAGTGCGTAAGGAGATGA
ATAAATATCAAAAATCGCTCAATATGCCTGTGTGGGTGGATATATGTAGCGCGGGTTGCG
ATAACAGGGCAAGTTTCGCCCTGTTTTTAATAATAAGCAGAGTTAAACGTTAAACACGGT
GAAATCATTCGCCAGTTCAGTCGCCGGGAAAATTGACCTGCATTCACGTAACAGGTGCTG
ACAACCTTTGTCATCATAGCGCGAGCTGACGTGGGTAATGATTAGCTTGCCGACTCCAGC
CTCACGGGCTAGTGTCGCAGCCTGGCGTGTAGAGCTATGGCCGCGACTATTGGCTTTGGC
TTCCATGGTTATATCCAGCGTCGCTTCGTGCACCATGACATCGACACCTTTAGCCAGGTC
AAGTGCGGCATCGCAGGGGCCGGTATCGCCGAAAATAGCGAGCGCTTTACCTGGCACTGG
AGCAGCTAAGTAATCTGCGCCGTTAATCTGCCTTCCATCTTCCAGCGTGATTGTTTTGCC
CGCTTTTAATTCCTGAAACAGTGGGCCAGGCGGCACGCCAGCAGCTTTTAATGCCTGGGC
ATTTAATGCACCCGGTTTATCATGTTCTTCAATACGATAGCCATAACATTCCAGTGGGTG
TTCCAGCGGATAAGCGGTTACTTTGCGCAGGCCATCATCGAGAATTTCGCCAGCGCCAAT
TTCGACAATTTCCAGCGGATAATCGGTCCATGAGCCGCTAATCCGCAGCGCGGTTTCCAC
AAATTCACGGATACCTTGCGGACCATAAATCGTTAAGGGTTGGATAATGCCTGACATAGA
ACGACTGCACAGCAAGCCGGGTAAACCAAAAAGATGATCGCCATGAAGGTGACTGATAAA
AATCTTGTCCAGTTTTCCAGGGTTAAAGGCGGTATGCAGTAGCTGATGCTGGGTGCCTTC
ACCGCAGTCAAACAACCAAAGTCCGCTCTGGGTCGGATGTTGCAGGTTAAGCAATATTGC
CGTGACATTGCGCGTGCGGGTTGGCACACCGGCTGAAGTACCTAAAAAAATTAATTCCAT
GAGTTCATCACGTTTCAAAAAATATTCCGGCTAGTATAAGGCATACATCTAAAAGGAGAG
CATTATGATTGAATGGCAAGATCTGCATCACTCTGAATTATCGGTTTCCCAGCTTTATGC
CTTATTACAACTGCGTTGCGCGGTGTTTGTTGTCGAGCAGAATTGCCCTTATCAGGATAT
CGATGGTGATGATTTGACGGGGGATAATCGCCATATTCTCGGTTGGAAAAATGATGAACT
GGTGGCGTATGCGAGGATTCTGAAAAGTGATGATGATCTTGAGCCGGTCGTTATAGGTCG
GGTGATTGTCAGTGAAGCGTTGCGTGGCGAAAAAGTGGGGCAGCAGCTGATGAGTAAAAC
ACTCGAAACATGTACGCATCACTGGCCTGATAAGCCTGTTTACCTCGGGGCGCAGGCGCA
TCTGCAAAACTTCTACCAGAGTTTCGGTTTTATCCCTGTGACGGAGGTCTATGAAGAAGA
TGGTATCCCACACATTGGGATGGCACGCGAGGTAATTCAGGCGTAATCAACAACCCTTGT
CTATAGTTAGTGACAGGTTTTACGCAAATGGAGAACGAGAATGTCTAATCAGTTTGGTGA
TACACGTATCGATGACGACCTGACGCTGCTTAGTGAAACACTGGAAGAGGTGCTCCGCTC
CTCTGGCGATCCCGCCGATCAGAAATATGTTGAGCTGAAAGCGCGTGCAGAAAAAGCGCT
GGATGATGTGAAAAAACGGGTTAGCCAGGCTTCAGACAGTTATTACTATCGGGCGAAGCA
GGCAGTTTATCGTGCTGATGACTACGTCCACGAAAAACCCTGGCAAGGAATTGGTGTGGG
CGCGGCCGTTGGGCTGGTACTAGGACTGTTGCTGGCACGCCGTTAAAACCTCCCTACACC
GGGGTACTGCATTTTTTTTGTAGTACCCCGTATAATGTGAGGCTTTTAACAGGGAGAGGT
CCGCGTGCAATCACTTACTACGGCGCTGGAAAATCTACTGCGCCATTTGTCGCAAGAGAT
TCCGGCGACACCCGGCATTCGGGTTATCGATATTCCTTTCCCTCTCAAAGACGCTTTTGA
TGCCTTGAGCTGGCTGGCCAGTCAGCAAACATACCCGCAATTCTACTGGCAACAACGTAA
TGGTGATGAAGAAGCTGTCGTCCTGGGCGCGATTACCCGTTTTACGTCGTTGGACCAGGC
ACAACGTTTTCTTCGCCAGCACCCGGAACACGCCGACTTACGCATTTGGGGGCTGAATGC
TTTTGACCCGTCGCAGGGCAATTTACTTTTACCCCGCCTGGAATGGCGACGCTGTGGCGG
TAAAGCCACGCTGCGGCTGACGCTATTCAGCGAAAGCTCCCTTCAGCACGATGCGATTCA
GGCAAAAGAATTTATCGCCACACTGGTGAGTATCAAGCCCTTGCCTGGGTTACATTTAAC
CACCACGCGAGAACAACACTGGCCGGACAAAACGGGCTGGACGCAATTAATCGAACTGGC
AACGAAAACCATCGCCGAAGGTGAGCTCGACAAAGTGGTGCTCGCTCGGGCAACTGACCT
GCATTTCGCAAGTCCGGTCAACGCGGCGGCGATGATGGCTGCCAGTCGTCGACTGAATCT
GAATTGCTACCATTTTTACATGGCCTTTGATGGCGAAAATGCTTTTCTTGGCTCTTCACC
GGAACGGTTATGGCGGCGGCGTGACAAAGCGCTGCGTACTGAAGCGCTGGCGGGAACAGT
AGCAAATAATCCTGATGATAAGCAGGCGCAGCAGTTAGGAGAGTGGCTGATGGCGGATGA
TAAAAACCAGCGCGAGAACATGCTGGTGGTGGAAGATATCTGTCAACGATTACAGGCCGA
TACCCAGACGCTGGATGTTTTACCGCCGCAGGTACTGCGTCTGCGTAAAGTGCAGCATCT
TCGCCGCTGTATCTGGACTTCACTCAACAAAGCGGATGATGTGATCTGTTTACATCAGTT
GCAGCCAACGGCAGCAGTTGCTGGCTTACCGCGCGATCTGGCGCGACAGTTTATCGCCCG
TCACGAACCGTTCACCCGAGAATGGTACGCCGGTTCTGCGGGCTATCTCTCATTACAACA
AAGCGAATTCTGCGTTTCCCTGCGCTCAGCAAAAATTAGCGGCAATGTCGTGCGATTATA
TGCTGGCGCGGGCATTGTCCGTGGTTCCGACCCCGAGCAAGAGTGGCAGGAAATCGACAA
CAAAGCGGCAGGGCTGCGTACTTTATTACAAATGGAATAGTAATGAGTCGCATCATTACC
GATTCATATCAATAATCTATTTTTGTAGCTCCTTATACTTAGCCGCAATATTGATACCGG
ACAAACTCATGTCAGTAAGCGCATTTAACCGACGCTGGGCGGCGGTCATTCTGGAAGCAT
TAACGCGTCACGGCGTCAGACACATCTGTATCGCCCCAGGCTCGCGTTCTACACCGTTAA
CGTTAGCGGCGGCGGAGAATTCCGCATTCATTCACCACACCCATTTCGATGAGCGTGGGT
TGGGGCATCTGGCGCTGGGGCTGGCGAAAGTCAGCAAGCAGCCGGTGGCGGTGATTGTGA
CCTCCGGCACGGCGGTGGCAAATCTCTATCCGGCACTGATTGAAGCCGGGTTAACCGGAG
AAAAACTGATTCTCTTAACCGCCGATCGCCCGCCGGAGCTAATTGACTGCGGCGCGAATC
AGGCAATTCGCCAGCCGGGAATGTTCGCCTCTCACCCCACGCACAGTATTTCATTGCCGC
GCCCGACCCAGGATATCCCCGCACGTTGGCTGGTTTCTACCATCGACCACGCTCTCGGTA
CGCTTCATGCGGGGGGAGTCCATATCAACTGCCCGTTTGCTGAACCGCTGTATGGCGAAA
TGGACGATACCGGGCTTAGCTGGCAACAGCGTCTGGGTGACTGGTGGCAGGACGACAAAC
CGTGGCTGCGTGAAGCGCCTCGTCTGGAAAGTGAAAAACAGCGCGACTGGTTCTTCTGGC
GACAAAAGCGCGGCGTGGTGGTTGCCGGGCGCATGAGTGCGGAAGAGGGCAAAAAAGTTG
CCCTGTGGGCGCAAACTCTTGGCTGGCCGCTGATTGGCGATGTGCTGTCACAAACCGGGC
AGCCGCTGCCGTGTGCCGATCTTTGGTTAGGCAATGCCAAAGCGACCAGCGAGCTGCAGC
AGGCGCAAATTGTGGTGCAACTGGGAAGCAGCCTGACGGGGAAACGGCTCCTGCAATGGC
AGGCAAGCTGTGAACCAGAAGAGTACTGGATTGTTGATGACATTGAAGGGCGACTTGATC
CGGCACACCATCGCGGACGTCGCTTAATTGCCAATATTGCCGACTGGCTGGAGCTGCATC
CGGCAGAAAAACGCCAGCCCTGGTGCGTTGAAATCCCGCGCCTGGCGGAACAGGCAATGC
AGGCGGTTATTGCCCGCCGTGATGCGTTTGGCGAAGCGCAACTGGCGCATCGCATCTGCG
ACTATCTGCCTGAACAGGGGCAATTGTTTGTTGGTAACAGCCTGGTGGTACGTCTGATTG
ATGCGCTTTCGCAACTTCCGGCAGGTTACCCGGTGTACAGCAACCGTGGGGCCAGCGGTA
TCGACGGGCTGCTTTCGACCGCCGCCGGCGTTCAGCGGGCAAGCGGCAAACCGACGCTGG
CGATTGTGGGCGATCTCTCCGCACTTTACGATCTCAACGCGCTGGCGTTATTGCGTCAGG
TTTCTGCGCCGCTGGTATTAATTGTGGTGAACAACAACGGCGGGCAAATTTTCTCGCTGT
TGCCAACGCCGCAAAGCGAGCGTGAGCGTTTCTATCTGATGCCGCAAAACGTCCATTTTG
AGCACGCCGCCGCGATGTTCGAGCTGAAATATCATCGTCCGCAAAACTGGCAGGAACTTG
AAACGGCATTTGCCGACGCCTGGCGCACGCCAACCACCACGGTGATTGAAATGGTGGTTA
ACGACACCGATGGTGCGCAAACGCTCCAGCAACTTCTGGCGCAGGTAAGCCATTTATGAT
CCTGCACGCGCAGGCAAAACACGGAAAACCAGGTTTACCCTGGCTGGTGTTTTTGCACGG
TTTTTCCGGCGATTGCCACGAATGGCAAGAAGTGGGCGAGGCGTTTGCCGACTACTCACG
GTTGTATGTTGATCTCCCAGGTCACGGTGGTTCGGCGGCGATTAGCGTCGATGGATTTGA
TGATGTCACCGACTTACTGCGTAAAACCTTGGTTAGTTACAACATCCTTGACTTCTGGCT
GGTGGGGTACTCGCTTGGTGGACGGGTGGCGATGATGGCGGCTTGCCAGGGGCTGGCGGG
GCTTTGTGGGGTTATTGTCGAAGGCGGGCATCCGGGGCTGCAAAATGCTGAACAACGTGC
GGAACGTCAGCGTTCCGATCGCCAATGGGTGCAGCGTTTTCTCACAGAACCGTTAACGGC
GGTATTTGCCGACTGGTATCAACAGCCTGTTTTTGCCTCACTCAATGACGATCAACGCCG
GGAGCTGGTGGCGCTGCGCAGCAACAATAATGGCGCAACGCTTGCCGCCATGCTGGAGGC
GACTTCTCTCGCCGTCCAGCCTGATTTACGTGCTAACCTTAGCGCCCGCACATTTGCGTT
TTATTATTTATGTGGTGAACGTGACAGCAAATTCCGCGCCCTGGCGGCGGAACTGGCTGC
CGACTGCCATGTCATTCCTCGCGCCGGACATAACGCGCATCGGGAAAATCCCGCTGGCGT
AATCGCAAGTCTGGCGCAGATCTTGCGTTTCTGACTAAAGGACACAATATGATTTATCCT
GATGAAGCAATGCTTTACGCACCGGTTGAATGGCACGACTGCTCCGAAGGTTTCGAGGAC
ATTCGTTATGAAAAATCCACCGACGGTATCGCAAAAATCACCATTAATCGTCCGCAGGTG
CGCAATGCCTTCCGTCCTCTGACGGTAAAAGAGATGATCCAGGCGCTGGCAGATGCGCGT
TATGACGACAACATCGGCGTGATCATTCTGACTGGTGCAGGCGATAAAGCGTTCTGCTCC
GGTGGTGACCAGAAAGTGCGTGGTGATTACGGCGGCTATAAAGATGATTCCGGCGTACAT
CACCTGAATGTGCTGGACTTCCAGCGTCAGATCCGTACCTGTCCGAAACCGGTTGTCGCG
ATGGTGGCTGGCTACTCCATCGGCGGCGGTCACGTTCTGCACATGATGTGCGACCTGACT
ATCGCGGCAGATAATGCCATCTTCGGTCAGACTGGCCCGAAAGTCGGTTCCTTCGACGGC
GGCTGGGGCGCTTCCTACATGGCTCGCATCGTCGGGCAGAAAAAAGCGCGTGAAATCTGG
TTCCTGTGCCGTCAGTACGACGCAAAACAGGCGCTGGATATGGGCCTTGTGAACACCGTG
GTACCGCTGGCGGATCTGGAAAAAGAAACCGTCCGTTGGTGCCGCGAAATGCTGCAAAAC
AGCCCGATGGCGCTGCGCTGCCTGAAAGCTGCACTGAACGCCGACTGTGACGGGCAGGCG
GGGCTGCAGGAGCTGGCGGGCAACGCCACCATGCTGTTCTACATGACGGAAGAAGGTCAG
GAAGGTCGCAACGCCTTCAACCAGAAACGTCAGCCTGACTTCAGCAAATTCAAACGGAAT
CCGTAATGCGTAGCGCGCAGGTATACCGCTGGCAGATCCCCATGGACGCGGGGGTGGTTC
TGCGCGACAGGCGGTTAAAAACCCGCGACGGGCTGTATGTTTGCCTGCGTGAAGGCGAGC
GCGAAGGGTGGGGGGAGATCTCCCCACTGCCGGGCTTCAGTCAGGAAACCTGGGAAGAGG
CGCAAAGTGTGCTGCTTGCCTGGGTAAATAACTGGCTGGCAGGCGATTGCGAGCTACCGC
AGATGCCTTCCGTGGCCTTTGGCGTAAGCTGTGCATTGGCAGAACTGACAGATACGTTGC
CGCAAGCAGCCAACTACCGTGCGGCACCGCTGTGTAATGGCGATCCGGACGATCTGATCC
TCAAACTTGCAGATATGCCAGGCGAGAAAGTGGCGAAGGTCAAAGTGGGATTGTACGAAG
CGGTGCGCGACGGCATGGTGGTGAATCTGTTGCTGGAGGCAATTCCGGATCTGCATTTGC
GTCTTGACGCAAATCGCGCCTGGACACCGCTGAAAGGTCAGCAGTTTGCCAAATACGTTA
ACCCGGATTATCGCGACCGCATCGCGTTTCTCGAAGAGCCGTGCAAAACCCGCGATGATT
CGCGAGCGTTTGCCCGTGAAACCGGCATTGCCATTGCCTGGGATGAAAGCCTGCGCGAGC
CGGATTTTGCCTTTGTGGCTGAAGAGGGCGTGCGCGCGGTAGTTATCAAACCCACGCTCA
CGGGCAGTCTGGAAAAAGTACGCGAGCAGGTACAGGCGGCGCACGCGCTGGGGCTGACGG
CGGTGATCAGTTCTTCCATTGAATCGAGCTTAGGCTTAACGCAACTGGCGCGGATTGCCG
CCTGGTTAACGCCGGACACCATTCCAGGGCTGGACACGCTGGATCTGATGCAGGCGCAGC
AGGTACGTCGCTGGCCGGGTAGCACGCTGCCTGTCGTGGAAGTTGATGCACTGGAGCGGT
TGTTATGATCTTCTCTGACTGGCCGTGGCGTCACTGGCGGCAAGTGCGGGGAGAAACCAT
CGCCTTACGTCTTAATGACGAGCAACTCAACTGGCGCGAGCTTTGTGCTCGCGTCGATGA
ATTAGCCTCCGGATTTGCGGTGCAGGGGGTGGTTGAGGGCAGCGGCGTGATGTTGCGGGC
GTGGAATACGCCGCAAACGCTGCTCGCCTGGCTGGCGTTACTGCAATGCGGGGCGCGGGT
GTTGCCCGTGAACCCTCAGCTGCCGCAACCGTTGCTTGAAGAATTGCTGCCCAATCTGAC
GCTGCAATTTGCTCTGGTGCCGGATGGGGAAAACACGTTTCCGGCATTAACGTCGCTGCA
CATTCAGCTGGTTGAAGGCGCACATGCCGCTACGTGGCAGCCGACGCGTCTGTGCTCAAT
GACGTTGACCTCGGGTTCTACCGGTTTGCCGAAAGCCGCTGTCCATACTTATCAGGCCCA
TCTTGCCAGTGCGCAAGGTGTGTTATCGCTGATTCCGTTTGGCGATCACGATGATTGGTT
GCTCTCTTTACCGCTGTTTCACGTCTCCGGTCAGGGAATTATGTGGCGCTGGTTATACGC
TGGTGCGCGGATGACGGTACGTGATAAACAGCCATTGGAGCAAATGCTGGCAGGCTGTAC
TCACGCTTCACTGGTGCCAACACAACTCTGGCGTTTGCTGGTTAACCGTAGTTCCGTTTC
CCTGAAAGCGGTGTTACTTGGCGGCGCGGCTATCCCGGTCGAGTTGACGGAACAGGCGCG
CGAGCAGGGGATTCGTTGCTTTTGCGGCTATGGTCTGACCGAGTTTGCCTCCACGGTGTG
TGCGAAAGAAGCCGACGGCCTGGCAGACGTTGGTTCGCCGCTGCCGGGTCGGGAAGTGAA
AATCGTTAATAATGAAGTGTGGCTGCGGGCTGCCAGTATGGCAGAAGGTTACTGGCGTAA
CGGGCAACTGGTTTCACTGGTTAATGACGAAGGCTGGTACGCTACGCGCGATCGCGGTGA
GATGCATAATGGCAAGCTGACCATTGTCGGACGTTTAGACAATCTATTCTTCAGTGGCGG
AGAGGGTATTCAGCCGGAAGAAGTCGAGCGCGTAATTGCTGCACATCCTGCGGTTTTGCA
GGTGTTTATCGTCCCCGTTGCCGACAAGGAGTTTGGTCATCGACCGGTGGCGGTGATGGA
GTATGACCACGAGAGCGTTGATCTTAGTGAATGGGTGAAAGATAAGCTGGCCCGTTTTCA
ACAACCGGTGCGCTGGCTAACTCTGCCGCCGGAGCTGAAAAACGGCGGTATTAAAATTTC
ACGTCAGGCGCTAAAAGAGTGGGTGCAACGTCAGCAATAATTAACCCTCCGTTTCACTTC
TCATTTCTGCCATTCCATTGCCGTTGATAAAGAGTTTATCTGTTAATCTGTAAATTGATG
TGAAAACTCTTAGCAAACAGGATAATGCAATGGAATGGCTGGTCAAAAAATCGTGCTGCA
ATAAACAAGATAACAGACATGTACTTATGCTCTGCGATGCTGGCGGCGCGATAAAAATGA
TCGCCGAAGTGAAGAGTGACTTCGCCGTGAAAGTGGGGGATTTACTCTCGCCTTTGCAGA
ATGCGCTTTATTGTATTAATCGTGAAAAGCTGCATACGGTGAAAGTCCTCTCGGCAAGCA
GTTATAGCCCCGATGAGTGGGAACGGCAGTGTAAAGTGGCAGGGAAAACTCAGTAACGTT
GTTTTGTCGTGGGCAGGAAAATCAGCATCAACCCGCTCATAATACAGGCTACTCCCAGTA
GTGCTTTCAGCGAAAAAGTCCCTTCCCAGCCGGGAAGTACCATTGAAGCAATCCATACCA
GCACATAACTCATACTGAGCAAGGCATAGGCTTTGCTTAGCGCAAGTTTATGAAGCGTTT
TATACCAACAAAAAACGGAAAGCAGATAACCCAGCAGCCCGAGTAACAGTATCCGGGCAT
CCAGGCCAAAAGCTAACAGAGCCGCGATAAAATCCCATAAGTGCGTCATCGGCGGCAGAT
GACTCGCCGCAAAACCCAGGCTTAATTGCGCAACTGAGGCAATAATGACGCTGAATAATC
CCCACATCAGGCCCATTACACCGTACTCCCGAGGATCACAATGCCGCCAATAATGAACGC
CACCCCACACCAGTGACGCGGCGATACCGGTTCGTGCCACAGTTTTACTGCAGCCAGCGT
CACCCAGACAAAATTCAGACTTAACATCGGGTAAGCAATGCCTACCGGTACGTTCTGCAA
GACCAGCAGCCAGAGCACCATGGCAAGACCAAGACAAGCCAGCGCCAGTCCCAGCCACAG
CACGATATGTTTGCGCCGTTTGTTTATCGCCACAAAGCAGGTTGCCTGTTTCTGACACAA
CTGCCCGGCAACGCTAAGCAAGCTGGCAAAGACTAATGTTAGCCAGATCATTTGGGACGA
TACTGAATCAGCACCAGACGCTCCTGACGATCGATGGCATCTGCGGGCGGAATGGCGAGA
CTGTTGATATCTTCATCGCGGTCAACCGAAAGCACGAGAGTAATAATCCCCTCCTGACGA
TGTTGATTAAGCCAGTTTGCGAACTCATCACCGCTGACAAATCTCCCTTTCGCATCCGGA
TAATTAAGGCCGTATTTCAACTCACCTGTCTGGCGATACATGATGATGTCATCGCGTTGC
AGGCTCCATGCCAGACCTGCGGCAACACCGACGCTATCAGTAAGAATATAGCGGCTTGGC
TGAAGTGATTCTTGTGTCATCTCGACAAAAAATTGCGGATGTTTTCCTTCCATAACTCTG
TCAGGAATTGAAAATCCTACCAGCAACGCCAGCCCCAGCGGGCAAAGCGCGGCAAAAGGC
CAGGTCTTTTCGACGTTTGTTAAGGTGTACCAGCCGAAAAATGCCCATAGCGAAAAAATC
GACCAGGCACAAAAGACTTTATAGCTCTCGAAGGTTTGCCACACCGGCGTGTTCATTGGT
CCCCACGGGGAGACCACAAATGTGGCAATAATGCCAGTGACGCCAAAAGCGATGTTAATC
CAGCCATTAATCCGCAGCGCCAGAGGATTATTTTTTGCTGCCAGCAAAGCGTAATGCGCC
ATCAGCATTGCCAGAGATGCAAAGCAGGAAAGAATATAGGTGGGCAATTTACCTTTAGCG
ACGGAGAAAAACAGCAGCGGCATTATCGTCCAGCTCAACAAATAGACGGTTGCGGAATGC
TTGCGGTTTTTCCAGCCTGTGTACAGTGCACCGGGGAGTAATCCCAGCCACGGCAGGCTA
CCGGCAATGATGACCGGCACGTAGTACCAGAACGGAGCTCTATGTTGGGCATCATCCAGT
GCAAAGCGTTGAATATGCTCAACCCAGAAAAAATAGTGCCAGAAGTTAGGCTCCCGCTGC
GCTATCGCCAGTCCCCAAGGGAGAACCGTCAGTACGCAACTGATAACCGCCAGCCAGCCG
TAAATAAAGAGATCTTTCCAGCGTTTTTGCGTCGCTACCCATGGCAGCACGCTTAATACC
GGCACGGCAAGGGCGAGAAAACCTTTGGTCATCACCCCCATGCCGCAGGTGATTCCCAGC
AGTAAAAATCCTGCGCTTTTGCCTTTCCACGTCTGTGCCTGCATTGCCAGCCAGAAGCTG
CACATTCCCGCCACCAGCCAGAATGCAATAAACGGATCGAGCACGGCATAAGTGCCGATG
GCATAGACAATAAACAATGAGAGATAAATTACTGTGGCGAGTAGAGCCAGACGTTTATCG
CGCCATAAGCGCAGAGTAAACCAGGTCACCAGCGCGGCAGTTAACAGGGTCGCAAAGATA
ACGCCTGCCCGCACACCAAAGTTATTCGCGCCAAATAGCCATTGCCCAATGCTGTTAATC
CAGTATCCGGCAATGGGTTTTTCGAAATAACGTAGCCCTAACAGATGGGGCACAATCCAG
TCGCCGGATGCCAGCATTTCTCGACTGATTTCCGCATAACGCGTTTCATCGGGTTGCCAG
AGCAGACGCGTGCTGATCGGTAACAGGTAATAGCAGGCAATAAACGCGAAGAGGCCGATA
AGGTAACGTACCGATTTCATCAGCGACTACCCGCAATTTGTTGGCAACCCAGCCAGCCTT
CACGTCCGGCAATATTTCCGCGAACAACTTGTCCGAGCGGCAACGTCTCTGATAACAGTT
CGCTTAAAGGGCAAAATGTCACGCCTTCCTGAGCTGCGCGTTTGAGGAGATCCACAAAAT
TATGCTGATAAGCGCAGCCTTCAACTTCTGCATGAATGGTATAAACCGGCGTGCCTTTAT
CTCGCAGGATGCGGTTGAGTAACCAACCGTTAAAATCTTCTGCTTTCACATCCCGACCAA
TCACTTCATCCCAGGTGGGTAAGGTCACCGGAATTTGCGCAGTGCCAGGGTTTCCTGATT
CGAGCAATGGACGGAACGGCATGGCCCCACGACAATCGCTGTTGTAGCGCAAATGGAACG
CTTCTTTTGCTTCGATCACCTTCTGGTCGGCACGCCAGCCCGCAGCGGCAGAACAGGTTA
CCGGTTGACCGATAATCTCTTCCAGAGTGCGAAGACCGCGTGCAATATCGTCGATCATTG
TTTGCCGATCCCAGTTACCGCTACGGGCTTGCCAGGCATGGTGATCCCAGGCGTGCAGGC
CGACTTCGTGATGTTTAGCCGCTTCACGAATGATATCGGCATTGGCATGACCAATCTCTT
TACCTGGCCAGGCCGTACCTGCCAGTAAAATATCCCAGCCATAAAGCGATGCCGCGTTTG
AGCGCAGCATCTTCCACAAAAACTGTGGCTTCACCAGTCGCCAGAGATGGCGGCCCATAT
TGTCCGGGCCGACGCTGAAAAAAATGCTGGCCTGAATATTATGCTTACTCAAGATTTCCA
GCAGACGCGGCACGCCTTCACGGGTGCCACGAAAGGTATCGACATCAATGCGTAAGCCTA
CTTTGGTCATGATGGTTTATCCGTAAGATCAACGGTGCGCAGGAAGAAATCCAGCGTTTC
GTCGATGGTTTCCTGCATATCAATTTTCGGCTCCCAGTCCAGGCAGCGGTGGGCATTGCG
GATGCTCGGTTTACGATGCTCTACGTCCTGATATCCTTTGCCGTAGTAGCTGCTACTTTC
GACAACGCGAAAGCCCGCAAACGGTGGGAAATGATGGCGCAGCGGATGTTTTTCGAAGCT
CGCCAGCAGCATCTCGCCCAGTTCCTCAATGCTCGCTTCGTTCTCAGGATTGCCAATGTT
GATAATTTCACCGTCGCAGCGATTTCCCGCATTTTCGATAATGCGGTATAACGCCTCGAT
ACCATCGCGAATATCAGTAAAGCAGCGTTTTTGTTTTCCGCCATCAATCAGCTTAATCGG
TGAACCTTCTACCAGATTGAGAATGAGTTGCGTAATAGCGCGGGAGCTGCCAATTCGCGC
TGCATTAAGGTTATCCAGTCGTGGTCCCATCCAGTTAAACGGGCGGAAGAGGGTGAACTG
TAAACCCTCTTTTTCGCCATAGGCCCAGATCACCCGATCAAGTAATTGTTTTGATACCGA
ATAAATCCAGCGTGGTTTATTCACCGGGCCGACGATTAAATTAGAATGGTCCTCATCGAA
GTATTTATCGCTACACATCCCATAAACTTCTGAAGTTGACGGGAAGATGATTCGCTTACG
GTACTTCACGCAGTAGCGGATAATGCGCAGATTCTCTTCAAAATCGAGTTCAAATACGCG
CAGCGGGTTGCGGGTATATTCAATCGGCGTGGCTATCGCCACCAGCGGCAAGACGACATC
ACATTTTTTGACATGATACTCAATCCATTCGGAATGAATACTGATATCGCCTTCAACAAA
GTGAAAATGCGGATGATTCAGAAAACGGCTTATCGCATCGCTGCCAATATCCAGACCGTA
AACTTCATAATGATCTTCGCGCAGCAGGCGTTCTGTCAGATGGTTGCCAATAAAGCCATT
CACCCCGAGGATGAGTACCCGGGTACGGCGTCGGGCGGTGCAGGCAGGCTGGCTATTCAA
GCGTGAACCTTGCACCAGGCCCAGCGTCTGCGCTAATTGCGAGCCCTGCATAGTAATGCC
GTCGCCCGCCTGTCCGGTGACGATTTCCAGCGCGCCATCGCCACAGGCAATCAGCAGTGG
CGCAACAGAAATCACGCTCCCCGGCTGTGCTTTGCTGGCATGAGGATGAACACGCGACGA
CCAGACGGTGAATTTCTGATTGCCAACATAGCTGAAGGCACCCGGCCACGGATCGGCAAC
GGCACGTACCATGTTGTGCAGTACGGATGCCGGTTTATGCCATTCAAGGAAACTGTCATC
CGGCGTTCTGCGACCAAAACAGGTGGCTTCGTTTTCGCGCTGGGCGATTTCCAGAATATT
ACCGTGTTTAATGGCGGGTAATGTCTGTTCCAGTAGCTGGCGCGCGGCATGGCACAATTT
ATGATGCAGCGTAATAGCGATATCGTCTGGCGCAATGGCAATGCGCAGTTGCGCCACAAT
GGCCCCGGCATCGGCACGTTTCACCATTCGGTGCAATGTAACGCCAGTTTCCGTTTCACC
GTTGACCAGCACCCAGTTCAGCGGCGCGCGACCACGATATTTTGGTAACAGCGAACCATG
CAGATTAAATGCACCTGCGGGAGCGAGCTGCAAAATTTCGTCGTAAATAAGATGGCGATA
ATAAAAAGAGAAAATCACATCTGGCGACAGTTGGGCAATGCGTTCCACCCACAGCGGATG
ATTAACGTTATCCGGCGCATAAACCGGAATGCCTCTTTCCGCCGCCAGACGAGCCACCGA
ACCATAAAAGGCTTTTTCACCGGGATTATCAGTATGGGTAAAAATGGCGCTAATTTCGTA
ACCGGCAGCCAGCAGGGCTTCAATACCGAGGCATCCCATATCGTGGTAGGCAAAAACGAC
GGTTTTCATTATTCATTTTCCTTGCTGGATGGACGGATAACTTGCTGAACAAAATAGCGG
GGGCGGGCGCGGACATCGGTGTAGATCCTGCCGATATATTCACCGAGTAATCCCATGCCG
ATAAACTGAGCGCCAATAAAAGTAAACAGCACGGCAAATAGCATAAAGACGCCTTCTGCC
GCCCATTGTGGTCCGAAGGTCAGGCGTAAAATCACCAGCAGCACCGCAATGCTAAAACCT
CCAATCGCAATAATGCTGCCGAGCAGACTCAGCATACGTAGCGGCGTTGTGGTAAGGCAG
GTCACCAGGTCGTACATCAAATTAATCAGGCGCATAAAACTGTATTTGGATTCACCAAAC
TCACGCTCGGCATGATGTACTGGAATTTCAATGGCACGGCGGGCGAAGATATTCGCCAGA
ATCGGGATAAAGGTGCTGCGTTCATGGCAGTGCAACATCGCATCGACAATATGACGGCGA
TAGGCGCGCAGCATACAACCGTAATCACCCATCGCTTTGCCAGTGGTGCGCTGAATAAGC
CGGTTAATCATCTTCGAAGCGGTTTTACGAAACCAGCTGTCCTGGCGGTTCTGGCGTACA
GTCCCTACCACGTCGTAACCTTCATCGGCTTTTGCCACCAGGCGGGGGATTTCTTCTGGC
GGATTCTGGAGATCGGCATCAAGGGTAATAATTAAGTCGCCAGTAACGTGACTGAATCCC
GCCATAATCGCTGAATGTTGCCCGTAATTGCGGTTAAGCAAAATAGACACAATATGGCTG
TTCTCCGCTTGTGAGGCTTCGACCAGCATATGCGCGGAATTATCGCTACTGCCGTCATCA
ATCAGCAGGATCTCATACTCTTTCCCCAACGATTCACAGGCTGTGGTGGTGCGCCTGATT
AATTCCGGTAAGCTTTCCTGCTCGTTATAAACGGGAATAACCACCGAGACTTTCTTAACA
GGGTGGATTTCAAACATGGCTTATTGTCCTGCGAGTTGCTGAAGGGCTGTGATGACATGG
TCGGCATCGGCGGTAGTCATATCCGGGAACAGCGGCAAAGAACAGATGCGTTCGCTATTC
CATTCGGTATTCGGTAACGACAGCGTGGGAAAACGCTCGCGATAATATTTTTGTGTGTGA
GCGGCGCGGAAATGTAACCCGGTACCAATGCCTCTTTCTTTTAACGCTTCCATCAACGCA
TCGCGACTGATACCACAACGTTGTTCATCGACACGAATAATAAACAGATGCCAGGCGTGA
ACGTGCGGCCAGGCGGGAAGGCTTAATGGCTGAAAGGGGAGAGCTGCCAGTGCTTGCTGA
TATTGCTGGGCAATTTCGCGCCGACGGGTGTTGAGGTGCTCTAATTTGACTAACTGTGTC
AGGGCAATCGCGGCGTTAATATCGGTCAGATTGTACTTATAGCCCGGTGTTAAGACTTCA
GCCTGCGGTGCACGGCCCCAGGTTTGTCTGTCATAGGCATCGACACCCAGACCGTGAAAT
TTCAGCATCCGTAGCTGGCGGGCAAGGTTTTCATTATCAGTTACAATCAGGCCACCTTCA
GCACAGGTAATATTTTTAATGGCATGAAATGAAAAAATAGCGGTACCTTTTGCGCCAATA
TGTCGCCCTTTGTAATACGTACCGACGGCATGGGCAGCATCTTCGATAACTGCGATGCCG
TAACGTTCGCCAATGGCGCGAATGGCGTCAATATCTGCTGGCGCACCGGCATAATGCACC
GGAATGATGGCTTTAGTGCGTGGCGTAATGGCTGACTCGATAGCTTCAGGCGTGACCATC
AGCGTATCGCGGTCGACATCCACCATTACCGGCGTTGCACCCAACAAGGAAATCATATTG
AGGGTTGAAACCCAGGTCAGGGAAGGCGTAATCACTTCATCGCCCTTGCCAATTTTCAAC
GCCATTAGCGTGATATGCATTCCGGCGGTGGCTGAACTGACCGCGATGGCATGCTGATTT
CCCGTCAACTGGCAAAAAGCTTGCTCAAGCGCCTGATTCTTCGGACCGGTTGTGATCCAA
CCGGATTCGAGAACCTCTTTAACTGCAGCGAGTTCCTCCACGCCCATTGCTGGTCGCGAA
AAAGGCAAAAATTCTGACATTGCTTTTCCTTCCGCCATTGAATACCTGTCCACTTATATT
TGCTATAAAGAGTGTTGTGTATATTTTGCCATTTGGAGCGAAATTTTAAGGATAGAATAT
TAACTTAACCTTAAGAAACTAATATTAGACGTAAATATTGAAATTTTTATATTTTTTCTT
ATTTAGGCTTTGCATTTGGCAAAATTTTGAGGCATTTTGCCGACATCGTAGGATTTTTAA
TATTACACCAACTGCGAATTATCGCCAGAAATGTAGCTCAATTTCACGGTAATTGTCTGG
TTGCGCTTGTCTATAGGTGGAGTTTACGTGTTAGCTTTTTGCCGCTCTTCGTTGAAGTCA
AAAAAATATATCATCATTTTACTGGCGCTCGCTGCAATTGCCGGACTGGGTACTCATGCC
GCCTGGAGTAGCAATGGTTTGCCACGTATCGACAATAAAACACTGGCCAGACTGGCACAG
CAGCACCCGGTTGTCGTTTTGTTTCGTCATGCTGAACGTTGCGACCGTTCAACCAATCAA
TGCTTGTCAGATAAAACAGGTATTACGGTTAAAGGTACCCAGGATGCCCGTGAACTGGGC
AACGCTTTTAGTGCTGATATCCCTGATTTCGATCTTTATTCCAGTAATACCGTCCGGACC
ATTCAGTCGGCTACCTGGTTTTCAGCGGGTAAAAAATTGACGGTAGATAAACGACTTCTT
CAGTGCGGTAATGAGATTTATAGTGCAATTAAGGACTTACAAAGCAAAGCGCCTGATAAA
AATATCGTTATTTTCACCCATAATCATTGCCTGACATATATTGCTAAAGATAAGCGTGAC
GCGACATTTAAACCTGATTATCTGGATGGTTTAGTCATGCATGTGGAAAAAGGCAAAGTT
TATCTGGATGGGGAATTCGTTAACCACTAAATTTTCAATCTGACAGCCAGTAATGGCTGT
CATCATTGTTACAGAAGACCTTTCAAACGTAACGTTTTTCGGGTGGCGACATTCAAATCA
TAATGCACCAGATCTTCAGGTTTTACCCACGCGTAGTCCTGAAACTCTTCGTTTATTTTC
ACTTCTCGGTTGGCAGAAACGCAGTCAAAAATCAGGTAAATCATATAAATCTCTTCCTTG
CGACCATCTGCATACGTCTTGGTGCGAATATCATCGCTGAAGGTCCACGGCGTGATTTCT
GTCAAAAGCAGCTGTTCTCCCAGTTCTTCGCGAATTTCGCGGCGTAGTGCCTCTTCAATT
CGTTCGCCAGGCTCCACGCCGCCACCCGAAATCGCCCATTGACCGGGGAAAACGCCGCGA
TCGTCGGCCATTTTACACAGCAAATAAGCACCATCATTTTGAATCAAAGGGCATACAATA
GTCCGTTGTCGCACAGGGATATTCCTTATAAATAAAAAGAAACCATGAGAATACGGTAAC
TCACAAATATGTGAAAGTGACAGTAATCTCTTTTGCGATGATAACTGTACTTATTATTAT
TTTTGTGTGTATCGATAAAGTGTGTTTATTTTTTCGGCATTTAATTATTTAAGAAGTATT
TAGTTACAATAAGTGACTAGATCCTTTTTTTCGCTCATTGAATCCTCTGTGCCAGGCAGT
ACAATCCCGCAGCTTTGGGAATTTTGATTAATTGCTTGTGGGAAAGGGGATAATGAAAAA
AATTGCGCTAGCAGGTCTGGCCGGAATGCTGTTGGTTTCTGCATCGGTCAATGCAATGAG
CATCAGCGGTCAGGCGGGTAAAGAATACACCAATATTGGTGTCGGTTTTGGGACTGAAAC
GACGGGCCTGGCGTTAAGCGGTAACTGGACACATAACGACGACGACGGTGATGTCGCTGG
CGTGGGGCTGGGGTTGAATCTGCCTCTCGGGCCGTTAATGGCGACCGTTGGCGGAAAAGG
CGTTTACACCAACCCGAATTACGGCGATGAAGGTTATGCCGCAGCGGTAGGAGGTGGTTT
GCAGTGGAAAATTGGCAACAGCTTCCGTTTGTTTGGCGAGTATTACTACTCTCCGGATTC
GCTCTCCAGCGGTATTCAAAGTTATGAAGAAGCGAATGCTGGCGCGCGTTACACCATTAT
GCGTCCAGTCAGTATTGAGGCGGGTTATCGCTACCTGAATCTGTCGGGTAAAGACGGTAA
CCGCGACAACGCCGTGGCTGACGGCCCGTATGTTGGGGTTAACGCCAGTTTCTGATCCCT
TCCGGCGCGGCATTCTGTCGCGCCATTCAGTTTCTTACTACGCCTTATCTCCCTTTGCGT
TATAGTGATTCGATAACAAAAGCAGGAGATAACCATGTTAAAAGTGGAAATGTTATCCAC
CGGGGATGAAGTGTTACACGGGCAAATCGTTGACACTAACGCTGCCTGGCTGGCCGATTT
TTTCTTTCATCAGGGGTTGCCATTATCTCGCCGCAATACGGTGGGGGATAACCTTGATGA
CTTAGTCACCATTCTTCGCGAACGTAGTCAGCACGCCGATGTGCTGATCGTTAACGGCGG
GCTGGGACCGACCAGCGATGATTTAAGCGCACTCGCCGCTGCGACAGCAAAAGGTGAAGG
CCTGGTGCTGCATGAAGCCTGGCTCAAAGAGATGGAACGCTATTTCCACGAACGTGGACG
AGTAATGGCACCGAGCAACCGTAAACAAGCGGAGCTGCCTGCCAGTGCTGAATTTATCAA
TAACCCGGTAGGCACCGCCTGTGGTTTTGCCGTGCAGCTTAATCGTTGCCTGATGTTCTT
TACTCCCGGCGTACCGTCAGAATTTAAGGTGATGGTCGAGCACGAAATCCTGCCGCGCCT
GCGCGAGCGTTTTTCTTTACCGCAGCCGCCGGTTTGTCTGCGTTTGACTACTTTTGGTCG
TTCGGAAAGCGATCTGGCACAAAGCCTGGACACTCTACAACTGCCGCCGGGCGTAACAAT
GGGCTATCGCTCCTCAATGCCTATCATCGAACTGAAACTCACCGGACCGGCAAGCGAGCA
ACAGGCGATGGAAAAACTGTGGCTGGATGTTAAACGTGTTGCCGGACAGAGCGTGATTTT
CGAAGGCACTGAAGGACTGCCCGCGCAGATCAGTCGCGAATTGCAAAACCGCCAGTTCAG
CCTGACGTTGAGCGAGCAATTCACCGGTGGTTTATTGGCTTTGCAACTTTCTCGCGCAGG
TGCTCCATTGCTGGCGTGTGAAGTGGTTCCTTCACAGGAGGAAACCCTGGCGCAAACTGC
GCACTGGATTACAGAACGGCGGGCCAACCATTTTGCCGGGCTGGCACTGGCTGTTTCGGG
TTTCGAGAACGAGCATCTCAACTTTGCGCTAGCCACGCCAGACGGCACTTTCGCTCTGCG
TGTGCGTTTCAGCACTACGCGCTACAGCCTGGCTATCCGTCAGGAAGTGTGCGCAATGAT
GGCACTGAATATGCTGCGCCGTTGGTTAAACGGCCAGGATATCGCCAGTGAGCATGGCTG
GATTGAGGTTGTTGAGTCCATGACCTTATCTGTCTGATTCCGCCACTCTGTGCCGGTTTA
CTGCACCGGCACATTCCCCCTCCGGCAAAATTTGTCCAACCTGTTGTACTCAATAAGAAA
AAATCCGTGCGCTGATTCACAAATTTGTGCGTAATTTCTCCAGTCTGCTGGACGAGGAGC
GGGATTTGATGCGCTTCACAATTTTACTCCCCCTGAGCAACGAGACTGATTCCAGTATCT
AAGACTGGAGTCCAGTATGTTGGAATCAAGCAAAGTTCCCGCCCTGACACGGGCTATTGA
TATTCTCAATTTGATTGCCCGCATTGGCCCCTGTAGTGCTGCGACGATCATTGACACATT
GGGAATCCCTAAAAGCACGGCCTATTTGCTGCTTAATGAACTCAGGCGTCAGCGTTTTCT
TAGCCTTGATCACCAGGAAAATTTTTGTTTGTGGACCAGGCTGGTGGAGCTTTCCGGTCA
TGCGTTAAGCAAGATGGATCTCCGGGAACTGGCTCGACCGCGTTTGACGCAACTGATGGA
TACCACCGGGCTGTTATGTCACCTGGGGATTATTGATAACGGCAGCGCTTATTACATTTT
GAAAGTGGAGTCATCAGCCACTATCAGCGTGCGTTCCCATGAAGGAAAAAGCCTTTCGCT
TTATCGCTCCGGAATAGGTAAATGCCTGCTTGCCTGGCAACCTGCAGCGGTACAGCAAAG
TATTATCGAAGGGCTGGTCTGGGAGCAGGCGACACCCACAACGATTACTCATCCACAGCA
ACTTCACGAAGAACTGGCGCGTATTCGCCGTCAGGGCTGGAGCTATGACAACGGCGAAGA
TTACGCCGATGTCCGTTGTGTCGCTGCGCCGGTGTTTAACGCCAATAACGAGCTTACCGC
TGCGATCTCGGTGGTCGGTACCCGCTTACAAATCAATGAAGAATACCGTGATTATCTGGC
GGGCAAGGCCATTGCCTGCGCCAGGGATATTTCACGTCTGTTGGGATGGAAAAGTCCCTT
TGACTTACAAGCCTCATAACAATGGAGAACATCATGACCCTACCAAAAATTAAACAGGTT
CGCGCCTGGTTTACTGGCGGTGCGACAGCAGAAAAAGGCGCTGGCGGCGGTGATTATCAC
GACCAGGGGGCGAATCACTGGATAGACGATCATATTGCCACCCCGATGAGTAAATACCGC
GATTACGAGCAGTCACGCCAGTCATTTGGCATTAACGTTCTTGGCACGTTGGTTGTTGAA
GTCGAAGCAGAAAACGGCCAGACCGGATTCGCCGTTTCGACAGCCGGTGAAATGGGCTGT
TTTATTGTCGAAAAACATCTTAACCGTTTCATTGAGGGTAAATGTGTCAGTGATATCAAA
CTGATCCACGATCAAATGCTCAGTGCCACCCTGTATTACTCCGGCTCTGGTGGCCTGGTG
ATGAATACGATTTCTTGTGTCGATCTGGCTCTGTGGGATCTGTTCGGCAAAGTGGTCGGG
CTTCCGGTTTATAAACTTTTAGGCGGCGCTGTTCGTGATGAGATTCAGTTCTACGCCACA
GGTGCGCGTCCGGATCTGGCAAAAGAGATGGGCTTTATCGGTGGCAAAATGCCGACGCAC
TGGGGGCCACATGATGGCGATGCGGGGATCCGCAAAGATGCCGCTATGGTCGCGGATATG
CGTGAAAAATGCGGTGAGGATTTCTGGTTAATGCTCGACTGCTGGATGAGTCAGGACGTG
AACTATGCGACCAAACTGGCCCACGCTTGCGCGCCCTATAACCTGAAATGGATCGAAGAG
TGCCTGCCGCCACAGCAGTATGAAAGTTATCGCGAACTGAAACGCAACGCGCCAGTCGGA
ATGATGGTCACCAGCGGTGAGCACCACGGCACACTGCAATCTTTTCGTACGCTTTCAGAA
ACCGGTATCGACATTATGCAGCCGGATGTTGGCTGGTGCGGTGGTTTAACCACGCTGGTG
GAAATTGCCGCAATCGCCAAATCCAGGGGGCAACTGGTGGTGCCGCACGGTTCGTCTGTT
TACTCTCACCATGCGGTGATCACCTTCACCAATACGCCATTCAGCGAATTCCTGATGACC
AGCCCGGATTGTTCAACGATGCGTCCGCAGTTTGACCCGATTCTGCTCAATGAGCCGGTT
CCGGTGAATGGTCGTATTCATAAATCAGTGCTTGATAAACCCGGTTTTGGCGTCGAACTC
AATCGTGACTGCAATTTGAAACGCCCCTACAGCCACTAATCACTCCGGGCGTTGCTGTGA
CAACGGTAACGCCCACATATTCTAAGGAGCTTTTTATGAGCACCGCTTTGCTTGACGCCG
TGGTGAAGAAAAACCGTGTGCGTTTAATTCCGTTTATGTTGGCGCTGTATGTGCTGGCGT
TTCTCGACCGTTCGAATATCGGTTTTGCCAAACAGACCTACCAGATTGATACCGGGTTGA
GTAATGAAGCTTATGCGCTGGGAGCAGGCATTTTCTTTGTGGTATATGCGTTTCTGGGTG
TTCCGGCGAATCTTTTGATGCGCAAACTGGGGGCCAGAACCTGGATTGGTACGACAACAC
TGCTGTGGGGATTTCTTTCGGCAGCCATGGCATGGGCCGATACTGAAGCGAAATTTCTGA
TAGTTCGCACTCTGCTTCGTGCTGCGGAGGCCGGATTTTTCCCTGGTATGATTTATCTCA
CCTCGCAATGGTTTCCGCAGCGTAATCGCGCCAGCATTATGGGGCTGTTCTATATGGGCG
CACCGCTGGCGTTAACACTGGGATCACCGCTTTCCGGCGCGCTGTTGGAGATGCATGGAT
TTATGGGGCATCCCGGCTGGTTCTGGATGTTTGTGATTGAAGGATTGTTGGCAGTCGGTG
CTGGGGTATTCACATTCTTTTGGCTTGATGACACACCGGAGCAGGCACGTTTTCTGAGTA
AACAAGAAAAAACGTTGCTTATCAATCAACTGGCAAGTGAAGAACAACAGAAAGTGACTT
CTCGGCTGAGCGATGCGCTGCGTAATGGCCGAGTCTGGCAACTAGCGATTATCTACCTGA
CCATTCAGGTGGCGGTTTACGGATTAATTTTCTTCCTGCCGACCCAGGTTGCGGCATTGC
TGGGAACAAAAGTGGGCTTTACAGCGTCGGTGGTCACCGCCATTCCGTGGGTTGCGGCCT
TGTTTGGGACCTGGCTTATTCCGCGCTATTCCGATAAAACCGGCGAACGGCGTAATGTCG
CAGCGCTGACATTACTGGCGGCGGGCATTGGTATTGGTCTGTCCGGGCTGCTTTCTCCAG
TAATGGCGATCGTAGCGCTGTGTGTTGCAGCTATCGGGTTTATTGCCGTGCAGCCAGTGT
TCTGGACGATGCCGACACAACTGCTTTCCGGTACGGCGCTGGCTGCGGGAATTGGTTTTG
TAAACCTGTTTGGTGCAGTGGGCGGGTTTATTGCCCCGATCCTGCGCGTGAAAGCAGAAA
CGTTATTTGCCAGCGATGCGGCGGGATTACTGACGCTGGCAGCGGTGGCGGTCATCGGTT
CGCTGATTATTTTCACTCTGCGTGTAAATCGCACTGTTGCGCAGACCGACGTGGCACATC
ATTAAATAGGTTAAGGAACACGATGAACGCATTATTAAGCAATCCCTTTAAAGAACGTTT
ACGCAAGGGCGAAGTGCAAATTGGTCTGTGGTTAAGCTCAACGACTGCCTATATGGCAGA
AATTGCCGCCACTTCTGGTTATGACTGGTTGCTGATTGACGGGGAGCACGCGCCAAACAC
CATTCAGGATCTTTATCATCAGCTACAGGCGGTAGCGCCCTATGCCAGCCAACCCGTGAT
CCGTCCGGTGGAAGGCAGTAAACCGCTGATTAAACAAGTCCTGGATATTGGCGCGCAAAC
TCTACTGATCCCGATGGTCGATACTGCCGAACAGGCACGTCAGGTGGTGTCTGCCACGCG
CTATCCTCCCTACGGTGAGCGTGGTGTCGGGGCCAGTGTGGCACGGGCTGCGCGCTGGGG
ACGCATTGAGAATTACATGGCGCAAGTTAACGATTCGCTTTGTCTGTTGGTGCAGGTGGA
AAGTAAAACGGCACTGGATAACCTGGACGAAATCCTCGACGTCGAAGGGATTGATGGCGT
GTTTATTGGACCTGCGGATCTTTCTGCGTCGTTGGGCTACCCGGATAACGCCGGGCACCC
GGAAGTGCAGCGAATTATTGAAACCAGTATTCGGCGGATCCGTGCTGCGGGTAAAGCGGC
TGGTTTTCTGGCTGTGGCTCCTGATATGGCGCAGCAATGCCTGGCGTGGGGAGCGAACTT
TGTCGCTGTTGGCGTTGACACGATGCTCTACAGCGATGCCCTGGATCAACGACTGGCGAT
GTTTAAATCAGGCAAAAATGGGCCACGCATAAAAGGTAGTTATTGATATCAAAGGCCCAT
GGGGATCGGCTGTGGGCCTGTGTTAATTAGTGGTTATTCGCTGCCAGATCGGCTTCGCTT
AGCTGGGTGGCCGCGAGCACCTGGTCACGATCAAAGCCCTGTTCCAGCATGCGCAAAGCA
ATTTTAATGGCTTGTTCATGCAAACCTTCTAATTTACCTTCCTGCCAGCCAATTTGATGT
CCTTCCTGCCGCAGCCGTTCAGCAATAGTCATTAATCTCTCCTTTTAATGACAGTTCGGA
ATATCAGCATCAGTGAGTTGGGTTGTCGCCAGCACAATCTCACGTTCAAAGCCCTGCTCC
AGCATGCGCAAAGCAATTTTAATGGCTTGTTCATGCATACCTTCCTGCCAGCCAATTTGA
TGCCCTTCCTGCCGTAGCCGTTCAGCAATAGTCATTAATCTCTCCTTTTGTAGTGGTGAA
CGTTCGGCAATCTCCTCAATAAAACGGGTGAAACGGGAGGTATCGCCGCATTGCAGCAGA
TAATTAAACAGTGTTTGTAGCTGGCTGTCATTAGTGAAGCCTCTAACCAAAAGCGTGGTG
ATCCTGTCGACCATGCCGATTAAATCGCGGTCGCGAATATGCTTTTGAATCAGTTCCAGC
AGAGCTATACGCCGATGTTGCATGATCTCATCGTCAGGTACGATGGTGATATCCACCAAC
AGAAAAGCTTCGGTGTACAACTGCCGGGCAAGTTGCGGATCGTCAAACTCATCCAGCCAG
TTGAGTGAGTACGGGTAAGGCGAGGTTTCGCCATGATAAAACAGCAACGGCACCACCAGC
GGGACTCTGTCATAGCCTTTGTCCTGGTGACGCTGCATGGCGGCAGTGGCATAGCGCATT
AGCCGAAAAGCCATATTCTTTTCTGCAGAGCTTTGATGTTCAATCACGCAGTAGATATAG
CCGTCACCGTCGCTGGTTTCCACGGACCACAAAACATCCGAGTAGTAAGCGCGTAAACTT
TTTTCAATAAAACTAGTGGGTTCCAGGCGTAAGGTTTGCAGGTTGCAAAGCTTGCGCAGT
GGTTCTGGTAAATGTATTTCGAGAAAATCCCGTGCGGTTTCGGGTGTGAACATAAAGGTT
TTAAATACCGCATCATGCGGGGAGGAGGTTGTTGATTCGGTCATGGTTGTCCGTCACCTG
ATATTTATGATGACGCGACATTACGGTTATCCCAGGCCTTTGACATCTGCCAGTTTCAGC
CTTTGCGAGACGTTTTCAGAGGAATTTTCACTGCGTTGCAACGCATACATTGGGCACGGA
ATCGTGTACGCAAAAATGCCCGGTAACCACATGCTTACCGGGCATCAGAAAGGAGTTTAA
GCCAGCGCCTGGGCCAGTAGCGTAATCGGATGTTCGCAGCGAAGACTTGTGGACATCTCA
ATCTGCCATTTACAGGTTTCGCAGTCGGTGACCACCAGATCTGCGCCGCTTTCTTCTATC
TGGCGGAACAGTGGTGCGCCGATGGCTTGTGAGGTGGGGTAGTTCTCTTTTTTGAAACCG
TAAGTACCCGCAATACCGCAGCACTGGGAATCCAGCACCGTTAACTCAAGCCCCGGGATG
TTACGCAACAGCTCCAGGGTGTAGAGCGTCCAGCCCATTTTTTCCATATGGCACGGAGTG
TGATAAACCACTTTCAGCGGCAGCGGTTTCAGCGGTAACGTTTTGCCTTCGTCCAGCTTG
CGCCACAGCCAGCGGGTTGCCAGTTCGATATGATCGCGCAAGCCTTTGTTGTCGACATTC
AGCACTTCCGGGTATTCGTCGCGCAGGGCAAATGTACAGGTTGAGGAGGTGGCAATCACC
GGAATGCCTTTTACTCCCACAGCTTCGCGGATCGACTCTACATTCGTAATTGCCTGTTTG
CGTGCTTTATCGGTAAAGCCGTTGGCGATTAGCGGTACGCCGCAGCATTTTTCTTTGCTG
AGCAGTTGTACACCGGTACCCATTGCGTTGAGCACTTTAATTAAATCTTTACCTAACTGC
GGATGGTTGTAGTTAACGAAGCAGCCGTGAAAGAAAGCGACCTGGTCTTTATATTGTGCT
TGCTGAGCCGCCACGCTGCGATACCAGCGACGGAACGTGCCGAAGGAGTATTTCGGTAGC
GTGCGGCGATGATCGATTTTTAACGCCGCATCAAGCAGCTGCCGCACCGGTTTCAGCGAG
GTAGCGGTGTTGACGATTGGTGCGAACGGCGTGGAAACGCTACCCATCAGGTCGGTATGA
CTCAACACAAAATTACGCAGCGACGGGCGCGTGGTGTCATATTTCGCCCGCGCGCGCTGG
ATAATATCGCCAATCTTCACATCGGACGGGCAGGCGACTTCACAACGTTTGCAGTTGATG
CAATATTTCAGCGCCTCGTCATACAGTGCGCCATCTTTCAAACGCAGACGCTCGCCATCC
GGCCCGGCTTGTTTTGGCCCTGGATAACCGGGATTCACCCGGCTCACCGGGCAGGCGGTG
GTGCAGACGGTGCACTTAATGCAGTTTTCGAAGCTGGTGTCATTCATTGTTGGCCTCCTG
CGCGTTGGGCAATCTGTTGAGCGGCATGTAAAGCACTGACGGCACAAACACCGCCGCCGC
ATCCCTGGGCGATGGGATCAAATCCGCCCAGCACCGAACCGATGGCAAACAGGTTTTCAA
TGGTTTGCCCTGCCTGTGACGGGCGTAGCGTCTCATCAGTGGTTACACCGAACTGCTGCC
ACGGTTGCGGCGCAAAAAAATCTCCCTTATACCATTCACCCCGCGTGGCGGTTTGTAGCA
CATCAAGGCCGAGAATCGGCTCTCGAATGCCGTTACGTTCCGCTACCAGTCCGCCACTAA
AGAAACTGCCGCTGGCGAGAACCGCGAAACGTGGACGTAGCGGAATATCGGCGTGATTGC
GGGTCCAGATTTCGTTCACTACGCCATTTTTACAGGTCACTTTTTTCACTTCATCGCCCG
GCATCCACACGCCACCCTGGCGCACAAACTGGCGCTGTAACTGGTTTTGCAGACGAATGC
CCAGCACGGAAGGCGGCAGCGTTGGCAAAAGCATCAGTGAACAAGGTAGTTTTTCATTCA
ACCAACGCCACAGTTTGTCATCGGCCAGACCGAAGCAGGCGGGCATCAGGATCATTTCGC
AGGTATTGGCGACAGGAATAAGCGCATCAAGTAACAGCGGCCAGTTTTCTTCATTATCAA
GGAAACGGGCGATATTCACCGCGCGAAATTCGGTGGCGTTATTGCGCAGCACATCCAGTT
CCGGCAGCTCTATTTCTGCGGTTTCAACGGCAAGGCCGAGTTCACGCAACGAAGCTGCCG
CAAGGTGCGCCTGAAAATCCATCAGGCCGCTAATTCCCACTACACATATTTTCTTCGCGG
GCAGCGGCCAGACGGGGACTTCTGGCGAACTTAGCCAGGTAGAGCGCAGAGTGCCGAGCG
GCGTAACCCGCTGGTGAGCAAGTTCTACGCTGCCCTGCAATTGCGCACCGCTTTCAGCGA
TTAATGCCTGCGCCTGGCAAGCGAGATCGAGCACGCGTTGTGGCTCGAGAAGGGAGTAAG
GATGGGCTGGTGCCTGCTGACGCAAAGATTCCAGTCCACTGTGAATGTCTGTCACCGGTT
GACCATCTGGCAGATGGCTCAGCAAATCCAGCGATCCGGATGAGAAATGCAGTGCGCTTT
GACCACGAGTGACAATGGCACAGCGCAGGCCGTGTTTTTGCAGTTGCAGGCCACAGAGTA
ATCCGGCGAGGCCGCCGCCCATAATGACAGTATCAAAGCGCATCTTTCTGCTCCTTCTCC
AGACCACACAATCCCTGATAAACCCAGCGGGTAAATTCGCTTTCGCGCAGTGCATCTCCC
CAGGCGATGGGTTGCACGCCTTTCCAGCGTTCGTTAAGGAAGGTGGAAAGTTGCTCGATA
GATTGCGCGGACGTCGTGACGTTAAAACGTTGCAGCAGTCCGGCAGCGCGGCAGGCGCAG
AGTTCGCCCTGGCAGGTGCCCATCCCCACACGGGTACGACGGCGTAAATCCAGCAGGCTA
TTAACGTTTAAATTTTCTACCGCGTACTGCACTTCACCCGCAGTTACCGCTTCGCACTCA
CATACCAGGCTACGGTGCAGACGGCCTTCGCTCAGCCAGGCAGGCGTGCGATCGCCATGA
CGATAAACCGCAGAACCGCGCAGCGGGGCAGGCAGGGAGATGACTTTACGCAAGGTAACT
TCAGCGGGTTCTTGTGAACCAGGCAGTGCCAGATCGGCAGTCGTACAGGGGCGCGTGTTG
CCCAGTTTGCGGCATACCGCGTCGGTAGCCCATTCAGCCATCAGCCGATAGGTCATCAGT
TTGCCACCGGTGATGGTGATAAATCCGTCCAGACCATCGCGTTCAGCATGGTCGAGCAGC
ACGATGCCACGGCTGACGTTACGTCCGCTCGGGTCGTCATCGCTGGCAACCAGCGGGCGC
ACGCCAGAATAGGCCCGCAAAATGCGCGTTTTCGCCATCACGGGGGCCAGTTTTTCCCCT
TCACGCAGCAGAATATCAACCTCTTCTGCCGTCACTCGATTATCGTCAATCTCGTTGTAA
TCAATACGTAAAGAGGTGGTACCAATCAGCGAAATGGTATCGCCAGGCACCAGAATATCG
GCGTCGGAAGGTTTACGGCAGCGGTTGATCACATGCTGGTTAATGCGGTGATCCATGATC
AGCAGCGATCCTTTCGCCGGGAACATGCGAATGCGCAGATCGGCATATTCGGCAATGTGT
TGCCCCCAGATCCCAGCGGCATTAACCACGACAGGTGCATGAAGGGCCTGAGTTTCGCCG
GTGAGATGGTTACGTACACGAACACCGCACACCGTCGCGCCTTCACGAATCAGCCCCGTG
ACTTCATGAGCGGTAAGGATAACGGCACCGTGTTCTTTGGCATCCAGCATGTTTGCTGCG
GTCAGACGAAATGGATCAACGGTGCCATCCGGAACTTTCACCGCGCCAATCAGTGCCGGG
TTAACGGCAGGTTCGATAATGCGCGCTTGCTGCGGGTCTATAGCTTCTGCGCTGATCCCT
GCTTCTTCGCAGGCGCGAATAAAAGTGGCCTGGAAGGAGAGGTCATCTTCCGGCAGGGTG
ATAAACAGGCCGTTGGTTGGTTCAACGCAGTGACGTGCAATGCGTTTCAGGATCTGGTTT
TCACTAATGCATTCGCGGGCCGATTCCGCATCGGTTACCGCATAGCGCGCACCGCTGTGC
AGCAGGCCGTGGTTACGCCCGGTGGCACCGGTTGCGATGTCGTGGCGCTCAACCAAAATC
ACGCGCAGCCCGCGCAGGGCACAGTCGCGGGCAATCCCGGCTCCCGTTGCGCCGCCGCCA
ATGATAATCACGTCACTTGATTGCGAGTCGCGAGTTTTCATTGTTATCCCTCTGAAGTTC
GTTTTTTACCATTTAGCCATAGTAAAAACATGAATTGTTTGATTTCGCGCATATTCGCTC
ATAATTCGAAAGTGAAACGTGATTTCATGCGTCATTTTGAACATTTTGTAAATCTTATTT
AATAATGTGTGCGGCAATTCACATTTAATTTATGAATGTTTTCTTAACATCGCGGCAACT
CAAGAAACGGCAGGTTCTCTCACTGAATCAGGCTGTTAATCATAAATAAGACCACGGGCC
ACGGAGGCTATCAATGTTGAGTATTTTTAAACCAGCGCCACACAAAGCGCGCTTACCTGC
CGCGGAGATCGATCCGACTTATCGTCGATTGCGCTGGCAAATTTTCCTGGGGATATTCTT
TGGCTATGCGGCTTACTATTTGGTTCGTAAGAACTTTGCGCTTGCTATGCCTTATCTGGT
TGAGCAGGGATTCTCACGCGGTGATTTAGGTTTTGCCCTTTCGGGGATCTCGATTGCTTA
TGGATTTTCGAAATTCATCATGGGTTCGGTATCGGATCGCTCGAATCCGCGCGTTTTCCT
GCCCGCAGGTTTGATTCTGGCGGCGGCAGTGATGTTGTTTATGGGCTTTGTGCCATGGGC
GACGTCGAGCATTGCGGTGATGTTTGTACTGTTGTTCCTCTGCGGTTGGTTCCAGGGGAT
GGGGTGGCCGCCGTGTGGTCGTACTATGGTGCACTGGTGGTCGCAGAAAGAACGTGGCGG
CATTGTGTCAGTGTGGAACTGTGCGCACAACGTCGGTGGTGGTATTCCGCCGCTGCTGTT
CCTGCTGGGGATGGCCTGGTTCAATGACTGGCATGCGGCGCTCTATATGCCTGCTTTCTG
CGCCATTCTGGTGGCATTATTCGCCTTTGCGATGATGCGCGATACCCCGCAATCCTGTGG
CTTGCCGCCGATCGAAGAGTACAAAAATGATTATCCGGACGACTATAACGAAAAAGCGGA
ACAGGAGCTGACGGCGAAGCAAATCTTCATGCAGTACGTACTGCCGAACAAACTGCTGTG
GTATATCGCCATCGCCAACGTGTTCGTTTATCTGCTGCGTTACGGCATCCTCGACTGGTC
ACCGACTTATCTGAAAGAGGTTAAGCATTTCGCGCTAGATAAATCCTCCTGGGCCTACTT
CCTTTATGAATATGCAGGTATTCCGGGCACTCTGCTGTGCGGCTGGATGTCGGATAAAGT
CTTCCGTGGCAACCGTGGGGCAACCGGCGTTTTCTTTATGACACTGGTGACCATCGCGAC
TATCGTTTACTGGATGAACCCGGCAGGTAACCCAACCGTCGATATGATTTGTATGATTGT
TATCGGCTTCCTGATCTACGGTCCTGTGATGCTGATCGGTCTGCATGCGCTGGAACTGGC
ACCGAAAAAAGCGGCAGGTACGGCAGCGGGCTTTACCGGGCTGTTTGGTTACCTGGGCGG
TTCGGTGGCGGCGAGCGCGATTGTTGGCTACACCGTGGACTTCTTCGGCTGGGATGGCGG
CTTTATGGTAATGATTGGCGGCAGCATTCTGGCGGTTATCTTGTTGATTGTTGTGATGAT
TGGCGAAAAACGTCGCCATGAACAATTACTGCAAGAACGCAACGGAGGCTAATGGCATGA
AATTGACGCTGAAAAACCTTAGCATGGCGATCATGATGAGCACTATAGTCATGGGAAGCA
GTGCAATGGCGGCGGACAGCAACGAAAAAATAGTCATCGCCCATCGCGGTGCCAGTGGAT
ATTTGCCGGAGCATACGCTGCCAGCAAAAGCGATGGCGTATGCGCAGGGAGCGGATTATC
TGGAACAGGATTTGGTGATGACCAAAGACGACAATCTGGTTGTTCTGCATGACCATTACC
TCGATCGTGTTACTGATGTTGCCGATCGTTTCCCGGATCGGGCGCGCAAAGACGGTCGTT
ACTACGCGATAGATTTCACGCTGGATGAAATTAAGTCGTTGAAATTTACCGAAGGTTTCG
ATATTGAAAACGGTAAAAAAGTGCAGACTTATCCGGGGCGTTTCCCAATGGGTAAGTCCG
ACTTCCGGGTGCACACCTTTGAAGAAGAGATTGAATTTGTTCAGGGGTTAAATCACTCTA
CCGGGAAAAATATCGGTATTTATCCAGAAATCAAAGCGCCGTGGTTCCATCATCAGGAAG
GGAAGGATATTGCGGCAAAAACGCTGGAAGTGCTGAAGAAATATGGTTACACCGGTAAAG
ACGATAAAGTTTATTTGCAATGTTTTGATGCTGATGAGCTGAAGCGTATTAAGAATGAGC
TGGAACCCAAAATGGGCATGGAGCTCAATCTGGTACAGCTGATTGCCTATACCGACTGGA
ATGAAACGCAGCAGAAACAGCCGGATGGAAGCTGGGTTAATTACAACTACGACTGGATGT
TTAAGCCGGGTGCCATGAAACAGGTGGCGGAATATGCAGATGGTATTGGTCCGGATTACC
ATATGTTGATTGAGGAGACATCGCAGCCGGGTAATATCAAACTCACTGGCATGGTGCAAG
ATGCTCAGCAGAATAAACTGGTAGTGCATCCTTATACCGTGCGGTCAGATAAACTGCCTG
AATACACTCCTGATGTGAATCAGTTATATGATGCTCTGTATAACAAAGCGGGTGTAAATG
GGCTGTTTACTGATTTCCCTGATAAGGCAGTAAAATTTCTTAATAAAGAGTAATGTTACT
GCAGGATGGCGTTCATGCGCCATCCTGTCTCATATCAAATTTTTCCAATCGCCACTAATT
GTTCCATGCACATTTGTAGTAAAAACAGTGGACTGCCTTCTACCGGCTTTTCTTTAGCCA
GCAACGAAATCTGTCGATAGAAAGTTGGTTCGAGAGGAACGGAACACAATTCACCTGCAA
TGCTTTTCAGCGTTAACTCTGGTTGTAAGGCGATGCCTAATCCCTGTCGAATAAAATTCA
TCGCTGTATCCGCCTGATTAAATTCACATTTTATCTGCTGGGCGCACTATTAGTGGTAGT
GGCTGGTGGAATCTATGCGCTGCAAATGAAGGGTAAAAGCGGTGTCAAGCTAGTAGTGGC
AAAAGAAATTCATTAATACGACACGTTTCATTAAGATTTTCCTCAGGTAACCACCTATAG
TCATTGTCGTTAATAAAAATGACAGGCGATAGGGTATGGCAGTTTCAGCAAAGTACGACG
AATTTAATCACTGGTGGGCAACAGAGGGCGACTGGGTTGAAGAGCCTAACTATCGCCGTA
ATGGTATGAGCGGGGTGCAATGCGTCGAGCGCAACGGCAAAAAGCTGTATGTAAAGCGCA
TGACGCATCATCTGTTTCATTCCGTACGTTATCCGTTCGGCCGACCAACGATTGTCCGTG
AGGTTGCGGTAATTAAAGAACTGGAACGGGCCGGTGTCATCGTGCCGAAGATCGTTTTTG
GTGAAGCGGTGAAAATTGAGGGTGAATGGCGAGCGTTGCTGGTGACTGAAGATATGGCGG
GGTTCATCAGCATTGCTGACTGGTATGCCCAGCATGCAGTATCGCCTTATTCTGACGAAG
TACGGCAAGCCATGTTGAAAGCAGTGGCGCTGGCGTTTAAGAAAATGCATAGCATTAATC
GTCAGCATGGCTGTTGTTATGTTCGCCATATCTATGTGAAAACAGAAGGTAATGCAGAAG
CTGGTTTTCTTGACCTGGAGAAAAGTCGTCGCCGCTTGCGTCGCGATAAAGCGATTAATC
ATGACTTCCGCCAGCTGGAAAAATATCTGGAGCCAATCCCCAAAGCGGACTGGGAGCAGG
TGAAAGCGTATTACTACGCCATGTAATCGTTGTAGGCCAGATAAGACGCATAAGCGTTGT
ATCTGGCACTACAACCAATTCACATCTCGATTTCAATATCGCCTTTTGCCCGGCAACAAC
AGGGCAAAATTTCCCCCGGCTGAATAAAGGCTAACGGTTCGGCAATCCAGTCAACTTGAC
CTGCAACCAGGCGTGTGCGACAGGAGCCGCAGTAACCTTCGCGACACTGGTACTCAACCG
CCACATTGTGGGATTCCAGCGCCGCCAGAAGGGAAGGGTGTTCATCCTGGCACAGCAGTT
GTGTGCCAGTGATGCGCAGGGTAACGCGGGCCATCAGAGCTGGAAGTTACTCAAATCGTC
GGTGTCCACTTCCGAGTCAATCTGCCCGACCAGATAAGAACTGACTTCCACTTCCTGCGG
AGCAACCTGCACGTTATCAGACACCAGCCAAGTGTTGATCCACGGGATCGGGTTGGAGCG
CGTCTGGAACGGCAGATCCAAACCGACTGCCTGCATACGGATATTGGTGATGTATTCAAC
GTACTGGCAGAGAATGTCTTTATTCAGACCAATCATCGAACCGTCGCGGAACAGATAATC
CGCCCAGTCTTTCTCCTGTTGAGCTGCCTGAACAAACAGGTCATAGCACTCCTGCTTACA
CTCTTCGGCAATTTCCGCCATCTCAGGATCGTCCGCGCCGCTGCGCAGCAGATTCAGCAT
ATGCTGGGTGCCGGTCAGGTGCAGGGCTTCGTCGCGGGCAATCAGGCGAATAATTTTGGC
GTTGCCTTCCATCAATTCGCGTTCTGCAAATGCGAAGGAACAAGCAAAGCTGACGTAGAA
ACGAATCGCTTCCAGCGCGTTAACGCTCATCAGGCAGAGATACAGTTTTTTCTTCAGCTC
GCGCAGGCTAACGGTCACAGTTTTACCGTTAACGGTGTGGGTACCTTCGCCCAGCAGATG
CCAGTAGCTGGTCATTTCGATCAGCTCATCGTAATAGCTGGAGATCCCTTCCGCACGTTT
CTGGATCTGCTCGTTGGTGACGATATCGTCAAACACAACAGACGGATCGTTAACGATATT
ACGAATGATATGAGTATAGGAACGGGAATGAATCGTTTCTGAGAACGCCCAGGTTTCGAC
CCAGGTTTCCAGTTCCGGAATAGAAATAAGCGGCAATAGCGCCACGTTCGGGCTACGACC
CTGAATGGAATCCAGCAGCGTCTGATATTTCAGGTTGCTGATAAAGATGTGTTTTTCGTG
CTCCGGCAGCGCCTGGTAATCTATACGGTCGCGGGAGACGTCAACTTCTTCCGGACGCCA
GAAGAAAGAGAGCTGCTTTTCGATCAGCTTTTCGAAGATGTCATATTTTTGCTGATCGTA
GCGAGCCACGTTGACCGGCTGACCAAAGAACATCGGTTCTTTGAGCTGATCATTTTTCGT
CTGTGAAAAGGTGGTATATGCCATGAGTGTGTCCTGTTGGGAGTTTAATGCCGGATAAGG
CATTTTACGCCGCATCCTGTGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTACAAAT
CCGAGCCGTAGGCCGGATAAGGCGTTCACGCTGCATCCGGCACCCGGAGCCTGATGCGAC
GCTGGCGCGTCTTATCAGGCCTACAAACCGAGCCGTAGGCCGGATAAGGCGTTTACGCCG
CATCCGGCATCTCAATATCAGATCTTACATGCGCCGCTTTCGCAGCCATCGTCCTGGATT
GACGGCACCAGATCGTCTTGTGCGTCTTCAGCGCCGTCACGGGTGTTCTGATAATACAGT
GTTTTGACCCCGAATTTGTAGGCGGTGAGCAGGTCTTTCAGCAACTGCTGCATCGGCACT
TTTCCTGACGGGAAGCGTGACGGATCGTAGTTGGTGTTGGCAGAGATCGACTGATCGATA
AATTTCTGCATGATACCCACCAGTTGCAGATAACCATCGTTACCCGGCATTTCCCACAGC
AGCTCATAGGCGTCGTGCAGGTGCTCGTAGTCCGGCACCACCTGGCGCAAAATACCGTCT
TTCGACGCTTTGATGCTGACGTAACCGCGCGGCGGTTCAATACCGTTAGTGGCGTTAGAG
ATCTGCGAAGAAGTCTCGGACGGCATCAGAGCAGAAAGCGTGGAGTTACGCAGACCGTGC
GTTTTGATTGACTCACGCAGAGCTTCCCAGTCGTAATGCAGCGGCTCATTAGCGATGGTA
TCCAGATCTTTCTTATAGGTATCGATCGGCAGGATCCCTTTCGCGTAAGTGGTTTCGTTA
AACCACGGGCACGCGCCTTGCTCTTTCGCCAGCTCATTAGAGGCTTTCAGCAGGTAATAC
TGAATGGCTTCGAAGGTTTTATGCGTCAGGTTGTTGGCGCTGCCGTCGGAGTAGCGTTTA
CCGTGCTTCGCCAGGTAGTAAGCGAAGTTGATCACACCAATACCCAGCGTACGACGACCC
ATCGCTCCACGTTTGGCGGCCGGGATCGGGTAATCCTGATAATCCAGCAGCGCGTCAAGT
GCACGAACCGCCAGAATTGCCAGCTCTTCCAGTTCATCCAGGTTATTAATTGCGCCCAGG
TTGAAAGCAGACAGCGTACACAGCGCGATTTCACCGTTCTCGTCGTTGACGTCGTTCAGC
GGTTTGGTCGGCAGGGCTATCTCCAGGCACAGGTTAGACTGACGCACTGGCGCGATGGCC
GGATCAAACGGGCTATGGGTATTGCAGTGGTCAACGTTCTGAATATAGATACGACCGGTA
GACGCACGTTCCTGCATCATCAGCGAGAACAGCTCAACGGCTTTCACACGCTGCTTGCGG
ATGCTGTCGTCTTTCTCATATTTGGTATACAGACGTTCAAACTCTTCCTGATCGGCGAAG
AACGCGTCGTACAGCCCCGGTACGTCGGACGGGCTGAACAGGGTGATATCTTCACCTTTC
AGCAGACGGGTATACATCAGTTTGTTGATTTGTACCCCGTAGTCCATATGACGCACGCGG
TTGCCTTCCACACCACGGTTGTTTTTCAACACCAGCAGGCTTTCCACTTCCAGATGCCAC
ATCGGGTAGAACAGCGTTGCCGCACCGCCGCGCACACCGCCCTGAGAGCAGGATTTCACC
GCTGTCTGGAAATGTTTGTAGAACGGAATGCAGCCGGTATGGAACGCTTCACCACCGCGA
ATCGGGCTACCCAGCGCACGAATACGCCCGGCGTTGATGCCGATCCCGGCACGCTGGGAA
ACGTATTTAACAATCGCGCTGGAGGTGGCGTTGATGGAATCCAGGCTGTCACCGCACTCG
ATCAGTACGCAGGAGCTGAACTGACGAGTCGGGGTACGCACGCCGGACATGATTGGCGTC
GGCAGCGAAATTTTAAATGTGGAAACCGCGTCGTAAAAACGCTTCACATATTGCAGGCGC
GTTTCACGCGGGTAGTTCGAGAACAAGCACGCGGCAACTAGAATATAAAGGAACTGGGCG
CTCTCATAGATTTCGCCGGTCACGCGGTTCTGTACCAGATATTTGCCTTCCAGCTGCTTA
ACGGCAGCATAAGAGAAGGTCATATCACGGTCGTGATCGATAAAGGTGTCCATCTGCTTG
AACTCTTCTTCCGTGTAGTCTTCCAGCAGATGATTATCGTATTTGCCCATCTCGACCATT
TTCACCACGTGGTCGTACAGCGCAGGCGGCTCAAACTGGCCGTAGGCTTTTTTACGCAGG
TGGAAGATCGCCAGGCGCGCGGCGAGATACTGATAATCCGGCGCATCACGGGAGATCAGG
TCTGCGGCAGCCTTGATAATGGTTTCGTGGATGTCAGAGGTCTTGATACCGTCATAAAAC
TGAATGTGGGAGCGCAGCTCGACCTGGGAAATCGAAACGTTATGCAGTCCTTCTGCCGCC
CAATCCAGAACGCGATGGATTTTGTCGAGATTGATGCGCTCTGTGCTACCGTCGCGCTTT
GTCACCAGCAGATTCTGATTCATGTATGTCGTACCTGTTTTTGGAATTCTTTCCGCAATA
GTTTCATGCAGACTACCTGTAGTACGGGAAGCTGCTTAGAACACTATATATAGGGGGTAT
GTTTGGGATTCACTGCAAGATAGTGTGAAAATGACCCTCTTGCAAGTGCATAACTTTGTG
GATAACTCAGGAAGGAAAAAGTGGCTTTCGCGCACCTTAGGTCAGACAAGGTGTCCGGGA
AAGTCAATGGGAAGAGAAAAATTTGTTAAAAATAACTGTTCGGCGATTTCTTGAACGGCA
TAATAGGTTAGATAAATTGATATAGATGGCTTATTAATCTTTTTGCTAATGATTGCAAAA
ATTGATCTAAGCACGAGTCATCACATAATCTGATGTATCAGTTGTGGTCAATATATAAGC
GAATGTAAGAGATTGTTGATGGCGAAATGGTTGTTTTCTATTCGGTTATTGTTAAATGCT
AAGCCATTTTGTTAATTTACCTTATATTATAAGAAAATTATTCATGACTTTAATTTAGTT
TAAATATAACTGATATCCCTGAAGGTTATTAACTTGAATTATGACGCACTGATATTATTC
ATCAAATAATAACAAAATAGCCATTGCACCGGGTTGAACAATTTACAAAAGAAAGATATT
CCATATCGTATAATGCGATTAAATACGCCGTCTTATAGAAAATGATGGTTAGATTAATAT
GCGGATTATCTTTCTACGCAAGGAGTATTTATCTTTACTCCCGTCAATGATTGCATCTCT
TTTCTCTGCTAACGGTGTCGCGGCGGTCACTGATTCATGCCAGGGATATGATGTCAAAGC
GAGTTGTCAGGCCAGCAGGCAAAGCCTTTCAGGCATTACGCAGGACTGGAGTATCGCTGA
TGGGCAATGGCTGGTTTTTTCGGATATGACCAATAACGCCAGCGGTGGGGCCGTATTTTT
GCAACAAGGAGCGGAATTTTCACTATTACCAGAAAATGAAACTGGAATGACTCTGTTTGC
CAATAACACCGTTACAGGAGAATATAATAACGGCGGGGCCATATTTGCTAAAGAAAACTC
AACGCTGAATCTTACTGATGTTATTTTTTCCGGTAACGTCGCAGGCGGCTATGGTGGCGC
AATCTATTCTTCTGGTACTAACGATACTGGTGCCGTCGATTTACGTGTCACTAACGCCAT
GTTTCGCAATAACATCGCTAATGATGGCAAAGGTGGCGCAATTTATACCATTAATAATGA
CGTTTATTTAAGTGATGTTATTTTTGATAACAACCAGGCATATACATCAACAAGTTACAG
TGATGGCGATGGCGGGGCAATCGATGTTACCGATAATAATAGCGACAGCAAGCATCCTTC
AGGTTATACGATAGTAAATAACACTGCCTTTACAAATAACACTGCCGAAGGTTATGGCGG
GGCGATATATACCAATAGCGTGACGGCTCCCTATCTTATTGATATTTCTGTTGATGACAG
CTACAGCCAGAACGGAGGCGTGTTAGTCGATGAGAACAATAGCGCAGCAGGCTATGGAGA
TGGTCCTTCCTCTGCGGCGGGTGGCTTTATGTATCTCGGCTTAAGTGAAGTTACCTTTGA
TATTGCCGACGGAAAAACGCTGGTTATTGGCAATACAGAGAATGACGGAGCTGTTGACTC
TATTGCTGGTACCGGGTTAATCACCAAAACAGGTTCCGGCGATCTGGTACTTAATGCAGA
TAACAATGACTTTACTGGTGAGATGCAGATTGAAAACGGTGAAGTTACCCTGGGCCGCAG
CAACTCCCTGATGAATGTCGGCGATACGCATTGCCAGGACGATCCGCAAGACTGCTACGG
TCTGACGATAGGGAGTATTGATCAGTATCAGAATCAGGCTGAGCTAAACGTTGGCTCGAC
CCAACAAACTTTTGTGCACGCATTGACGGGCTTTCAGAATGGCACTTTAAATATCGATGC
TGGTGGCAACGTTACTGTTAATCAGGGCAGTTTTGCTGGCATCATCGAAGGTGCTGGTCA
GCTCACCATTGCGCAAAACGGCAGCTACGTGCTGGCAGGGGCGCAGTCGATGGCGCTAAC
CGGCGATATAGTCGTTGATGATGGTGCGGTGCTTTCGCTGGAAGGCGACGCGGCAGATCT
TACCGCTCTCCAGGACGATCCGCAGTCGATCGTGTTAAACGGCGGTGTGCTCGATCTCTC
TGATTTCTCCACCTGGCAGAGCGGCACATCATACAACGATGGCCTTGAAGTCAGTGGCAG
CAGCGGAACGGTTATCGGCAGTCAGGATGTGGTAGATCTTGCAGGTGGCGACAATTTGCA
TATCGGCGGCGACGGGAAAGATGGCGTCTACGTGGTGGTCGATGCGAGCGACGGGCAGGT
AAGTCTGGCAAACAATAATAGTTATTTGGGCACAACACAAATCGCCTCCGGTACGCTGAT
GGTGAGCGACAACTCGCAGCTTGGAGATACCCACTATAACCGCCAGGTTATCTTTACCGA
TAAGCAACAAGAAAGCGTGATGGAGATTACCTCCGACGTTGACACGCGTTCAGATGCGGC
AGGCCACGGACGTGATATTGAAATGCGCGCCGACGGTGAAGTGGCAGTTGATGCGGGGGT
AGACACGCAGTGGGGCGCACTGATGGCTGACAGCAGCGGGCAGCATCAGGATGAGGGTAG
CACATTGACTAAAACGGGGGCTGGTACACTGGAGCTGACCGCCAGCGGTACAACGCAGTC
GGCGGTACGTGTCGAAGAAGGCACCCTGAAAGGTGATGTTGCTGATATCCTTCCTTATGC
TTCGTCACTGTGGGTTGGTGATGGGGCAACGTTCGTTACTGGCGCGGATCAGGATATTCA
GTCAATTGATGCTATTTCCAGCGGCACTATCGACATCAGCGATGGTACGGTTTTGCGCCT
GACCGGGCAGGATACTTCCGTCGCCCTTAATGCCTCACTATTTAACGGCGATGGGACGCT
GGTGAATGCCACCGATGGTGTGACGTTGACAGGTGAGCTTAATACCAACCTTGAAACTGA
CAGCCTGACTTATCTTTCCAACGTGACGGTTAATGGCAATCTGACCAATACGTCCGGTGC
GGTTAGCCTGCAAAATGGCGTCGCTGGCGATACGCTGACGGTAAACGGTGATTATACCGG
CGGCGGTACGCTACTGCTCGATAGCGAATTAAACGGCGATGACTCGGTAAGCGATCAATT
GGTGATGAACGGTAATACTGCTGGCAACACAACTGTGGTGGTTAACTCCATTACAGGGAT
TGGTGAGCCGACATCGACAGGCATTAAAGTGGTTGATTTCGCAGCTGATCCCACGCAGTT
TCAAAACAATGCGCAGTTCAGTCTGGCAGGCAGCGGCTACGTCAATATGGGAGCGTATGA
CTACACGCTGGTGGAAGATAACAACGACTGGTATCTGCGATCGCAAGAAGTAACGCCGCC
ATCGCCACCTGATCCAGACCCGACTCCCGATCCTGATCCCACGCCGGATCCTGATCCAAC
ACCCGACCCGGAACCTACGCCTGCTTACCAGCCGGTGTTGAATGCCAAAGTTGGCGGTTA
TCTTAATAACCTGCGGGCGGCAAATCAGGCGTTTATGATGGAGCGACGCGATCACGCAGG
TGGCGATGGTCAGACGCTGAATTTACGTGTTATCGGCGGAGATTATCATTACACAGCAGC
GGGGCAACTGGCTCAACATGAAGACACTTCTACGGTGCAACTTAGCGGCGATCTGTTTAG
CGGGCGCTGGGGCACGGATGGCGAGTGGATGCTTGGGATTGTTGGTGGCTACAGCGATAA
CCAGGGCGACAGCCGCTCGAATATGACCGGAACTCGCGCCGATAACCAGAACCACGGTTA
TGCCGTTGGGCTGACATCAAGCTGGTTTCAGCACGGTAATCAGAAGCAAGGGGCCTGGCT
GGATAGCTGGCTGCAATACGCGTGGTTTAGCAATGATGTTTCCGAACAAGAAGATGGCAC
AGATCATTACCACTCGTCGGGGATTATCGCCTCGCTGGAGGCGGGGTATCAGTGGTTACC
GGGGCGTGGTGTGGTGATTGAACCGCAGGCGCAGGTGATTTATCAGGGCGTGCAGCAGGA
TGATTTTACCGCCGCTAACCGTGCGCGCGTGTCACAATCGCAGGGTGATGATATTCAGAC
GCGGCTGGGTTTACACAGCGAATGGCGTACCGCTGTTCATGTCATACCAACATTAGATCT
GAATTATTATCACGATCCCCATTCGACGGAAATTGAAGAGGATGGCAGCACTATCAGTGA
CGATGCGGTGAAGCAACGGGGTGAAATAAAAGTGGGAGTCACGGGCAATATCAGTCAGCG
AGTGTCCCTGCGCGGCAGCGTGGCGTGGCAGAAAGGGAGTGATGATTTTGCCCAGACGGC
AGGGTTTTTGTCGATGACGGTGAAATGGTAATCACTGTCTAGTCGGCACGGTTGCCGGAT
GCGGCGTAAACGCCTTATCCGGCCTACGGGGAGCATTTGTAGGCCTGATAAGACGCGGCA
AGCGTCGCATCAGGCATTGGCGCGGCCAAACATCAACCTCACTTATTCTGCGTGTGCAGC
ATATAGTTCACATCCACGCCGGGGCCGAGTTTAAAAGTATTAGTGATCGGGTTGTAATGC
AGCCCAGTGATATGCCGCTCTTTTAAACTGGTCTGATCCACCCAGCCCAGCAATTCTGCC
GGTTTAATAAACTTCTTCACATCATGCGTGCCTTTGGGCACCATGCGCAAAATATATTCC
GCACCAACCACCGCCATCAGCCATGACTTGCCGTTGCGGTTAAGTGTCGAGAAAAAGACA
TCGCCGCCTGGTTTCACCAGTTGCGCACAGGCTCTGACCACTGACTGCGGATCGGGGACG
TGCTCCAGCATCTCCATGCAGGTCACCACATCATACTGCCCGGCATGTTTTGCCGCGTGC
TCTTCCACGGTTTCCTGCACGTAATCCACCTGAATGCCGCTTTCCAGTGCGTGCAGTTTT
GCCACCTGCAATGGCTCAAAGCCCATATCCAGACCGGTCACCGTCGCGCCTTCGCGCGCC
ATACTCTCGGCCAGAATGCCGCCGCCACAACCGACATCGAGCACCTTTTTGCCAAATAAA
CCGCCAGCACGCTCGGCAATATAGCCCAGACGCAGCGGGTTAATGCGGTGCAGCGGTTTG
AACTCACCTTCCAGATCCCACCAGCGGGAGGCGACGGCTTCAAATTTAGCGATCTCTTCG
TGGTCTACGTTATGGTTTACCGGCGATTTTTCGGCATTCATTGGCACTTCTACTCCGTAA
TTGGCAAGACAAACGAGTATATCAGGCATTGGATGTGAATAAAGCGTATAGGTTTACCTC
AAACTGCGCGGCTGTGTTATAATTTGCGACCTTTGAATCCGGGATACAGTAGAGGGATAG
CGGTTAGATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAA
GAGCTCCTATCTGGATTATGCGATGTCGGTCATTGTTGGCCGTGCGCTGCCAGATGTCCG
AGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACGTACTAGGCAATGA
CTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCA
TCCCCATGGTGACTCGGCGGTCTATGACACGATCGTCCGCATGGCGCAGCCATTCTCGCT
GCGTTATATGCTGGTAGACGGTCAGGGTAACTTCGGTTCTATCGACGGCGACTCTGCGGC
GGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAACTGATGGCCGATCT
CGAAAAAGAGACGGTCGATTTCGTTGATAACTATGACGGCACGGAAAAAATTCCGGACGT
CATGCCAACCAAAATTCCTAACCTGCTGGTGAACGGTTCTTCCGGTATCGCCGTAGGTAT
GGCAACCAACATCCCGCCGCACAACCTGACGGAAGTCATCAACGGTTGTCTGGCGTATAT
TGATGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGGGGCCGGACTTCCC
GACGGCGGCAATCATTAACGGTCGTCGCGGTATTGAAGAAGCTTACCGTACCGGTCGCGG
CAAGGTGTATATCCGCGCTCGCGCAGAAGTGGAAGTTGACGCCAAAACCGGTCGTGAAAC
CATTATCGTCCACGAAATTCCGTATCAGGTAAACAAAGCGCGCCTGATCGAGAAGATTGC
GGAACTGGTAAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTGACGAGTCTGACAA
AGACGGTATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTCGGTGAAGTTGTGCTCAA
CAACCTCTACTCCCAGACCCAGTTGCAGGTTTCTTTCGGTATCAACATGGTGGCATTGCA
CCATGGTCAGCCGAAGATCATGAACCTGAAAGACATCATCGCGGCGTTTGTTCGTCACCG
CCGTGAAGTGGTGACCCGTCGTACTATTTTCGAACTGCGTAAAGCTCGCGATCGTGCTCA
TATCCTTGAAGCATTAGCCGTGGCGCTGGCGAACATCGACCCGATCATCGAACTGATCCG
TCATGCGCCGACGCCTGCAGAAGCGAAAACTGCGCTGGTTGCTAATCCGTGGCAGCTGGG
CAACGTTGCCGCGATGCTCGAACGTGCTGGCGACGATGCTGCGCGTCCGGAATGGCTGGA
GCCAGAGTTCGGCGTGCGTGATGGTCTGTACTACCTGACCGAACAGCAAGCTCAGGCGAT
TCTGGATCTGCGTTTGCAGAAACTGACCGGTCTTGAGCACGAAAAACTGCTCGACGAATA
CAAAGAGCTGCTGGATCAGATCGCGGAACTGTTGCGTATTCTTGGTAGCGCCGATCGTCT
GATGGAAGTGATCCGTGAAGAGCTGGAGCTGGTTCGTGAACAGTTCGGTGACAAACGTCG
TACTGAAATCACCGCCAACAGCGCAGACATCAACCTGGAAGATCTGATCACCCAGGAAGA
TGTGGTCGTGACGCTCTCTCACCAGGGCTACGTTAAGTATCAGCCGCTTTCTGAATACGA
AGCGCAGCGTCGTGGCGGGAAAGGTAAATCTGCCGCACGTATTAAAGAAGAAGACTTTAT
CGACCGACTGCTGGTGGCGAACACTCACGACCATATTCTGTGCTTCTCCAGCCGTGGTCG
CGTCTATTCGATGAAAGTTTATCAGTTGCCGGAAGCCACTCGTGGCGCGCGCGGTCGTCC
GATCGTCAACCTGCTGCCGCTGGAGCAGGACGAACGTATCACTGCGATCCTGCCAGTGAC
CGAGTTTGAAGAAGGCGTGAAAGTCTTCATGGCGACCGCTAACGGTACCGTGAAGAAAAC
TGTCCTCACCGAGTTCAACCGTCTGCGTACCGCCGGTAAAGTGGCGATCAAACTGGTTGA
CGGCGATGAGCTGATCGGCGTTGACCTGACCAGCGGCGAAGACGAAGTAATGCTGTTCTC
CGCTGAAGGTAAAGTGGTGCGCTTTAAAGAGTCTTCTGTCCGTGCGATGGGCTGCAACAC
CACCGGTGTTCGCGGTATTCGCTTAGGTGAAGGCGATAAAGTCGTCTCTCTGATCGTGCC
TCGTGGCGATGGCGCAATCCTCACCGCAACGCAAAACGGTTACGGTAAACGTACCGCAGT
GGCGGAATACCCAACCAAGTCGCGTGCGACGAAAGGGGTTATCTCCATCAAGGTTACCGA
ACGTAACGGTTTAGTTGTTGGCGCGGTACAGGTAGATGACTGCGACCAGATCATGATGAT
CACCGATGCCGGTACGCTGGTACGTACTCGCGTTTCGGAAATCAGCATCGTGGGCCGTAA
CACCCAGGGCGTGATCCTCATCCGTACTGCGGAAGATGAAAACGTAGTGGGTCTGCAACG
TGTTGCTGAACCGGTTGACGAGGAAGATCTGGATACCATCGACGGCAGTGCCGCGGAAGG
GGACGATGAAATCGCTCCGGAAGTGGACGTTGACGACGAGCCAGAAGAAGAATAATTTTA
CTTCTTCATGCCAAAAGGGAGCTATCTCCCTTGTTTGAATTGAAAAGTCCAGGCTGCAAA
GTCTGGGCTTTTGTCGTATTAGGGCACGGTAAAGTTTGGCTGTGCCCGTAAAAAATGGCT
GGCTATACACAAGGAATGTGGCAATGAGTGGTGAAAAAAAGGCGAAAGGCTGGCGGTTCT
ATGGTCTTGTAGGTTTTGGCGCAATAGCACTGCTTTCCGCTGGCGTCTGGGCGTTGCAAT
ATGCTGGCAGTGGGCCAGAAAAAACGTTGTCGCCGCTGGTGGTGCACAACAATCTGCAAA
TCGATCTCAATGAGCCGGACCTCTTTCTCGACAGCGACTCTCTGAGCCAGCTTCCCAAAG
ATCTCCTCACCATTCCGTTTCTCCACGATGTTCTGAGCGAAGATTTCGTTTTCTATTATC
AGAATCATGCCGATCGTCTGGGCATTGAAGGCAGCATTCGTCGTATTGTCTATGAACACG
ATCTCACGCTGAAAGATAAGCTCTTTTCGTCACTCTTAGATCAGCCCGCGCAGGCAGCGC
TGTGGCACGATAAACAAGGCCATCTTTCACATTATATGGTGCTGATCCAGCGCAGTGGTT
TAAGCAAACTGCTGGAGCCATTGTTGTTTGCCGCTACCAGCGACAGCCAGTTAAGCAAAA
CGGAAATCAGTAGCATCAAGATAAATAGTGAAACTGTTCCTGTTTATCAGTTGCGCTATA
ACGGCAATAACGCCCTGATGTTCGCGACTTATCAGGACAAGATGCTGGTGTTTTCCAGCA
CGGATATGTTGTTTAAAGATGATCAGCAGGATACCGAAGCCACGGCGATCGCAGGTGATT
TGTTGAGCGGCAAAAAACGCTGGCAAGCAAGCTTTGGCCTGGAAGAGCGTACTGCCGAAA
AAACGCCAGTACGCCAGCGCATCGTAGTCAGCGCCAGGTGGCTGGGGTTTGGCTACCAGC
GGTTAATGCCTTCTTTTGCTGGCGTACGCTTCGAAATGGGTAACGACGGCTGGCACAGTT
TTGTGGCGTTAAATGATGAATCCGCCAGCGTAGATGCCAGTTTCGATTTTACGCCGGTAT
GGAACAGTATGCCTGCCGGAGCCAGCTTCTGTGTGGCGGTGCCGTATTCACACGGTATTG
CCGAAGAGATGCTTTCGCACATCAGCCAGGAAAACGACAAGCTGAATGGGGCGTTAGACG
GTGCCGCGGGGCTGTGCTGGTATGAAGACTCAAAATTGCAAACCCCGCTGTTTGTCGGTC
AGTTTGATGGCACTGCCGAACAGGCGCAATTGCCAGGGAAACTGTTTACGCAAAATATTG
GTGCGCACGAAAGCAAAGCGCCAGAAGGTGTTTTGCCGGTAAGCCAGACTCAGCAGGGCG
AAGCGCAAATCTGGCGTCGCGAAGTGAGTTCCCGATACGGCCAGTATCCGAAAGCGCAGG
CGGCGCAACCCGATCAATTAATGTCGGATTATTTTTTCCGTGTGTCGCTGGCGATGCAAA
ACAAAACGCTGCTTTTCTCCCTCGATGACACGCTGGTTAATAACGCGCTGCAAACACTGA
ATAAAACCCGCCCGGCAATGGTGGATGTAATACCCACTGATGGCATCGTTCCGCTCTATA
TCAATCCACAAGGAATAGCGAAACTGCTGCGTAACGAAACGTTGACCAGTCTGCCGAAGA
ATCTCGAACCGGTTTTTTATAACGCCGCACAAACTTTATTAATGCCGAAGCTGGACGCTT
TATCTCAACAACCGCGTTATGTCATGAAGCTGGCCCAGATGGAACCCGGTGCCGCCTGGC
AGTGGCTACCCATAACCTGGCAGCCGCTATGAGGCACGGGCTGCTGGCGCTGATTTGCTG
GCTGTGTTGTGTTGTTGCCCATAGCGAAATGCTGAATGTCGAACAATCCGGGCTGTTTCG
CGCCTGGTTTGTACGCATTGCACAAGAACAGCTCCGCCAGGGGCCAAGTCCACGCTGGTA
TCAGCAGGATTGTGCGGGCCTGGTGCGATTTGCGGCGAACGAGACGCTGAAAGTTCACGA
CAGTAAATGGCTAAAAAGTAACGGTTTATCTAGCCAGTATTTGCCGCCAGAGATGACGCT
AACACCTGAACAGCGTCAACTGGCGCAAAACTGGAATCAGGGGAACGGGAAAACCGGCCC
CTATGTGACCGCGATTAATTTGATTCAGTACAACAGCCAGTTTATTGGCCAGGACATAAA
CCAGGCGCTGCCTGGCGATATGATTTTTTTCGATCAGGGCGATGCCCAGCACTTAATGGT
CTGGATGGGGCGTTACGTCATCTACCACACCGGAAGCGCCACGAAAACTGACAACGGAAT
GCGCGCAGTCAGTCTGCAACAACTTATGACATGGAAGGACACCCGATGGATACCCAACGA
TTCCAATCCCAATTTCATTGGCATTTATCGTTTAAATTTTCTGGCGCGATAGCAGCGTGC
TTGTCCCTGTCTCTTGTGGGAACAGGGCTTGCTAATGCTGATGATTCGCTTCCTTCCAGC
AACTATGCGCCGCCTGCCGGGGGAACATTCTTTTTGCTTGCTGACAGCAGTTTTAGCAGC
AGTGAAGAGGCGAAAGTGCGACTGGAAGCGCCGGGGCGTGATTATCGGCGCTATCAGATG
GAAGAGTACGGCGGCGTGGACGTTCGCCTGTATCGTATTCCTGACCCGATGGCATTTTTG
CGCCAGCAGAAAAACCTGCATCGCATTGTGGTGCAACCGCAATATCTGGGCGACGGGCTG
AACAATACGCTAACCTGGCTGTGGGATAACTGGTACGGCAAATCTCGCCGCGTGATGCAG
CGTACTTTCTCTTCTCAGTCACGGCAGAATGTGACTCAGGCGTTACCCGAATTACAGCTC
GGCAATGCCATTATTAAACCTTCCCGTTATGTACAGAACAACCAGTTTTCCCCGCTGAAA
AAATATCCCCTGGTGAAACAGTTCCGTTATCCACTATGGCAGGCTAAACCGTTCGAGCCG
CAGCAAGGGGTAAAACTGGAAGGCGCATCCAGCAATTTCATCTCGCCGCAGCCGGGTAAC
ATTTATATTCCTCTCGGCCAACAAGAGCCGGGACTGTACCTCGTCGAGGCGATGGTTGGT
GGGTATCGGGCGACGACGGTGGTGTTTGTTTCCGATACCGTGGCGCTTAGCAAAGTGTCA
GGCAAAGAGCTTCTGGTGTGGACCGCGGGTAAAAAACAGGGTGAAGCGAAGCCCGGCTCA
GAGATCTTGTGGACTGACGGTCTTGGCGTGATGACCCGCGGTGTGACCGATGACAGCGGT
ACCTTGCAGTTACAACATATATCGCCAGAACGTTCATACATTCTGGGTAAGGATGCTGAA
GGCGGCGTTTTTGTCTCCGAGAACTTCTTCTACGAAAGCGAAATCTACAACACCCGCTTG
TATATTTTTACCGATCGCCCGCTATATCGCGCAGGCGATCGTGTCGATGTTAAAGTGATC
GGCCGCGAGTTCCACGATCCGTTGCATTCATCCCCCATCGTCAGCGCCCCGGCGAAGCTT
TCGGTGCTGGACGCCAACGGCAGTCTGTTGCAAACCGTCAATGTCACGCTGGATGCGCGC
AATGGCGGGCAGGGAAGTTTCCGCCTGCCAGAAAATGCCGTAGCCGGAGGTTATGAGTTA
CGTCTTGCTTACCGCAATCAGGTCTATAGCAGCAGTTTTCGCGTGGCAAACTACATCAAG
CCACATTTCGAGATTGGTTTAGCTCTCGCCAAAAAAGAGTTCAAAACTGGCGAAGCGGTC
AGCGGCAAACTGCAACTGCTCTACCCGGATGGCGAGCCGGTAAAAAATGCCCGCGTGCAG
TTAAGTTTGCGCGCTCAGCAATTATCAATGGTCGGTAACGATTTGCGTTATGCCGGACGT
TTCCCCGTGTCGCTGGAAGGCAGCGAAACGGTGTCCGACGCCAGCGGTCATGTGGCGTTA
AATCTCCCCGCCGCCGATAAACCGAGCCGCTATTTGTTAACCGTCTCCGCCAGTGACGGC
GCGGCGTATCGCGTCACCACCACCAAAGAGATCCTCATTGAACGCGGTCTGGCGCATTAC
TCATTAAGTACTGCCGCACAATACAGTAATAGCGGCGAGTCGGTTGTGTTCCGTTATGCC
GCGCTGGAATCTTCAAAACAGGTTCCTGTTACGTATGAATGGTTGCGTCTCGAAGACCGC
ACGAGCCATAGCGGAGAGCTACCGTCAGGCGGCAAATCCTTTACCGTCAATTTCGCTAAA
CCTGGCAACTACAATCTGACATTACGCGATAAAGACGGCTTAATTCTCGCTGGGTTAAGT
CATGCCGTCAGCGGTAAGGGCAGCACGGCGCATACTGGTACGGTAGATATCGTGGCGGAT
AAAACGCTGTACCAGCCAGGCGAAACCGCGAAGATGCTGATTACCTTTCCGGAGCCAATT
GATGAAGCATTATTGACGCTGGAACGCGATCGCGTGGAACAGCAGTCGCTGCTTTCGCAT
CCGGCAAACTGGCTAACGCTACAACGTTTAAACGATACCCAGTATGAAGCCCGGGTTCCA
GTGAGCAATTCCTTTGCGCCTAACATCACTTTTTCGGTGCTGTATACCCGTAACGGTCAG
TACAGTTTTCAGAACGCCGGGATCAAAGTTGCCGTTCCCCAGCTGGATATCCGGGTGAAA
ACGGACAAAACCCATTACCAGCCTGGTGAACTGGTCAATGTCGAATTAACCTCGTCGCTG
AAAGGTAAACCTGTTTCTGCGCAGCTAACGGTAGGCGTGGTCGATGAAATGATCTACGCG
CTGCAACCAGAAATCGCGCCGAATATCGGCAAATTTTTCTATCCGCTGGGGCGTAACAAT
GTGCGTACCAGCTCCAGTCTGTCGTTTATCAGCTACGACCAGGCGCTCTCCAGCGAGCCG
GTTGCGCCTGGCGCAACTAACCGCAGCGAGCGGCGAGTAAAAATGCTTGAACGTCCACGG
CGTGAAGAGGTGGATACCGCGGCATGGATGCCGTCACTCACAACCGATAAACAAGGCAAA
GCGTATTTCACGTTCCTGATGCCTGATTCGTTAACCCGCTGGCGTATCACCGCGCGTGGG
ATGAACGGCGACGGGCTGGTCGGGCAGGGGCGTGCTTATCTGCGTTCGGAAAAAAATCTC
TACATGAAGTGGAGTATGCCAACGGTGTATCGCGTGGGCGACAAACCGGCGGCAGGACTG
TTTATCTTCAGTCAGCAGGATAACGAACCGGTGGCGCTGGTGACTAAATTTGCAGGCGCT
GAGATGCGCCAGACGCTGACGCTGCACAAAGGGGCGAATTATATTTCGCTGACGCAGAAT
ATTCAGCAATCTGGCTTGTTAAGTGCAGAACTGCAACAAAATGGGCAAGTGCAGGACAGC
ATTAGCACAAAACTGTCTTTTGTGGATAACAGCTGGCCCGTTGAACAGCAGAAAAATGTC
ATGCTCGGTGGTGGCGATAACGCGCTGATGTTGCCCGAGCAGGCGAGCAATATCCGGCTA
CAAAGTAGTGAAACGCCGCAGGAGATTTTCCGCAACAATCTTGATGCGTTAGTCGATGAA
CCGTGGGGTGGCGTAATCAACACCGGTAGCCGTCTGATCCCGCTCAGTCTCGCCTGGCGT
TCGCTTGCCGATCATCAAAGTGCCGCCGCTAACGACATTCGTCAGATGATTCAGGATAAC
CGTCTGCGGCTGATGCAACTGGCGGGGCCCGGAGCGCGCTTTACCTGGTGGGGTGAAGAT
GGCAATGGTGACGCCTTCCTTACGGCATGGGCATGGTACGCCGACTGGCAGGCCAGCCAG
GCGATCGGCGTAACGCAACAACCGGAATACTGGCAGCATATGCTCGACAGCTACGCGGAG
CAGGCAGATAACATGCCGTTATTGCATCGGGCGCTGGTGCTGGCATGGGCGCAGGAGATG
AATTTGCCGTGCAAAACGTTGTTGAAAGGGTTGGATGAAGCTATCGCCCGGCGCGGAACT
AAAACTGAAGATTTCTCTGAGGAAGACACCCGCGATATCAATGATAGCCTGATCCTCGAT
ACACCGGAGTCTCCACTGGCAGATGCGGTGGCAAACGTCTTAACCATGACGTTGCTGAAA
AAAGCGCAGTTGAAGTCCACGGTGATGCCACAGGTTCAGCAATATGCGTGGGATAAAGCG
GCAAACAGCAATCAGCCGCTGGCGCACACGGTTGTGCTGCTTAATAGCGGTGGCGACGCT
ACCCAGACGGCCGCTATTTTAAGTGGTTTGACCGCTGAGCAATCCACTATTGAGCGCGCG
CTGGCCATGAACTGGCTGGCGAAATATATGGCGACAATGCCTCCAGTTGTTTTGCCTGCG
CCTGCGGGCGCATGGGCTAAACATAAGTTAACTGGAGGGGGCGAAGACTGGCGTTGGGTT
GGTCAGGGCGTGCCGGACATTCTCTCTTTTGGTGACGAATTATCGCCGCAAAATGTGCAG
GTCCGCTGACGTGAGCCGGCAAAAATGGCTCAACAAAGTAACATTCCGGTGACCGTTGAA
CGCCAGTTGTATCGGCTTATCCCTGGTGAAGAAGAGATGAGCTTTATTCTGCAACCGGTG
ACCAGCAATGAGATTGACAGCGATGCGCTGTATCTCGATGAAATCACGCTTACCAGCGAG
CAGGATGCAGTTCTGCGCTACGGTCAGGTGGAAGTACCGCTGCCACCGGGAGCCGACGTT
GAGCGCACAACATGGGGCATTTCGGTCAATAAACCCAACGCCGCGAAACAGCAGGGGCAA
TTGCTGGAAAAAGCGCGAAATGAAATGGGCGAACTGGCCTATATGGTGCCGGTGAAAGAA
CTGACGGGAACGGTCACTTTCCGCCATTTGCTGCGCTTCTCGCAAAAAGGGCAATTCGTT
CTGCCTCCTGCTCGTTATGTGCGTTCCTATGCACCTGCGCAGCAAAGTGTTGCGGCAGGG
AGTGAATGGACCGGGATGCAGGTGAAATAAGTGAACTGGCGCAGAATCGTCTGGCTATTG
GCGTTGGTTACTCTGCCAACACTTGCGGAGGAGACGCCGTTACAACTGGTGCTGCGCGGT
GCGCAGCACGATCAACTGTATCAGCTGTCGTCATCAGGCGTGACCAAAGTCTCAGCATTA
CCTGACTCGCTCACCACGCCGTTAGGGAGTTTGTGGAAACTGTATGTTTACGCCTGGCTG
GAGGATACCCATCAACCGGAGCAGCCCTACCAGTGTCGCGGAAACTCCCCGGAAGAGGTT
TATTGTTGTCAGGCTGGGGAGAGCATAACGCGCGATACCGCGCTGGTACGTTCCTGTGGG
CTCTATTTTGCGCCGCAGCGGTTGCATATTGGCGCAGATGTGTGGGGGCAATACTGGCAA
CAGCGTCAGGCACCTGCGTGGTTAGCGTCTCTGACTACGCTGAAGCCAGAAACCTCGGTA
ACGGTTAAATCGCTGCTTGATTCATTAGCGACGTTACCCGCGCAAAACAAAGCTCAGGAA
GTCTTACTGGATGTGGTGCTGGACGAGGCGAAAATCGGTGTCGCATCCATGCTCGGTAGT
CGGGTACGGGTGAAAACCTGGAGCTGGTTTGCCGATGATAAACAGGAAATCCGTCAGGGT
GGTTTTGCTGGCTGGTTAACCGATGGTACACCGCTGTGGGTTACTGGCAGTGGCACCAGC
AAAACGGTACTAACCCGTTATGCGACGGTGCTTAATCGGGTTTTGCCAGTGCCGACGCAG
GTTGCCAGTGGGCAATGTGTAGAGGTGGAGCTGTTTGCCCGCTATCCGCTGAAGAAAATC
ACAGCGGAAAAGAGTACGACGGCAGTAAATCCCGGCGTACTTAATGGGCGCTATCGTGTG
ACGTTTACTAATGGTAACCACATTACGTTTGTCAGCCACGGTGAGACGACCTTACTGAGC
GAAAAGGGCAAACTGAAATTGCAGTCGCATCTCGATCGTGAAGAGTACGTTGCCAGAGTT
CTGGATCGCGAGGCGAAAAGTACGCCCCCTGAGGCAGCGAAAGCCATGACCGTGGCGATT
CGCACTTTTTTACAGCAAAACGCCAATCGGGAAGGCGATTGCCTGACCATCCCCGACAGC
AGCGCCACGCAGCGTGTTTCTGCTTCGCCAGCGACCACGGGGGCGCGAACGATGACCGCC
TGGACGCAGGATCTCATCTATGCAGGCGATCCGGTTCATTATCATGGCAGTCGCGCTACC
GAAGGGACACTTTCCTGGCGGCAAGCCACGGCCCAGGCGGGGCAGGGAGAGCGTTACGAT
CAGATACTCGCGTTTGCTTATCCCGACAACAGTCTTAGCCGCTGGGGAGCGCCACGCTCA
ACCTGCCAGTTATTACCCAAAGCGAAAGCCTGGCTGGCGAAAAAAATGCCGCAGTGGCGG
CGTATATTACAAGCTGAGACGGGGTACAACGAACCAGACGTGTTTGCGGTTTGCCGTTTA
GTCTCAGGTTTCCCCTATACCGATCGGCAGCAGAAACGGCTGTTTATTCGTAACTTCTTT
ACGCTTCAGGATCGGCTGGATTTAACCCATGAGTATCTGCACCTGGCCTTTGATGGTTAT
CCCACCGGGCTTGATGAGAACTATATCGAAACGCTGACCCGACAATTATTAATGGACTAA
TGCTATGCGAAAGATTTTTCTTCCGTTGTTACTGGTGGCGCTTTCGCCTGTCGCTCACAG
TGAAGGTGTGCAGGAAGTCGAGATTGATGCACCGCTCTCAGGCTGGCATCCGGCAGAGGG
CGAAGATGCCAGTTTTTCACAATCGATCAATTACCCGGCGTCGTCCGTCAACATGGCAGA
TGATCAAAATATCTCAGCGCAGATCCGCGGCAAAATAAAGAATTATGCTGCGGCGGGTAA
AGTTCAGCAGGGCCGGCTGGTGGTCAACGGTGCCAGTATGCCGCAGAGAATTGAATCCGA
TGGTTCATTTGCACGCCCTTATATTTTCACTGAAGGCAGCAACAGCGTGCAGGTCATCAG
CCCGGATGGGCAAAGCCGACAAAAAATGCAGTTTTACTCAACGCCGGGTACAGGAACGAT
TCGTGCACGTTTACGGCTGGTTCTCTCGTGGGATACGGACAATACCGACCTCGACCTTCA
CGTTGTTACGCCCGATGGCGAACACGCCTGGTACGGTAACACCGTGCTGAAAAACAGTGG
TGCACTGGATATGGATGTCACGACGGGGTACGGACCCGAGATTTTCGCCATGCCCGCGCC
AATTCACGGGCGCTATCAGGTGTATATCAACTACTATGGTGGGCGCAGCGAAACGGAATT
AACCACCGCCCAACTGACGCTGATCACCGATGAAGGATCGGTCAATGAGAAACAGGAAAC
ATTTATTGTACCGATGCGTAATGCTGGCGAGCTGACGCTGGTGAAAAGTTTTGACTGGTG
ATTAATGGGGTTACCTTCGCCGTCGATGTTCAAGAAAACACCCGATAACTTTCGCTATCG
GGTGTTTTTATTGATTAATTCAACCGTTCAATCACCATCGCAATTCCCTGACCGCCGCCA
ATGCACAGTGTTGCCAGCCCCAGCGTTTTATCGCGTGCCTGCATGGCATGTAATAGTGTG
ACCAGAATACGAGCACCACTGGCACCGATAGGATGCCCGAGCGCGATGGCCCCGCCGTTG
ACATTCACTTTCTCAGAATCAAAGCCCAGGTTTTTCCCAACGGCAAGGAACTGTGCAGCA
AATGCTTCATTAGCCTCAATGAGATCAATATCCGCCAGTTGCAGCCCCGCCAGTTGTAAC
GCTTTTTGCGTGGCAGGTACTGGCCCCATACCCATCAATGCGGGGGGCACGCCACCGCTG
GCATAACTTTTAATGCGAGCCAGGGGGGTAAGGCCTGCTGCCAGCGCCGCAGATTCTTCC
ATAATCACCAGAGCGGCAGCACCGTCGTTAATACCAGACGCGTTCCCAGCGGTGACTGTT
CCTGCTTTATCGAAGGCCGGGCGCAATGCACCTAACGCTTCAGCCGTTGAATTCGCTTTC
GGGAATTCGTCTTGACTGAAGACGAAGGTTTTCTTTCGAGTGACAACATTTACCGGGACG
ATTTCGGCTGTAAAAGCACCGGACTCAATTGCGGCTGCCGCTTTACGCTGTGAATGTAGC
GCCAGTTCATCCTGCATTTCACGGGTAATTCCGTACTCTTTAGCCACGTTTTCGGCGGTA
ATCCCCATATGATAACCATGGGTGGCGCACATCAGGCCATCGCGCAGGATTACGTCATAA
ACCTGTCCGTCTCCAAGACGATAACCAGAGCGTGCTTTTGCATCGAGTAAGTAGGGGGCT
AAACTCATATTTTCCATACCCCCCGCCACAATGCTCTGCGCCTGACCTGCCTGAATGGCC
TGGGCGGCAAGCGCCACACTTTTAAGACCCGAACCACATACTTTATTGACCGTGAATCCG
CACACCGTTTCTGCCAGCCCGCTTTTTAACAGTGCCTGACGCGCCGGATTTTGCCCCAGC
CCGGCTTGTAACACGTTACCCATAATCACTTCATCAACGTGTTGTGAATCGATTTTTGCA
CGTTCAATGGCGGCTTTAATTACTGTCGCCCCCAGGTCGATGGCGCTGGTGGAAGCGAGT
GAACCGTTAAAACTACCGATAGCAGTACGTACCGCACTGACGATGACACAATTTTTCATT
TTATATTCCTTCTGTTTGTAGGGGTGCCGTCAGAACAGCGTTAAACCAATGACGAAAATG
ACACCGGAGAAGAGCAGGGCAGTGATGCAGTAGCCCATGATGTCGCGGACACCGAGTCCG
GCGATTGCCAGTGCTGGCAGCGCCCAGAATGGTTGTGCCATGTTCATCCATTGCTCGCCG
TAGGCGATCGCCATTACCGATTTACCGAGATCAGCGCCCAGCGCCTGGGCTGCGGGTATC
ACGAAAGGTCCCTGAATAACCCAGTGACCGCCGCCAGACGGAACGGCGAAGTTAATCAGT
GCAGAACTAAAAAAGGTCATTACCGGGAAGGTGTCTTTGTTCGCAACATTGATGAAGAAT
TCGGTAATGAGTCCGCCCAGACCGGAATGCTCCATCATCAGTTGGATCCCAGCGTAGAAG
GGGAATTGCACCAGAATACCGGCAGTACTGCGTGCTGCCGCGCTGATAGCACGCATATAA
GCCATTGGCGTTTTATGTAGCAGCAGACCCGCAATCATAAACATCAGGTTGACGGTATTG
ATGGTGATGTTGAAGCCATGTTCGCTGAAGTACATCGCAAGGTAAGCGATACCGAGTGCG
CCGATGATCAACGTCAGAATGCGGCTTTCTTCCAGTCGCTCGGATGGTGGGGCATCTTTC
GGTAGCTGCTTTTGAAAATCAGCCTCTTCCATGAGTAGTTTTGGATCGATACTCACCACG
TCAGACGGTTTTGGCATCATCATGCGGGTGATAAATGGCATCACCACAATCAACGCCACA
GTGATGAAAATGTTAAAACCACTGAACAGAGTATCGCCCACCGGGATCAGCCCGGCGATA
TGCTCAACCGGGTTGCCCGGTGTTGCAGCCAACAGAGGCATTGATCCAGAGAAGCCGCCA
CCCCAGGTGAGAAAACCAATGTAGGCGCAGGCAATGAGCAACGGATAATCAGAACCGGGG
ACTCGCCGGGCGACTTCACGGGCAAACATTGCGCCGACAACCAAACCAAATCCCCAGTTG
ATGACACAAGCGACTGAACCGAAGAAAGTGACCAGCATGACGCCCTGTACGGGCGTCTTT
GCGGCGGAGGCGGCAGTACGCAGCAAACTTTTCACCGGAGCAGAGCTGGCAAGGGCATGA
CCGGTAACGATGATAAGCGCCATCTGCATACCAAACGCCAGCAAGTTCCAGAAACCGTCA
CCCCACATTTTCACCATGCTGATCGGCGTTTGTGGTGTTAACCAAAGCGCGATCACGAAT
GTTAGCAATGTCAGCAACATGGCAAAGATCAGTGGATCGGGAAGCCACCGGCTGACAAAA
CGCGTCATAAAACGCGATATGCGACCAATCATAAATCACCCCGTTGCGTATTCAGATCGG
CGGCGACTTCAAACCGAGCTTCTGTTTTGGCACGCACGGTGGCTAAATCACACCCGTCGG
CAATTTCGGTGAGCCACATTTTGCCGTCAATAAAACGAAAGACAGCCAGTTCAGTAACCA
GCATATGCACCGCATGTTGCGCAGTGAGTGGCATGGTGCAGCGGCGCAAAATTTTTGCTG
AACCATCTTTGGCGCAATGTTCCATGGCGATGATCACTTTGCGCGACCCGGTCACCAGAT
CCATCGCGCCACCCATACCGGGCACCATTTTCCCAGGCACTACCCAGTTCGCGAGGTTTG
CTTCTTCGTCTACTTGCAAACCGCCGAGCACGCAGGCATCAATATGACCGCCACGGATTA
GCGCAAATGACATGGCGCTATCAAACATGGCTGCACCGGGTAAAACACCGCACGGTTGCC
CGCCAGCGTTCACCAGATCTGGATGCGCTGTCGTGACCGGGCCTAAACCGAGGAAGCCGT
TTTCCGATTGCAGAGTGATATGAATACCCTCCGGTAAATAATTGGCGACCATTGTGGGTA
AACCGATCCCTAAGTTAACGATGTCACCATCACGAAGCTCTTGCGCCACACGGCGCGCAA
TACGTTGTTTCGCATCCATTATTTGCTCTCCTGTGAAACGATGATGTGGTCGATAACGGC
ACCAGGGGTGACAATATGGTCAGGTTGCAGCTCGCCGGTTTCGACCAGTTCATCTGGCTC
TACCAGCGTGATATCAGCCGCAAGGGCTATCAGGGGGTTAAAGTTGCGGGCGCTAAGTTG
ATAGGTCAGGTTGCCAAGTGTGTCGCAACGATGAGCGCGAATTAGCGCCAGGTCGGCGCG
CAGTGGGCGTTCGAGCAGCCAGGTTTTACCGTCGAGTGTCAGTGTCTGTTTGCCTTCCTC
TACGACGGTGCCGACACCCGTTGGGGTGAGAAAACCACCAAGTCCAGCTCCACCACAGCG
AATTTGCTCGATTAGCGTACCTTGCGGCACCAGAACGACGTCCATCTCACCAGATATCAT
GCGCCGACCTGTTTCCGGGTTGGTGCCGATATGTGAAGCAATCACTTTGCGGACTCGACC
ATTGACGATGAGCGGACCGATGCCGGTATCAACAAACGCGGTATCATTGGCTATCAATGT
CAGGTCGCGAACACCAGATTCCAGTAATGCTTCAACCAGGCGGGATGGAGTGCCAATCCC
CATAAATCCGCCCACCATGATGGTCATGCCGTCACGAAAGAAGCCGGTGGCGTCTTGTAA
TGTCATCAATTTTGTTTTCATTTTTTATCCCTCTTGCATACACCGTTGTGGGTACAGTCA
GGCAATAGCAAGGGGAGTGCCAGAATGAGATTATTGGATTTAGTTATTTAACTAATTGAA
TATGAAGGGATAAATTGGATGGGGATTTATAAGGAGAATGAGCGGCTATGCAGAAAATTG
CGCACTGTGCAAATTTCTGCATAGCAAGTTTTGGTGTTATACATCCGCCGGATCGATACC
GTATTCCTGGAGTTTATACATCAATGCACGGCGACTGATGCCCAGCATTAAAGCAGTGCG
GGTTCGGTTTCCTTCTTGTTGTTCCAGCACTTCCATAATGATGCGTTTTTCGACGCGTTT
AATTTCCTCTTTTAAATTACGCTCACCGACAGGGGCTGTTTTTACCTCGCCAGCATTACA
GACTGGCTGACGAATCTGTGGCGGAAGATCCTCAGAAAAAATGATCGGGCCTGAATTCAT
CACGACGGCGCGTTCAATAACGTTGGAAAGCTCTCGAATATTTCCCGGCCATGACCAGGC
GGTAAGCAGTGACATTGCCATCGGATCGATGTCGATAATATCGCGCTGATTCTCACTACT
GAATTTTTGCAAAAAGTGATTAGCTAACAGGGAAATATCTTCCCGGCGATCGCGCAGAGG
CGGCAGTATTAAATGAATAACGTTAAGGCGATAAAAGAGATCTTCACGGAAGGTGCCTTC
TTTTACCATTGCCTGCAAGTCGCGGTTGGTGGCAGCAATGATGCGGATATCAACTTTTAT
GGTCTGATGGCCGCCAATCCGTTCAAATTCCCGTTCCTGTAGAATGCGTAGTAATTTGGC
TTGTAGTACCAGCGGCATTTCGCCAATTTCGTCGAGGAGCAGAGTACCTTCGTTGGCTCG
TTCAAATAATCCCTGACGCAAGGTTTGTGCACCAGTAAATGCACCTTTTTCATGACCAAA
CAGTTCACTTTCGAGCAACGATTCCGGCAGCGCCGCGCAGTTGACTTTAATGAACGGCCC
CTTTGCCCGCCGCGAATTGTAGTGAATCGCTCTGGCAATCAACTCTTTCCCGGTGCCGCT
TTCACCGCTAATCAAGACGCTGGCCTGAGAAAGGGCAATTTTGGCGGTGTCTTTGCAGAT
GTCCATCATCGCCGGGCTGTTGGTGAGAATGTGCCCCCATTGCCAGCTGGTGCTCAGTGC
CTGGTGCAGATGACGGATCTCTTTTTTCATTGACTGGAGTTGTAAAGCGCGCTGAACGAT
TAAATTCAACTCATCGAGATCAAACGGTTTAATAACATAGTCGAAGGCTCCGCAGCGTAG
CGCTTCGACGGCGGTTTCCACTTCCGCATAGGCCGTCATCAGAATAACGGGTGTCCGGGT
CTCATGGCTGCGCATCTCCTTTAGTGCCTTGATGCCGTCCATCTCTGGCATGCGGATATC
CATCAACACCACATCAGGGTGAATATCGGCAAACAGGTGTAATGCTGTGCGTCCGTTGTT
CGCACAATGTGTTTCGAATCCTTGTAGTGCAAAAGCGGTGCTCAGCATACGGCGAACATT
ATCTTCATCATCCACAATAAGGATGCGATTAATAGCAGTCATACAGTCTGATTTCCCTGC
GGGTTGATCGGTAAAATAAGCGTGAAGGTTGCGCCGTAGCCCGGCAAACTGGCGACGCGA
ATATCACCCTGATGGGCATTAATGATGCGTTGACTTAACGCCAGACCAAGCCCGGTTCCT
GAGGCTTTGGTGGTGAAAAAGGGATCGAAGATCTTTTTTTGCAGCGAGAGATCAATGCCA
CAGCCGTTGTCCTCTATCGAAATGGCCTGTTGTGAGTCGCTGTATTGCCAGGTTTGAATG
CGAATTTTCCCTCGTGCGCTGATAGCCTGGACGGCATTGATCAGGATATTCAGTAGTACC
TGTTTGAGCAGTTCACGATCGGCGTTAATCGGGCTTAATTCATTATCCAGTTCGCTTATG
AAGTCGACCCGCGCTTGTACGCCGGCGGTTTGTACCAGTACCAGAGTTTCTTCAACCAAT
GCATTGAGGCTGACTTGTTGCCATTGACTGTGGCGTGGACGTGAAAATTCGAGCAATTGC
TGAATAACTTTGTTAATTGAATCGATTTCTTTGAGTACTACGGACAGATATTCCTGATGT
ATTGGGTCACTGGTTTGTTGGCGCAAGATCTGTACATAACCACGAATAGCCGTTAACGGA
TTACGTACTTCATGCGCGACGCCAGCCATCAGCTCACCCAGTGTGGCGAGGCGTTCTGCT
TGCGCCATGCGGCGCTGGGTTTCTTTGCGGGCAGTTAAATCAGAGAAAATCACCAAAGCA
CCTATCATTTCACCGTGCGTGTTATGAATACGACTGGTAGTGACACTGAGTTCAATGGTG
CGGTCACGACCTGGAAAACTGATCTCCAGCGCCACATGTTCGGTGCCATGTTCCAGCGTA
TCCAGTACTGGACTGTAGAACTGAGTATTGTCGAACAACATGGAGTAAGGCTGCCCTACC
AGTTCATGGCGTTGATAGCCAGTGATAACTTCTGCTGCTGGGTTCATGGTGGTTACATCA
CCCTGGCGGTCAATGGCAATGACGCCATCGGCAGCGTTTTCAATAATCAGATCGTTAAGT
GTCCGCGTTTCACGCAGTGCCTGGGCGAGGTTATTAACACTCTGACTGATTTGCCCCATT
TCACCGGGCAATTGTGGTAATCGAGTGGGAATATTTTGTGCCAGAGTCGAGAGGCCATCG
GTGATGATATCAATATTGGCGCTCAGGCGACGGGAGAAAAGGACAATCAACAGCAGGCTT
ATCAGCAAACCAGCGGTGAGCACAATGATAATCCTCACATCCATTTTCCAGGCCTGGCGG
CGAATATCTTCGGTTAATTCATTGGCCCAGATATAGCCGAGGATTTCACCATTACGCTCA
ATGGGGAGCATTGAATTCAAAATATCGCCGCGCACCTGCCTGCCTGAATAAACTAAAGGG
GTATTTGTACGCATCACTTCGCGACCAGGGTGATCTGCGGCAATGGTAACGCCGACATTA
TTCTGATATAGCGCTGAAGGCGCGTAGGTGATTATCGCATCCAGCATTTTGTTGTAATAA
CCAGCACCGATGCCAGGGAAGGCGTGAGTGATATTTTCGGTAATGGGGGCAAGTTCTGCA
TTTAATGCGCGGATACGCTCCTCACGTGGTAAGTCGATGTAGAGATCATAGCGATCGCCT
AGTGCCTGATTAAGCAGGTTGACCACGGCAGAAAGTTTTTTCTCTTTTTCAGATAAGACT
GCTGAACGTCCTTCCGTTTCTACGATATAACCAATAGTAAGCGTTGGGACAATGACCATC
AGGATTGCCATCAGGATCATTTGATTGCGTAAGCGGCGTGGATAAATCCACTTCATATAA
TGCATGCTGAAATCCACTAGTCTTGTCCGGTATATGACGATTATCAGAGGTTAAGGTGAT
GATTTCTCGGCGGTGTATCATATTCCAGAGAAGAGAGAACATTGCGGTAACACGCTTTTA
CCGCTACCTTAACCACACTCCATCGGTCACCTGAGGCGGAGCTTCGCCCCTTTGAAATAC
CTTGCTTCTTTTCGTACAACCCTGAAAGCCTCGCGCTACATGTTCAGAGCATTGGCGTTA
GTGCTCTGGCTGTTGATTGCTTTTTCATCCGTTTTTTACATCGTTAATGCGTTACATCAG
CGAGAATCGGAAATTCGTCAGGAATTTAATCTGAGTTCCGATCAGGCTCAGCGCTTTATT
CAACGCACCTCTGATGTGATGAAAGAGCTGAAGTACATCGCCGAAAATCGCTTATCGGCA
GAAAACGGTGTGCTTTCCCCGCGTGGACGAGAAACGCAGGCGGATGTGCCTGCGTTTGAA
CCGCTGTTTGCCGACTCCGATTGTTCCGCAATGAGTAACACCTGGCGAGGTTCTCTGGAG
TCATTGGCGTGGTTTATGCGCTACTGGCGCGATAATTTTTCTGCGGCTTACGATCTAAAC
CGGGTATTTTTAATCGGCAGCGATAACCTCTGCATGGCCAATTTCGGTCTGCGTGATATG
CCAGTGGAACGCGATACCGCGTTGAAAGCTTTGCATGAACGCATCAATAAATATCGAAAT
GCACCACAAGATGATAGCGGCAGTAACCTCTACTGGATCAGCGAAGGTCCGCGCCCTGGC
GTCGGGTATTTTTACGCGTTGACGCCAGTTTATCTGGCGAACCGGTTGCAGGCGCTTTTG
GGTGTCGAGCAGACCATCCGGATGGAGAACTTTTTCTTACCGGGTACGTTGCCGATGGGG
GTTACCATTCTTGATGAAAATGGTCATACCCTGATTTCGCTTACCGGACCAGAAAGTAAA
ATTAAGGGCGATCCTCGCTGGATGCAGGAACGCTCCTGGTTTGGCTATACGGAAGGGTTC
CGGGAGCTGGTGCTGAAGAAAAATCTGCCACCCTCATCGCTAAGCATCGTGTATTCGGTG
CCGGTTGATAAGGTGCTGGAACGCATTCGCATGTTGATCCTTAACGCAATTTTGCTGAAT
GTGCTTGCCGGAGCTGCATTGTTTACTCTCGCACGGATGTACGAGCGACGTATTTTCATT
CCGGCGGAAAGCGACGCCCTGCGACTGGAAGAACATGAGCAGTTCAATCGCAAGATTGTC
GCCTCCGCGCCAGTGGGTATCTGCATTTTGCGTACCGCTGATGGCGTCAATATTTTAAGT
AACGAACTGGCGCATACCTATCTCAATATGCTTACGCATGAGGACCGCCAACGACTGACG
CAAATTATCTGTGGGCAGCAGGTCAATTTTGTTGATGTCCTGACCAGCAACAATACCAAT
CTGCAAATCAGCTTCGTCCATTCGCGCTATCGTAATGAAAACGTGGCCATTTGTGTGCTG
GTGGATGTTTCTTCGCGCGTGAAGATGGAAGAGTCGTTGCAGGAGATGGCACAAGCAGCG
GAACAGGCGAGCCAGTCAAAATCGATGTTCCTTGCCACCGTCAGTCATGAGCTGCGAACG
CCGCTGTATGGCATTATCGGTAACCTGGATCTGTTGCAAACCAAAGAGTTACCGAAAGGC
GTCGATCGGCTGGTGACGGCAATGAACAACTCTTCCAGCCTGTTGTTGAAAATTATCAGC
GATATTCTCGATTTCTCGAAGATTGAATCGGAACAGTTGAAGATCGAACCGCGTGAGTTT
TCACCGCGTGAAGTGATGAACCACATCACCGCCAACTATTTACCGCTGGTGGTACGCAAG
CAGTTAGGCTTGTACTGCTTTATTGAACCGGATGTGCCAGTGGCCTTAAATGGCGACCCG
ATGCGTTTACAGCAGGTCATCTCCAACCTGTTGAGTAACGCCATAAAATTCACCGATACC
GGCTGTATAGTTTTGCATGTTCGCGCGGATGGCGATTATCTCTCTATCCGTGTTCGCGAT
ACCGGCGTGGGGATACCGGCGAAAGAAGTGGTGCGCTTGTTTGATCCCTTCTTCCAGGTC
GGAACGGGCGTACAGCGTAATTTCCAGGGGACCGGTCTGGGTCTGGCGATTTGTGAAAAA
CTGATCAGCATGATGGACGGCGATATCTCGGTAGATTCAGAACCGGGAATGGGCAGCCAG
TTTACCGTGCGTATTCCGTTGTACGGCGCTCAGTACCCGCAGAAAAAAGGCGTGGAAGGG
TTGAGTGGTAAACGCTGCTGGCTGGCGGTCCGCAATGCGTCGCTCTGTCAGTTCCTGGAA
ACCAGTTTGCAGCGCAGCGGCATCGTCGTTACAACATACGAAGGGCAGGAACCGACTCCC
GAAGATGTGTTGATCACTGACGAGGTAGTGAGTAAAAAATGGCAGGGCAGAGCGGTAGTG
ACCTTCTGTCGTCGCCATATTGGTATTCCGCTGGAGAAAGCGCCAGGGGAGTGGGTACAC
AGTGTGGCTGCTCCGCATGAGCTACCGGCATTGTTGGCGCGTATTTATTTGATCGAGATG
GAGAGCGACGATCCTGCTAACGCTCTGCCGTCAACGGACAAAGCGGTCAGCGATAATGAC
GATATGATGATTCTGGTCGTGGATGATCATCCGATTAACCGGCGTTTGCTGGCAGATCAG
TTGGGATCGTTGGGCTATCAATGTAAAACCGCGAATGATGGCGTCGATGCGCTTAATGTA
CTTAGCAAGAATCATATTGATATCGTGCTTAGCGACGTCAACATGCCAAATATGGATGGT
TACCGCTTGACGCAACGCATTCGTCAGTTGGGACTGACGTTGCCGGTAATCGGAGTAACT
GCTAATGCGTTGGCTGAAGAGAAGCAGCGGTGTCTGGAGTCCGGTATGGACAGCTGCCTG
TCGAAGCCGGTAACGCTGGATGTGATAAAACAGACGCTGACGTTATATGCCGAGAGGGTC
AGGAAATCGCGGGATTCGTAGGACGGATAAGGCGTTTACGCCGCATCCGGCATTCAGTGC
AAATGCCAGATGCGACGCTGACGCGTCTTATCTGGCCTACTTTAATGTAATTTGTTGAAA
TAATGGGAATCGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCAATCGGTGCAAATGC
CAGATAAGACACTAACGCGTCTTATCTGGCCTACAGGTGATTAGTCTTTATCTGCCGGAC
TTAAGGTCACTGAAGAGAGATAATTCAGCAGGGCGATATCGTTCTCGACACCCAGCTTCA
TCATCGCAGATTTCTTCTGGCTACTGATGGTTTTAATACTGCGGTTCAGCTTTTTAGCGA
TCTCGGTCACCAGGAAGCCTTCCGCAAACAGGCGCAGAACTTCACTCTCTTTTGGCGAGA
GACGCTTGTCACCGTAACCACCAGCACTGATTTTTTCCAACAGGCGAGAAACGCTTTCCG
GGGTAAATTTCTTCCCTTTCTGCAGCGCGGCGAGAGCTTTCGGCAGATCGGTCGGTGCAC
CTTGTTTCAGCACGATCCCTTCGATATCCAGATCCAATACCGCACTAAGAATCGCCGGGT
TGTTGTTCATAGTCAGAACAATGATCGACAGGCTTGGGAAATGGCGCTTGATGTACTTGA
TTAAGGTAATGCCATCGCCGTACTTATCGCCAGGCATGGAGAGATCGGTAATCAACACAT
GCGCATCCAGTTTCGGCAGGTTGTTGATCAGTGCTGTAGAGTCTTCAAATTCGCCGACAA
CATTCACCCACTCAATTTGCTCAAGTGATTTGCGAATACCGAACAAGACTATCGGATGGT
CATCGGCAATAATTACGTTCATATTGTTCATGTAATAGGCTACCTTGCTACAGCAAGCTC
TTGACATAACTGTCAATGTCGCTGATGTATTTTTCTATTCCTGGAACATCCTTCTCACGA
ATCAGATGTTCCAGCGTTTCACATAACTGCTTGCCGGGTACCAGATTTAGCATGGCAAAT
ACGCCTTTAAGACGATGAGCCGTTTGGGCTAACGCAGCAAAGTCACTGGTTGCTGCTTCA
GTATACAGCCTCTTAACATCATCCGGTACTGTGTCTACAAAGAGCGCATAATAGCCGCTG
GCATGGAGTTGCGCATTTTCATCTCCGCCCAGAGGCGATTCTGTCACCTCTTCCTGCGCC
AGTTGCACTTCAATTAATTGTAAGACCGCTTCCTGCATAGCGTTGCTCATATTGAAGTTG
ACGCACAATTGACCAGGCCCAATTTCCCGTACGCCAGACTCATCATCGCTTAAAAGCAAG
CCAGAGGCAGTAAGATTAGACGGATTATCCGTTAAAAAGATATCATAATCTTGACTAATT
AATCTTTCATCGGGTGTGATACAGGTTGCACCCCAATTTTCTAACTGGCGAGTGACAATA
TTCCGAATTTCTGCCGAAGTAACATCCACCATTACGCAGACATCATCCAGTAAACGCTCT
TCTTCCTCTTCAACTTCCGGGTCAGCTGCGAGCATTTTGATATGCACAGAGTAGCGTGTA
CCAAGCCCATCCCGCGTTTTGATGTTTAAATGACCGCCCAGTTTACGTGCCAGTTGATCG
CTCAGCCAGAATGCCAGCGGGTCCGCCTTGCCATAGCGATCGTTTTGGGTCTGGTTGATA
AACGGGAAGTGCAAATTATCCATTTCATGAATACTTACGCCTTCTCCCGTGTCCAGAATG
CGGAACGTCAGGCGGTCTTCGGAGGACTCATCCTGATCAACCTCAAGGGTGATTTTTCCC
AATTGCGTTGAGGTCACGGCATATTGCATCAGTAGCAGCAAAATACGTCGTAAGGCATCG
CGATCGCCGCGGCGCATATCGTGTGCTTTCAGATGATTGTTAATCAGCAGTTGCAGACCT
TTACGCTTGATGGCAGGCAACACTGAAGGCACAACTTCATCAATTAAATCCTGCACGGAG
AACAGCACCGTCTCACTTTTCCAGCTATCATCCGCAAGCATGTTCGCTAACTGTATTTCA
TCAACCAGCCGCACCAGCACATCTGCCTGATTCGCCAGTTGTTTGCTTTCCGGGGCGTTG
AGTTTAGCCGCGCTCTCCGCCAGGGACTGTGCGGGTTCTTTCAGCGCATCGCCAATGTTT
TTCATAAAGATCATCCGCCCCTGCTGGTTTTTCTCATACAGACGCTGCGCCTGCTTGAGT
TTCTTGTTTACCAGCACTTCGCGATCCTGATCGCGAATAATGAAAATTTGTGTGCGCGGC
GCGACCTGGCTGCGGAACATGCGGATCTCATACAGCTCGTTATTGATCGTCGCCTGAATA
ATCCCCTGATGCTGTTCCGCCATGGTGGTGATGTTTTGCAGATTCAAATGCGGCAGCAAA
TGATCGGCAATTTTGTTACTTATGACAGTGCGGTTCGATTCCTGATCGTGAACCAGCAGG
CCGAGCGGCAGCAGTGAGACTATCTCTTCATTGATTGCCCGTAAAATGCGCAATTCGTTA
TTGACCGCCGTGCTGGGGACGTTTTCTGTACTGCGGCTGGAGAAATGGCGGAATGTGGTA
TAGCCAAATAACGCCAGCGCCAGCAAACCGATGTTCAGCAGCAGTGGCAGCAGAATGTTT
TGCAACGTATCCAGCAATAAGGTGCCATAAGGAACCTGCCAGACCAGGCGCATATCGGTA
GAGTTGAGTGCCGAGGAGATTTCAATCTTCGTACTGTTAAAGTGGATACTGACGCTATCC
GTCCCTTCTTTCTCATTATCATTGTTTCCCGTTGCCGTCGCGTCTGGCTCAAGGCGGAAA
CTGTCCAGCGGCATACCCGGTGGGATCAAATCATTAATCGGCAGATCAAAAGCCACGACC
GTTGCCAGATGTCCTGGCTGGTTAAAGGTAGTACGCAATGTAAAGTAATGACCGTTCTGC
CAGGCCAGGCGGCGCATGTTAGAAAAGCTTTCGCGTTCATCGAGGGCGTTGGCCTGTTGC
AACATCTCTGCACGACGTGAATCAACAATGTCGCTGACGGTCGATTCTTTAAATCCGGAG
GTGAGATCTTTAAGGGGTAGGGTTGAGATCAGCACCAGACTGTTATCCTGACCATTCAGG
TAATACATCGACCACGGTACATTTTCTGCGCCCCACAATGTATCCAGATAAGTGGACATC
CGCTGAGTCATCTCAAGCGTTGAGTTGTCGTGAGAGCCAAAGATTAACGCTTCCGTTTTG
CGGCGTGGTTTCTCCAGATAGTAGACATCCTGTTTCAGGCGCGTCTCTTGTAAACCTTCG
CCGGAGGAGGGGGAGGTCGTCGCGGCAATGTTGTCGTAGATCTGCCAGGTCACGTAACGC
CAGTTATCGACGCGCTTTTGGATAGCATGGGTAATGTCGACAATCTGGTAACTTTTATCT
TTCAGCCAGGCGTTAACGGCGCTTTGTACCATTACACCCATCGTCACCAGTAACACAATG
ATCAACAGTAAAAAGAAGCGGGTAATGCTCCCCGGTAGGAGTGAAAAGCGGGTCGTGGCC
GTTGTCTCTTTCTGACGCATTCGTGTTTATGACCTGTTAAAACTTCGCGAAGTGATAGGG
CAGTATAAAGGGTACAGTGTGAAATTCCAGACTCTTACCTGATTGATGATTCTCTATTCT
CCCGTGATATTTATCATCCTGCATTGGGGGAAATAGATGTACAAGCGCCATTTTGCTGTA
CAAATAACCTACAAAAAGCCCAACAAAAATAATTGCAAATAAACAAAGATTGCTGGAAAT
TATGCGGATGTTAATTATTTGTGAAATAGTTAACAAGCGTTATAGTTTTTCTGTGGTAGC
ACAGAATAATGAAAAGTGTGTAAAGAAGGGTAAAAAAAACCGAATGCGAGGCATCCGGTT
GAAATAGGGGTAAACAGACATTCAGAAATGAATGACGGTAATAAATAAAGTTAATGATGA
TAGCGGGAGTTATTCTAGTTGCGAGTGAAGGTTTTGTTTTGACATTCAGTGCTGTCAAAT
ACTTAAGAATAAGTTATTGATTTTAACCTTGAATTATTATTGCTTGATGTTAGGTGCTTA
TTTCGCCATTCCGCAATAATCTTAAAAAGTTCCCTTGCATTTACATTTTGAAACATCTAT
AGCGATAAATGAAACATCTTAAAAGTTTTAGTATCATATTCGTGTTGGATTATTCTGCAT
TTTTGGGGAGAATGGACTTGCCGACTGATTAATGAGGGTTAATCAGTATGCAGTGGCATA
AAAAAGCAAATAAAGGCATATAACAGAGGGTTAATAACATGAAAGTTAAAGTACTGTCCC
TCCTGGTCCCAGCTCTGCTGGTAGCAGGCGCAGCAAACGCTGCTGAAGTTTACAACAAAG
ACGGCAACAAATTAGATCTGTACGGTAAAGTAGACGGCCTGCACTATTTCTCTGACAACA
AAGATGTAGATGGCGACCAGACCTACATGCGTCTTGGCTTCAAAGGTGAAACTCAGGTTA
CTGACCAGCTGACCGGTTACGGCCAGTGGGAATATCAGATCCAGGGCAACAGCGCTGAAA
ACGAAAACAACTCCTGGACCCGTGTGGCATTCGCAGGTCTGAAATTCCAGGATGTGGGTT
CTTTCGACTACGGTCGTAACTACGGCGTTGTTTATGACGTAACTTCCTGGACCGACGTAC
TGCCAGAATTCGGTGGTGACACCTACGGTTCTGACAACTTCATGCAGCAGCGTGGTAACG
GCTTCGCGACCTACCGTAACACTGACTTCTTCGGTCTGGTTGACGGCCTGAACTTTGCTG
TTCAGTACCAGGGTAAAAACGGCAACCCATCTGGTGAAGGCTTTACTAGTGGCGTAACTA
ACAACGGTCGTGACGCACTGCGTCAAAACGGCGACGGCGTCGGCGGTTCTATCACTTATG
ATTACGAAGGTTTCGGTATCGGTGGTGCGATCTCCAGCTCCAAACGTACTGATGCTCAGA
ACACCGCTGCTTACATCGGTAACGGCGACCGTGCTGAAACCTACACTGGTGGTCTGAAAT
ACGACGCTAACAACATCTACCTGGCTGCTCAGTACACCCAGACCTACAACGCAACTCGCG
TAGGTTCCCTGGGTTGGGCGAACAAAGCACAGAACTTCGAAGCTGTTGCTCAGTACCAGT
TCGACTTCGGTCTGCGTCCGTCCCTGGCTTACCTGCAGTCTAAAGGTAAAAACCTGGGTC
GTGGCTACGACGACGAAGATATCCTGAAATATGTTGATGTTGGTGCTACCTACTACTTCA
ACAAAAACATGTCCACCTACGTTGACTACAAAATCAACCTGCTGGACGACAACCAGTTCA
CTCGTGACGCTGGCATCAACACTGATAACATCGTAGCTCTGGGTCTGGTTTACCAGTTCT
AATCTCGATTGATATCGAACAAAGGGCCTGCGGGCCCTTTTTTCATTGTTTTCAGCGTAC
AAACTCAGTTTTTTGGTGTACTCTTGCGACCGTTCGCATGAGGATAATCACGTATGGAAA
TAAGCTTTACCCGCGTGGCACTGCTGGCTGCCGCGCTCTTCTTTGTTGGTTGCGATCAAA
AACCACAACCCGCCAAAACCCACGCTACTGAAGTTACCGTTCTTGAAGGCAAAACTATGG
GTACCTTCTGGCGTGCCAGCATCCCGGGCATTGACGCCAAACGCAGCGCCGAACTTAAAG
AAAAGATTCAGACCCAACTGGACGCCGACGATCAGCTGCTTTCGACCTATAAAAAAGATT
CCGCGCTGATGCGCTTTAACGACTCGCAAAGTTTATCGCCGTGGCCGGTAAGTGAAGCGA
TGGCCGATATCGTCACCACCTCGCTGCGCATTGGCGCGAAGACCGATGGCGCGATGGATA
TAACCGTCGGGCCGCTGGTGAATCTGTGGGGCTTTGGCCCGGAACAACAGCCGGTTCAAA
TTCCGAGCCAGGAACAGATCGATGCGATGAAAGCCAAAACCGGCTTACAGCACCTGACGG
TCATCAATCAGTCGCATCAGCAATATCTGCAAAAAGACCTGCCGGATTTATATGTCGATC
TCTCCACCGTCGGCGAAGGCTATGCGGCCGATCATTTGGCACGCTTGATGGAGCAGGAAG
GGATTTCCCGCTATCTGGTGTCGGTGGGCGGCGCGCTGAACAGCCGTGGTATGAACGGTG
AAGGCCTGCCGTGGCGGGTAGCGATTCAAAAACCAACCGATAAAGAAAACGCGGTTCAGG
CTGTGGTGGATATCAACGGTCATGGGATTAGCACCTCTGGCAGCTACCGTAACTATTACG
AACTGGACGGCAAACGTCTTTCCCATGTTATCGATCCGCAAACCGGGCGTCCCATCGAAC
ACAATCTGGTATCCGTGACGGTGATTGCTCCGACGGCGCTGGAAGCCGATGCCTGGGATA
CTGGCTTGATGGTACTCGGGCCGGAGAAAGCTAAAGAGGTTGTTCGCCGGGAAGGGCTGG
CGGTTTATATGATCACCAAAGAAGGCGATAGCTTTAAAACCTGGATGTCACCACAGTTTA
AAAGCTTCCTTGTCAGCGAAAAAAATTAAAGCGCAAGATTGTTGGTTTTTGCGTGATGGT
GACCGGGCAGCCTAAAGGCTATCCTTAACCAGGGAGCTGATTATGAAAAAAGCCACATGC
TTAACTGACGATCAACGCTGGCAATCTGTCTTAGCCCGCGACCCGAATGCCGACGGCGAA
TTCGTTTTCGCCGTGCGTACCACAGGCATCTTTTGCCGTCCGTCTTGCCGCGCCAGACAT
GCTTTGCGGGAAAACGTCTCCTTCTACGCAAATGCCAGCGAGGCACTCGCCGCTGGCTTT
CGCCCCTGCAAACGTTGTCAGCCAGAAAAAGCCAATGCCCAGCAACATCGGTTGGATAAA
ATCACCCACGCGTGTCGACTGCTGGAACAGGAAACGCCTGTAACGCTGGAAGCCTTAGCC
GACCAGGTGGCGATGAGTCCATTTCATCTACATCGGTTGTTTAAAGCGACTACCGGAATG
ACGCCTAAAGCCTGGCAACAGGCCTGGCGCGCTCGCCGTTTGCGCGAATCGCTGGCGAAA
GGGGAGAGCGTGACGACGTCTATTCTTAACGCCGGATTCCCCGACAGCAGCAGTTACTAT
CGCAAAGCTGACGAAACGCTGGGCATGACGGCTAAACAATTCCGTCACGGTGGCGAAAAT
CTGGCGGTGCGTTACGCGCTGGCTGATTGTGAGCTGGGTCGTTGCCTGGTGGCAGAAAGC
GAGCGGGGGATTTGCGCGATATTGCTGGGCGATGATGACGCGACACTAATCAGCGAGTTG
CAGCAGATGTTTCCCGCTGCCGACAACGCGCCTGCCGATCTGATGTTTCAGCAACATGTG
CGTGAAGTGATCGCCAGCCTCAATCAACGCGATACGCCGCTGACGTTACCGCTGGACATT
CGCGGCACTGCTTTTCAGCAACAAGTCTGGCAGGCACTGCGCACGATACCTTGCGGTGAA
ACCGTCAGTTATCAGCAACTGGCTAACGCCATCGGCAAACCGAAAGCGGTACGGGCCGTT
GCCAGCGCCTGTGCCGCCAACAAGCTGGCTATCATAATACCCTGTCATCGGGTGGTCCGT
GGTGATGGCACACTTTCCGGTTACCGCTGGGGCGTGTCGCGTAAAGCGCAACTGCTGCGC
CGCGAAGCTGAAAATGAGGAGAGGTAATGTTGGATCTGTTTGCCGATGCTGAACCGTGGC
AAGAGCCACTGGCGGCTGGTGCGGTAATTTTACGGCGTTTTGCTTTTAACGCTGCGGAGC
AACTGATCCGCGATATTAATGACGTTGCCAGCCAGTCGCCGTTTCGCCAGATGGTCACCC
CCGGGGGATATACCATGTCGGTGGCGATGACCAACTGTGGGCATCTGGGCTGGACGACCC
ATCGGCAAGGTTATCTCTATTCGCCCATTGATCCGCAAACAAATAAACCGTGGCCCGCCA
TGCCACAGAGTTTTCATAATTTATGTCAACGTGCGGCTACGGCGGCGGGCTATCCAGATT
TCCAGCCAGATGCTTGTCTTATCAACCGCTACGCTCCTGGCGCGAAACTGTCGCTGCATC
AGGATAAAGACGAACCGGATCTGCGCGCGCCAATTGTTTCTGTTTCTCTGGGCTTACCCG
CGATTTTTCAATTTGGCGGCCTGAAACGAAATGATCCGCTCAAACGTTTGTTGTTGGAAC
ATGGCGATGTGGTGGTATGGGGCGGTGAATCGCGGCTGTTTTATCACGGTATTCAACCGT
TGAAAGCGGGGTTTCATCCACTCACCATCGACTGCCGCTACAACCTGACATTCCGTCAGG
CAGGTAAAAAAGAATAAAAATAAGAATTATTATTGCTGTGCGCGCGAAGATGTTTAAACT
GCGGGCTGTAATTCATTGTCCGGGTTTTCTGCATGGAACTTCTTGTACTTGTCTGGCGGC
AGTATCGCTGGCCATTTATCAGTGTGATGGCGCTAAGCCTCGCCAGTGCGGCATTAGGCA
TTGGCTTAATTGCTTTTATCAATCAGCGCCTTATCGAAACGGCGGATACCAGTCTGCTGG
TGTTGCCGGAGTTTCTGGGATTATTGCTGCTGTTGATGGCAGTCACTCTCGGATCGCAAC
TGGCGCTCACCACTTTGGGGCATCACTTCGTTTACCGACTGCGTAGTGAATTTATCAAGC
GGATTCTGGATACTCACGTCGAGCGCATTGAACAACTCGGTAGCGCCTCGTTGCTGGCGG
GGTTAACCAGCGATGTGCGCAATATCACCATTGCTTTTGTGCGTCTGCCGGAACTGGTGC
AGGGGATCATTCTCACTATCGGTTCAGCGGCGTATCTGTGGATGCTGTCGGGCAAAATGT
TGCTGGTAACGGCTATCTGGATGGCGATCACCATCTGGGGCGGTTTTGTGCTGGTGGCGC
GGGTGTACAAACATATGGCGACCCTGCGTGAAACCGAAGACAAGCTGTACACGGATTTTC
AAACTGTACTTGAAGGGCGCAAAGAGCTGACTCTGAACCGGGAACGCGCCGAGTATGTGT
TTAACAACCTCTACATTCCTGATGCGCAAGAGTATCGCCACCATATTATTCGCGCAGACA
CCTTCCATCTTAGTGCCGTGAACTGGTCAAACATCATGATGCTGGGCGCAATCGGCCTGG
TGTTCTGGATGGCGAACAGCCTCGGTTGGGCTGATACCAACGTTGCCGCGACCTATTCGT
TGACGCTTTTATTCCTGCGTACGCCGCTGCTTTCGGCGGTTGGCGCATTGCCGACGCTGC
TGACGGCGCAGGTGGCGTTTAACAAGCTGAACAAATTCGCGCTCGCGCCTTTCAAAGCAG
AGTTTCCGCGCCCGCAGGCGTTTCCCAACTGGCAAACGCTGGAGCTGCGTAACGTGACGT
TTGCTTATCAGGATAACGCGTTTTCCGTTGGTCCGATTAATCTCACCATCAAACGTGGCG
AGCTGCTGTTTCTGATTGGCGGCAACGGTAGCGGAAAATCGACGCTGGCGATGTTGTTGA
CGGGCTTGTATCAGCCACAAAGCGGCGAAATCTTGCTGGATGGCAAACCTGTCAGCGGCG
AACAACCGGAAGATTATCGCAAACTGTTTTCGGCAGTGTTTACCGATGTCTGGCTGTTTG
ATCAACTGCTGGGGCCGGAGGGTAAACCCGCTAACCCGCAACTGGTTGAGAAGTGGCTGG
CGCAGCTGAAAATGGCTCATAAGCTTGAGTTAAGCAACGGGCGTATTGTTAACCTGAAGT
TATCAAAAGGGCAGAAAAAACGCGTGGCGCTGTTGCTGGCGCTGGCAGAAGAACGCGATA
TTATCCTGCTGGATGAATGGGCGGCGGATCAGGATCCACACTTCCGTCGTGAGTTTTATC
AGGTGTTGCTGCCGCTGATGCAGGAGATGGGTAAAACTATTTTCGCTATCAGTCATGATG
ATCATTACTTTATCCACGCCGACCGCCTGCTGGAAATGCGCAATGGGCAACTTAGCGAGC
TGACGGGCGAAGAGCGCGATGCCGCTTCGCGTGATGCCGTTGCCCGGACGGCATAATATT
ACGACGCTGACCTGGCGGACTGCTGCCGTCAGGTCAATATGCTAAAAATCCCTTCATTTC
TAATAACCCTATAATTAATCAACGAAATTATAATGTTTCTAAAATTAGAATATAATTTAT
AAACATTATTTAAATGTTGTTACTTAAGTGTTACCGTTGATGCCGCGCAAATCTCACCTG
CAATAAAGCGACTAAAAGTAAGGCATTAACAAGATGAAAAAAGTGACTGCCATGCTCTTC
TCGATGGCCGTGGGGCTTAATGCCGTTTCGATGGCGGCAAAAGCGAAAGCGTCCGAGGAG
CAGGAAACTGATGTACTGTTGATTGGCGGCGGCATTATGAGCGCCACGTTGGGGACCTAT
TTACGCGAGCTGGAGCCTGAATGGTCGATGACCATGGTGGAGCGCCTGGAGGGTGTCGCG
CAGGAGAGTTCGAACGGCTGGAATAACGCCGGAACCGGGCATTCTGCACTGATGGAACTG
AACTACACCCCGCAAAACGCCGATGGCAGCATCAGTATTGAAAAAGCAGTCGCCATTAAC
GAAGCATTTCAGATTTCCCGCCAGTTCTGGGCGCACCAGGTTGAGCGCGGCGTGCTGCGT
ACTCCGCGTTCATTTATCAATACCGTTCCGCATATGAGCTTTGTCTGGGGCGAGGATAAC
GTCAATTTCCTGCGCGCCCGTTACGCCGCGTTGCAACAAAGCTCGCTGTTTCGCGGTATG
CGTTACTCTGAAGATCACGCGCAGATCAAAGAGTGGGCACCGTTAGTGATGGAAGGGCGC
GATCCGCAACAGAAAGTGGCAGCCACGCGTACGGAAATTGGTACCGATGTGAACTACGGC
GAGATCACCCGCCAGTTAATTGCTTCCTTGCAGAAGAAATCTAACTTCTCGCTGCAACTC
AGCAGCGAAGTCCGCGCCCTAAAGCGTAATGACGATAACACCTGGACCGTTACCGTTGCC
GATCTGAAAAATGGCACTGCACAGAACATTCGTGCCAAATTTGTCTTTATCGGCGCGGGC
GGTGCGGCGCTGAAGCTGTTACAGGAATCGGGGATTCCGGAAGCGAAAGACTACGCCGGT
TTCCCGGTGGGCGGACAGTTCCTTGTTTCGGAAAACCCGGACGTGGTTAATCACCATCTG
GCGAAGGTTTACGGTAAAGCATCCGTTGGCGCACCACCGATGTCGGTTCCGCATATCGAT
ACCCGCGTTCTGGACGGTAAACGCGTAGTGCTGTTTGGGCCATTTGCCACCTTCTCAACC
AAATTCCTCAAAAACGGTTCATTGTGGGATCTAATGAGTTCCACCACCACCTCTAACGTG
ATGCCGATGATGCACGTCGGGCTGGATAATTTCGATCTGGTGAAATATCTGGTGAGTCAG
GTGATGTTGAGTGAAGAGGATCGTTTTGAAGCGTTGAAAGAGTACTATCCGCAGGCGAAA
AAAGAGGACTGGCGTTTGTGGCAAGCGGGGCAGCGCGTGCAGATTATCAAGCGTGATGCC
GAGAAAGGTGGCGTACTGCGTCTGGGTACTGAAGTCGTCAGTGACCAGCAAGGAACCATT
GCCGCGCTCCTGGGGGCATCGCCAGGGGCGTCAACCGCCGCGCCGATTATGTTGAATCTG
CTGGAAAAAGTATTTGGCGATCGTGTTTCCAGCCCGCAATGGCAGGCTACGTTGAAAGCG
ATCGTTCCGTCTTATGGACGCAAGCTGAACGGTGATGTAGCGGCAACAGAACGCGAGTTG
CAGTACACCAGCGAAGTGCTGGGGTTGAACTACGACAAGCCGCAGGCAGCAGATAGTACG
CCGAAACCGCAGTTGAAACCGCAACCCGTTCAAAAAGAAGTGGCGGATATTGCGTTGTAA
TGATACGCCACATCCGGCATGGTATGCCGGATGTGGCGTATGCTGATAAGACGCGCCAGC
GTCGCATCAGGCAACCGGCTCGGGCGTTAGATGTTGGATGCGGCGTAACCGCCTTATCCA
ACCTACGGGGTGGAGCACTTCACAGCGGTGTAGGCCTGATAAGACGCGCCAGCGTCGCAT
CAGGCAACCGGCTTGGGCGTTAGATGTCGGATGCGGCGTAACCGCCTTATCCGACCTACG
GGGTGGAGCACTTCACAGCGGTGTAGGCCTGATAAGACGCGCCAGCGTCGCATCAGGCAA
CCGGCTCGGACGTTGGATGTCGGATGCGGCGTAACCGCCTTATCCAACCTACGGGGTGGA
GCACTTCACAGCGGTGTAGGCCTGATAAGACGCGCCAGCGT
>seq3
CATCCTGCACGACCCACCAATGTAAAAAAGCGCCCTAAAGGCGCTTTTTTGCTATCTGCG
ATTTGCGAAATTGCCTGATGCGCTTCACTTAGCAGACTACTATTTCCGGCAATTCCTGTC
TCCTCACCTACTGTGTCAATGCAGCCAACAGCTTAACCATCGCGGGCGTCACCTGCTGTG
TTTCATAAACAATATATAAATCTGCAGGGATGCGCTGTTTGAGCGGACGGAAAATGACAC
CTGGCCAGTTCATTTGTGCGTAGCTGTCCGCTATCAATGTGATACCAATGCCCATACTGA
CCATAGCGAGTACCGTTTGCGGTTCATTAACTTCGCGAATAACAACCGGTGAAAATCCCA
CCTGCTGGCAAACTCGCTGCAAAAAATCCCAGTCAGTGTAAACGGGCGGCATTGTAACAA
AATACTCGTCACGTAGCGCTTCCAGCGGGACGGTGGAAAATGATGAGAGATGATGCTCTT
CAGGCATCGCCACCAGAAACGCCGATTCATGCAACCGTAAGCTGGTAAAACCAGTCGGTG
GTTCTGTCGCCATTCGCCAGATCCCGGCATCAAGTTCGCGGCGTTCCAGCAAGGCCATTT
GCATCGCGGGCATCTTTTCGCGAAAAAGAACGTCAACGTTAGGATTTTCCCTGAGGAATC
GCCGCATAACCGGGCGCATCCGTCCCCACATTGCCGTTCCCACTACGCCGAGTTCAATCC
GCCCTGCTTCTCCCCGACCTATTTGTTCAATCCGAGCCAATACATTATTAGCATTCACCA
GCAATCGACGCGATTCTTCCATCAAGATTTTGCCCGCGTGTGTCAGTACGACGCTGCGCG
AATGGCGAATAAAAAGCTGCGTGCCGAGTTGATTTTCCAGCTCTTTAATATGAATGCTGA
GCGGAGGCTGAGACATATTTAAACGCGCTGCTGCGCGGCCAAAATGCAACTCTTCCGCTA
CGGCAAGAAAATAACGGAGCAACTTAAGATCTGTTCTGTATACGCGTTCCATAATTAAGT
GCTCCATATAATAAATACATCGTATTAAATTATCATGGCATAAAGTATTTCACCACCAGA
TATCCGACATACATAAACACAATGGATAATATACCCGGTAATACATTTGGTACAGGAATA
GGCAAGCGCACGATTGTAAACAAAGCACCAATACCAAAACCAACGCCGGAAGAAAATAAA
ATATCTTTCACTAATTAACCTTTATCATAAAAGCAGCTCTGAAGAGCAGAGCCGCGAATC
CTTTTAATGAGTCACCGCTCGATGCTTTATCTTTTCAGGGTCATGATTATATTTAAACCC
AAAGAAAAATATCACTGCGAGAAAAAGAGCATATCCTGCAAACACCAGCCAGATAGTTTG
CCAGTCTTTTACGCCATCCACCGAAAAGTAATCTACTGCCATGCCACTCAGAATCGAGCC
AACCCATGCGCCGACACCATTTACCATGGTCATAAAGAGCCCCTGCGCGCTGGCACGAAT
GCTGGAATCAACTTCCTGTTCGACAAATACCGAACCAGAAATATTGAAGAAATCGAATGC
ACAGCCATAAACAATCATCGACAGCAGCAGCAAAATAAATCCGGTTGTTGACGGATCGCC
ATAGGCGAAGAAGCCAAAGCGCAGCGTCCAGGCCACCATACTCATCAGCATGACGGTTTT
AATGCCAAATCGCTTTAAAAAGAATGGGATAGTCAGTATAAAGCCCACTTCTGCCATCTG
TGAAACTGACAGTAAAATGGAGGGATATTTCACCACAAAACTGTCAGCAAACTCCGGGTT
ACGGGCGAAATCATGTAGGAACGGATTACCAAAAACGTTGGTAATTTGCAGTACCGCACC
CAGCATCATGGCAAAGAGGAAAAAGATGGCCATGCGTGGATTTTTAAACAGCACGAAGGC
ATCCAGACCCAGCTTGCTGGCAAGCGATGTGGTCGCTTTTTTCTCCGCAACCGGAATCTT
CGGCAAAGTCAGCGCATAAGCCGACAGCAGCAATGACGCACCGGACGCGATATACAGCTG
CAGACTACTCAATTCCAGATGCAGCAGGCTTACTGCCCACATCGCGACAATGAACCCCAC
CGTACCAAAAACGCGAATGGGCGGGAAAGCGGTCACCGGGTCAAGCCCTGCCTGGGCAAG
ACAGGAATAAGAGACGCTGTTCGATAACGCAATAGTCGGCATAAACGCCATCGCATTGAC
TAACATCACCCAAAACATCATATCCGGATCAGTTACGGATGCCGCATAAAAAAGTACGCC
CGCACACACCAGGTGACACAGCATGTATGCACGTTCTGCGCGCAGCCATTTGTCTGCGAT
GATCCCCATTATACCAGGCATAATAATCGCGGCGATCCCTTTGGAACTGTAAACCATGCC
AACATTAGCGCCGGTGAAATGAAGAGTATTAATCATGTAAGAGCCGAGGGTAACCAGCCA
GCTCCCCCAGATAAAATATTGCAAAAAGGACATTACCTTTAAGCGCATCGCGATGCTCAT
AATCGTTTCCTTGTCGCATCATTTGGCCTCACCCGCGAGGCCGTTTCTTATTGTTTTTCT
CAGGCAATTTTGCGCAGAAAGCCACAAATAAGGTTGATGAAGTTCTGCTTAGAGAGCTCC
GCAGCCGCCAGCGTTTGCGCATGTGACAATTTCACATCGCTTAAACCTTCCGCCATATTG
GTAATCGCAGAGACCGCAACGACTTTAAGGTCGCAATGGCGAGCTGAAATAACCTCAGGC
ACCACAGACATACCAACAACATCCCCACCAATAATTTGCATCATGCGAATTTCCGCCGCA
GTCTCGAAATTCGGCCCCGGATACGAGACGAACACGCCCTCCGTCAGAGGGAAACCCTCT
TCTTTCGCCACTTTTTGTAACAGTGCGCGGTATTCCGCATCGTAGGCATTTGCCAGTGAG
AAGAAGCGCTCTCCAAAACGATCATCGTTAAGACCCACCATCGGCGTACCGGGCATGGTG
TTGATATGATCTTTCAATGCGACCAGGCTGCCTGCCCCCACTTCCGGACGCAGCGAGCCT
GCCGCATTGGTGCAGAACAGTAGCTCGCAGCCCAGCAGCTTAAAGGTACGAATTGCGTCA
GTCATAATGGTCATTCCACGACCTTCGTAGAAATGTCCGCGACCTTTCATACATACCACC
GGTACGCCCTGGAGATGGCCCAGCACTAACTCCCCCGCATGACCATGTACCGTACTTACC
GGGAAGCCCGGCAGCTTTTCGTAGGAAATTGCGACAGCGTTCTCAATCTGATCGGCCAGC
GCGCCGAGCCCGGAACCTAAAATAAAGGCCACTCGTGGCGTGAAATCAGGTTTATAAGTC
TTGATAATATCTATGCAAAACAGCGGGTTATGAGAAAATTGAACCTGAGACATACATATC
CTTTTTCTGTAGGGTGGAATCTAACGCCTTTTTATAGCGAGGTTGTCCCGGCTCTTACCA
ATACACTTTTCTCACGCATTCAATAGCGATTCGATATCGATGGATTTATATCTTTTCTCT
ATTAATCCACGGTAAAAACTGTATTGGCGATATTAATTCCTTTGCATTAACAATATGTCG
TTTTTAGCAAACCACTTTATTAAGCAATCTACTAATAACGATCGGCATAGGGAATTATGC
TATGAAAAAACATCTTTTAACTCTGACACTTTCCTCTATATTAGCGATACCTGTTGTATC
TCATGCAGAATTTAAAGGCGGTTTTGCAGATATCGGCGTGCATTATCTGGACTGGACCAG
CCGGACTACCGAAAAATCGTCGACCAAATCACACAAAGATGATTTTGGTTATCTTGAATT
TGAAGGTGGCGCTAACTTTAGTTGGGGAGAAATGTACGGGTTCTTCGACTGGGAAAACTT
CTATAACGGTCGCCATAATAAACCAGGTAGCGAGCAGCGTTATACCTTTAAAAATACCAA
CCGTATTTACCTGGGTGACACCGGATTTAATCTCTACTTGCATGCGTATGGCACCTACGG
TTCTGCGAATCGCGTGAATTTCCACGACGATATGTTCCTGTACGGTATCGGCTACAATTT
CACCGGCAGCGGTTGGTGGTTCAAACCGTTCTTTGCTAAGCGTTATACAGATCAAACCTA
TTACACTGGCGACAACGGCTATGTCGCCGGCTGGGTTGCAGGTTACAACTTTATGCTGGG
CAGCGAGAAATTCACTCTTACCAACTGGAACGAGTACGAGTTTGACCGTGACGCTACCTA
TGCAGCGGGTAATGGCGGTAAAGAAGGGCTGAATGGCGCAGTTGCACTGTGGTGGAATGC
AACATCACACATTACTACGGGGATTCAGTATCGATATGCGGATGACAAACTGGGCGAAGA
TTTTTACCAGGATGCGATAATCTACTCCATCAAATTTAACTTCTGATTGATTACTGCCGG
GGCTCCCGGCAGTATGAATTCACTCTATATCTGATACAACGGATCCCCTTCCCGCCCAGC
CATTAGCGCATTGCCCTGGTCTCGTACCACGTCCCATAAAGCTTCAGCGGCGGTGGAAAG
TGAACGGTTCTTCCTGCGCACCAGCATCAACTGGCGTTCAACAACCGGCGTAATGCGCTT
TACCACCAGTGGGCTACCTTCAGGCAATGGTAGCGCCAGTGCGGGAAGAATACTGATGCC
GATGCCTGCGGCTACCATCGGGAACAGCGTCGCCGGATGTCCAATCTCCTGCACAATATT
CGCCTGAATACCATTGCGCGCCAGCGCTGCGTCAATCAGCGGTCGGCTGCCTGACGCGTA
ATCCTGCAACACCAATTTCGCTCCCTGTAATGCCTGCCAGGGTACATAATCTTCCACGGC
CAAAGCGCTATCGCGATGGCAAAGCAGAAAGAAAGGCTCGGAAAGAATCGCTTCACATTG
CAGATCGCCCACTGGGCCTGGATCGATGACGATGCCAAAATCGACATCTCCCTGGCGAAT
ACTTTCCATTACCCACTGCTGCGGACGATCGTGCAGGACAAACTGAATATCTGGATAGCG
GCGATGGCTTTCAGCAATGCATTGCGGAATAAGATGCGCGGAAATGGTCTGGCTGGCAGC
GACCCGAACTTTTCCGCTCAGTTGTTGCCCCATACGCCCGGTATCGCGCAACGTGCTGTT
CAGTTCATCCAGCAGTCGCTCAAGACGCAAAGCCAGCTGCTGCCCTGCATCTGTAAGCAC
CACTTCACGCGTGGTTCTGTCCAGCAGGCGAACACCAGTATGATTTTCCAGTTCCTTCAC
ACTGTGACTCACTGCCGACTGGCTCAGGCCGATACGCTCTCCTGCACGACTAAAACTTTT
CTCCTGCGCTACTGTGACGAAAACCTTTAATTGTTTTAAAGAATAATTCATCTGTTTTCT
TCATGAATGGATGCAATAAATCAATTTTATTTCTCAAACTGGAAGAAGCACAATAGAACC
ATCGATCATCTGGAGTCTTTATGAAACTTTTTCGTATCCTCGATCCTTTCACCTTAACCC
TGATCACGGTGGTGTTGCTGGCCTCTTTCTTTCCGGCCAGAGGCGATTTCGTCCCCTTCT
TTGAAAATCTGACCACCGCAGCTATTGCCCTGCTGTTCTTTATGCACGGCGCGAAGTTGT
CGCGTGAGGCGATTATTGCTGGCGGTGGTCACTGGCGACTGCATTTGTGGGTAATGTGCA
GCACCTTCGTGCTGTTTCCGATTCTGGGTGTACTGTTTGCCTGGTGGAAACCGGTAAATG
TCGACCCGATGCTCTACTCCGGTTTTCTCTACTTGTGCATTCTCCCGGCTACCGTGCAGT
CTGCAATCGCCTTCACGTCAATGGCGGGCGGTAACGTCGCGGCAGCGGTTTGTTCTGCGT
CGGCATCCAGCCTGCTGGGGATTTTCCTTTCACCATTGCTGGTTGGTCTGGTGATGAATG
TTCACGGTGCAGGGGGCAGCCTTGAGCAGGTCGGTAAAATTATGCTGCAACTGCTGCTGC
CGTTTGTGTTGGGGCATCTTTCCCGGCCGTGGATTGGTGACTGGGTGTCGCGCAATAAAA
AATGGATTGCGAAAACTGACCAGACGTCCATTCTGTTGGTGGTTTATACAGCGTTCAGCG
AAGCCGTCGTTAATGGTATCTGGCATAAAGTTGGCTGGGGATCATTGCTGTTTATCGTGG
TGGTCAGCTGCGTTCTTCTGGCTATCGTGATTGTAGTTAACGTCTTTATGGCACGCCGAC
TGAGCTTCAATAAGGCAGATGAAATTACTATCGTCTTTTGTGGTTCGAAAAAGAGTCTGG
CAAATGGCATCCCGATGGCAAACATTCTGTTCCCCACATCGGTGATCGGTATGATGGTGC
TGCCCCTGATGATTTTCCATCAGATCCAATTGATGGTCTGTGCGGTGCTGGCGCGTCGAT
ACAAACGCCAGACCGAACAGTTACAGGCGCAGCAGGAAAGCAGCGCCGATAAAGCTTAAA
GCGGACGCTTCAGGGGCTGGACCAGTTGCGTCAGCCCCTCGGTTTTAATCAGCAGCGTGA
TTTGCATTAGCTCACCGAGCTTCCCTGCCGGGAACTCATCTTTGCGGGCAAACCACAGCA
GATACTCCTCCGGCAGGTCGATTAAGCGACGCCCTTTGTATTTGCCAAACGGCATTATCG
TATTGGCTATTTCAATCAGCTGCTCTTTTTCCATCTCAGCTACCCAGCAAACGCAGCATT
TCCGCTTCGTCGATGACTTCAATGCCCAGTTCCTGCGCCTTCGCCAGTTTAGATCCTGCA
GCTTCACCCGCTATCACCAGATCGGTTTTCTTCGACACGCTGCCCGCGACTTTCGCGCCC
AGTTCGACCAGTCGAGCTTTAGCGTCATCACGCGACATCTGGCTTAAGCTGCCCGTAAGC
ACCACGGTTTTACCAGCAAACGGGCTGTCAATCTCTTCCGCGTTGATAACGATCGGCGCA
GGCCAGTGAACACCTTCCGCCAACAGCTCGCTGATGACATTGCGGTTGCTTTCTTCGGCA
AAGAAGTTGTGAACGTGGGATGCAACGACAATGCCAACATCAGGCACCTTTTGCAGCTCT
TCAATCGAAGCGGCTTCCAGCGCTTCCAGCGTGCCGAAATATGCCGCCAGACCTGCTGCG
GTGGCCTCGCCGACTTCACGGATGCCAAGTGCATAGAGGAAGCGAGCAAAGGTGGTTTCT
TTCGCTTTTTCCAGCGCGTTAACCACGTTTTGTGCCGATTTTGGCCCCATACGCTCCAGT
CCGGTCAGTTTGCCTGCGGTGAGTTTGAACAGATCTGCCGGAGTATGGACATATTCTTTT
TCAACCAGCTGATCGATGATTTTGTCGCCCATTCCGTCAACATCCATCGCACGGCGGGAA
ACAAAGTGTTTCAGCGACTCTTTACGCTGCGCACCGCAAATCAGGCCACCGGTACAGCGG
GCAACCGCTTCACCTTCCACACGCTCAACGTCAGAACCACATACCGGACAATGCGTCGGG
AATACAACCTCACGGGTATCTTCCGGGCGTTCAGAAAGCACGACGTTAACCACCTGCGGG
ATCACGTCGCCAGCGCGGCGAATCACCACTTTATCGCCAATGCGTAAACCAAGACGTTCG
ATTTCATCCGCATTGTGTAAGGTTGCGTTACTCACCAGCACGCCTGCAACATGGACAGGT
TCCAGACGCGCAACAGGCGTAATCGCGCCAGTACGCCCAACCTGAAACTCGACGTCACGC
ACAAAGGTCATCTGCTCCTGCGCCGGGAATTTAAACGCTACCGCCCAGCGCGGGGCACGC
GCGACAAAGCCAAGCTGCTCCTGCTGTGCCAGTGAGTTGACCTTAATCACCACGCCGTCG
ATATCAAAGCCCAGCGTCGGGCGGTCTTCTTCCACTTTGTGATAGAACGCCAGCACTTCT
TCCGCCGATTCACAAAGCGTTACCCGATCGCTGACCGGCAACCCCCACTTTTTAAATTGC
AGTAAACGGCCAAGATGAGTATCCGGCAGCTCGCCACCTTCCAGAACACCAACGCCATAG
CAGAAAAAAGTGAGCGGTCGCTTCGCTGTAATACGCGGATCAAGCTGACGCAGTGAACCA
GCTGCCGCATTACGTGGGTTAGCAAACACTTTCCCGCCCGTGCGTCGCGCATCTTCGTTA
ATCTTTTCGAACCCCGCCTGCGGCAGGAACACTTCACCACGCACTTCCAGACGCGCCGGG
ATATTCTCTCCGTGCAGCTTCAGCGGAATGGCGCGAATAGTACGCACATTAGACGTGATA
TCTTCCCCGGTGGTGCCATCGCCACGGGTCGCGGCACTGACTAAAACGCCATTTTCATAC
AGAATACTGACGGCAAGACCATCCAGCTTCAGCTCACAGCACCAGGTGACTTTCTCGTTG
TTTTTCAGACGGTCCTGCACACGTTTGTTGAAAGCAAGAAAGCTTTCTTCATCAAAAACG
TTATCCAGTGACAGCATTGGTACTTCATGGCGTATCTGGCTGAAAGCCGCCAGCGGCGCA
GCGCCTACACGTTGAGTAGGCGAATCAGGCGTAATCAGTTCTGGATGTTTGGTTTCCAGC
TCGCGCAGTTCGCGCATCAGCCTGTCGTATTCAGCGTCGGGAATTTCCGGCGCATCCATC
ACATGATAAAGATATTCATGATGGCGAAGCGTCGTTCGCAGTTCTGTCAGTTGTTGTTCG
ATTGATTCCATATCGCACCATCAATGCTAAAAACCCCCGACAAGCGGGGGTTCGAAGAGG
AGTTAATTTGCCTTAAGTGTATCAGGCGTTGGCGTCTTTGACTTCGCGGATGATGTCCTG
GTACTCGCGCAATTTCTGCGGAGTCATCATACGGCGCTGATCGTCAAGCACGACACCGCC
CACTTCATCGGCAATATGCTGCGCAGATTGCAGCATCAGCTTGAAGTTCTGCAGCTCGTC
ACCGTAAGACGGTACCTGCATAAAGATAGTGACACCCGGAGTAGTGAAATCCTTCATTTC
AGGATCAAAGGTTCCCGGTTTCACCATATTCGCCAGGCTGAATAACGCCGGGCCGCTGCC
ATCCGGGCTAAGATGACGATGGTAAATATTCATATCGCCAAAAATGAAGCCCGCTTGTTG
AATGCTGTTAAGAAGCAGTTCACCGTTTAGCTCGCTACCGTGATGCGCCGCGACGTTCAT
GATAATCACCGCTTCTTTGCGCTTCGGTTTATCCATAACTGGAGCAGGTTCCGCTACAGG
CTCAGGCTGTGGTGCCGCTACGGGTTCTGCAGGCTGGAAAGCCTGTTGTGCCGGTTGCGG
TGCTGAATGCACAGGCTGCGGCGCTGGCGCGACCTGTGGCGAAACTGGCTGCTGCAACGG
CTGTTCAGGCTGCGGCTGATAGGCAGGCTGCTGCACCGGCTGCGCTGGATGCGGAGCATG
TTGCGGCGGTACCTGCGCTTCAGGCGGCTGCTGGACCGGTTGACGCGGCTGCGCAGACGC
ATAAGGCGGTTGGTACTGGTGTTGCGGCGACGGACGAGCAGCCTCATGCTCCTGAGCGTT
AGCCGGGGCATGATTCACGCGGTGAACACGAACCTCACCAACGCCCTCATCATCTTCGAC
ATCCTCGTCATAAGAATCGTCGTCACGTTTTGACTTCATTCGTTTTAATGGCCGATCGCG
GAACATAGAAGATCGTTCTTTACGGCTGGTCCAGAAACCATGTACCAGTAAAGCGATTAT
GGCGATCGCGCCAACAATGATTAATATCAGACGCAAATCCTGCATCATTATATTCTCTGT
TGTTCTAACACCTTGCCACCACGGCAAACATTTACTCACTAAGAGTATTTGCCGATTACC
TCAAGTGCAAGTGCACTATTAACTTTCACAGCACAAAGATAGATGAAATCGTGCTTTTTG
CTGTTTTTTCGAACATATCCTAACTGTCCATTGCGCAATTACCCGGTAAAATACGCAGAA
TTTTCCTGGGATTGGTCAAAAGGAGCTCATCCTGATTATGGTTTCATCATTCACATCTGC
CCCACGCAGCGGTTTTTACTATTTTGCGCAAGGCTGGAAGCTCGTCTCGCAACCTGGGAT
TCGGCGTTTCGTTATTTTACCGCTGCTGGTCAATATTTTGTTGATGGGGGGCGCATTCTG
GTGGCTCTTTACACAGCTCGATGTCTGGATCCCGACTCTCATGAGTTACGTTCCGGACTG
GCTACAATGGCTGAGTTATCTGTTGTGGCCTCTGGCTGTCATCTCTGTGCTGTTAGTGTT
TGGCTATTTCTTCTCCACGATTGCTAACTGGATTGCCGCTCCGTTTAACGGTTTATTGGC
TGAACAACTGGAAGCACGATTGACTGGCGCTACACCGCCAGATACCGGGATTTTCGGTAT
CATGAAAGATGTGCCGCGAATCATGAAACGCGAATGGCAAAAATTTGCCTGGTATCTGCC
GCGCGCAATTGTATTACTAATTCTTTACTTCATCCCTGGTATTGGGCAAACCGTCGCGCC
GGTACTGTGGTTCCTGTTTAGCGCCTGGATGTTAGCCATCCAGTATTGCGATTACCCCTT
CGATAACCACAAAGTGCCGTTTAAAGAGATGCGCACCGCCCTGCGCACACGCAAAATCAC
CAATATGCAGTTTGGTGCTTTAACCAGCCTGTTTACGATGATCCCGCTGCTTAATCTGTT
CATCATGCCCGTTGCCGTTTGTGGCGCGACGGCGATGTGGGTCGATTGCTATCGCGATAA
ACACGCGATGTGGCGGTAACAATCTACCGGTTATTTTGTAAACCGTTTGTGTGAAACAGG
GGTGGCTTATGCCGCCCCTTATTCCATCTTGCATGTCATTATTTCCCTTCTGTATATAGA
TATGCTAAATCCTTACTTCCGCATATTCTCTGAGCGGGTATGCTACCTGTTGTATCCCAA
TTTCATACAGTTAAGGACAGGCCATGAGTAAGATTTTTGAAGATAACTCGCTGACTATCG
GTCACACGCCGCTGGTTCGCCTGAATCGCATCGGTAACGGACGCATTCTGGCGAAGGTGG
AATCTCGTAACCCCAGCTTCAGCGTTAAGTGCCGTATCGGTGCCAACATGATTTGGGATG
CCGAAAAGCGCGGCGTGCTGAAACCAGGCGTTGAACTGGTTGAACCGACCAGCGGTAATA
CCGGGATTGCACTGGCCTATGTAGCTGCCGCTCGCGGTTACAAACTCACCCTGACCATGC
CAGAAACCATGAGTATTGAACGCCGCAAGCTGCTGAAAGCGTTAGGTGCAAACCTGGTGC
TGACGGAAGGTGCTAAAGGCATGAAAGGCGCAATCCAAAAAGCAGAAGAAATTGTCGCCA
GCAATCCAGAGAAATACCTGCTGCTGCAACAATTCAGCAATCCGGCAAACCCTGAAATTC
ACGAAAAGACCACCGGTCCGGAGATATGGGAAGATACCGACGGTCAGGTTGATGTATTTA
TTGCTGGCGTTGGGACTGGCGGTACGCTGACTGGCGTCAGCCGCTACATTAAAGGCACCA
AAGGCAAGACCGATCTTATCTCTGTCGCCGTTGAGCCAACCGATTCTCCAGTTATCGCCC
AGGCGCTGGCAGGTGAAGAGATTAAACCTGGCCCGCATAAAATTCAGGGTATTGGCGCTG
GTTTTATCCCGGCTAACCTCGATCTCAAGCTGGTCGATAAAGTCATTGGCATCACCAATG
AAGAAGCGATTTCTACCGCGCGTCGTCTGATGGAAGAAGAAGGTATTCTTGCAGGTATCT
CTTCTGGAGCAGCTGTTGCCGCGGCGTTGAAACTACAAGAAGATGAAAGCTTTACCAACA
AGAATATTGTGGTTATTCTACCATCATCGGGTGAGCGTTATTTAAGCACCGCATTGTTTG
CCGATCTCTTCACTGAGAAAGAATTGCAACAGTAATGCCAGCTTGTTAAAAATGCGTAAA
AAAGCACCTTTTTAGGTGCTTTTTTGTGGCCTGCTTCAAACTTTCGCCCCTCCTGGCATT
GATTCAGCCTGTCGGAACTGGTATTTAACCAGACTAATTATTTTGATGCGCGAAATTAAT
CGTTACAGGAAAAGCCAAAGCTGAATCGATTTTATGATTTGGTTCAATTCTTCCTTTAGC
GGCATAATGTTTAATGACGTACGAAACGTCAGCGGTCAACACCCGCCAGCAATGGACTGT
ATTGCGCTCTTCGTGCGTCGCGTCTGTTAAAAACTGGCGCTAACAATACAGGCTAAAGTC
GAACCGCCAGGCTAGACTTTAGTTCCACAACACTAAACCTATAAGTTGGGGAAATACAAT
GTTCCAGCAAGAAGTTACCATTACCGCTCCGAACGGTCTGCACACCCGCCCTGCTGCCCA
GTTTGTAAAAGAAGCTAAGGGCTTCACTTCTGAAATTACTGTGACTTCCAACGGCAAAAG
CGCCAGCGCGAAAAGCCTGTTTAAACTGCAGACTCTGGGCCTGACTCAAGGTACCGTTGT
GACTATCTCCGCAGAAGGCGAAGACGAGCAGAAAGCGGTTGAACATCTGGTTAAACTGAT
GGCGGAACTCGAGTAATTTCCCGGGTTCTTTTAAAAATCAGTCACAAGTAAGGTAGGGTT
ATGATTTCAGGCATTTTAGCATCCCCGGGTATCGCTTTCGGTAAAGCTCTGCTTCTGAAA
GAAGACGAAATTGTCATTGACCGGAAAAAAATTTCTGCCGACCAGGTTGATCAGGAAGTT
GAACGTTTTCTGAGCGGTCGTGCCAAGGCATCAGCCCAGCTGGAAACGATCAAAACGAAA
GCTGGTGAAACGTTCGGTGAAGAAAAAGAAGCCATCTTTGAAGGGCATATTATGCTGCTC
GAAGATGAGGAGCTGGAGCAGGAAATCATAGCCCTGATTAAAGATAAGCACATGACAGCT
GACGCAGCTGCTCATGAAGTTATCGAAGGTCAGGCTTCTGCCCTGGAAGAGCTGGATGAT
GAATACCTGAAAGAACGTGCGGCTGACGTACGTGATATCGGTAAGCGCCTGCTGCGCAAC
ATCCTGGGCCTGAAGATTATCGACCTGAGCGCCATTCAGGATGAAGTCATTCTGGTTGCC
GCTGACCTGACGCCGTCCGAAACCGCACAGCTGAACCTGAAGAAGGTGCTGGGTTTCATC
ACCGACGCGGGTGGCCGTACTTCCCACACCTCTATCATGGCGCGTTCTCTGGAACTACCT
GCTATCGTGGGTACCGGTAGCGTCACCTCTCAGGTGAAAAATGACGACTATCTGATTCTG
GATGCCGTAAATAATCAGGTTTACGTCAATCCAACCAACGAAGTTATTGATAAAATGCGC
GCTGTTCAGGAGCAAGTGGCTTCTGAAAAAGCAGAGCTTGCTAAACTGAAAGATCTGCCA
GCTATTACGCTGGACGGTCACCAGGTAGAAGTATGCGCTAACATTGGTACGGTTCGTGAC
GTTGAAGGTGCAGAGCGTAACGGCGCTGAAGGCGTTGGTCTGTATCGTACTGAGTTCCTG
TTCATGGACCGCGACGCACTGCCCACTGAAGAAGAACAGTTTGCTGCTTACAAAGCAGTG
GCTGAAGCGTGTGGCTCGCAAGCGGTTATCGTTCGTACCATGGACATCGGCGGCGACAAA
GAGCTGCCATACATGAACTTCCCGAAAGAAGAGAACCCGTTCCTCGGCTGGCGCGCTATC
CGTATCGCGATGGATCGTAGAGAGATCCTGCGCGATCAGCTCCGCGCTATCCTGCGTGCC
TCGGCTTTCGGTAAATTGCGCATTATGTTCCCGATGATCATCTCTGTTGAAGAAGTGCGT
GCACTGCGCAAAGAGATCGAAATCTACAAACAGGAACTGCGCGACGAAGGTAAAGCGTTT
GACGAGTCAATTGAAATCGGCGTAATGGTGGAAACACCGGCTGCCGCAACAATTGCACGT
CATTTAGCCAAAGAAGTTGATTTCTTTAGTATCGGCACCAATGATTTAACGCAGTACACT
CTGGCAGTTGACCGTGGTAATGATATGATTTCACACCTTTACCAGCCAATGTCACCGTCC
GTGCTGAACTTGATCAAGCAAGTTATTGATGCTTCTCATGCTGAAGGCAAATGGACTGGC
ATGTGTGGTGAGCTTGCTGGCGATGAACGTGCTACACTTCTGTTGCTGGGGATGGGTCTG
GACGAATTCTCTATGAGCGCCATTTCTATCCCGCGCATTAAGAAGATTATCCGTAACACG
AACTTCGAAGATGCGAAGGTGTTAGCAGAGCAGGCTCTTGCTCAACCGACAACGGACGAG
TTAATGACGCTGGTTAACAAGTTCATTGAAGAAAAAACAATCTGCTAATCCACGAGATGC
GGCCCAATTTACTGCTTAGGAGAAGATCATGGGTTTGTTCGATAAACTGAAATCTCTGGT
TTCCGACGACAAGAAGGATACCGGAACTATTGAGATCATTGCTCCGCTCTCTGGCGAGAT
CGTCAATATCGAAGACGTGCCGGATGTCGTTTTTGCGGAAAAAATCGTTGGTGATGGTAT
TGCTATCAAACCAACGGGTAACAAAATGGTCGCGCCAGTAGACGGCACCATTGGTAAAAT
CTTTGAAACCAACCACGCATTCTCTATCGAATCTGATAGCGGCGTTGAACTGTTCGTCCA
CTTCGGTATCGACACCGTTGAACTGAAAGGCGAAGGCTTCAAGCGTATTGCTGAAGAAGG
TCAGCGCGTGAAAGTTGGCGATACTGTCATTGAATTTGATCTGCCGCTGCTGGAAGAGAA
AGCCAAGTCTACCCTGACTCCGGTTGTTATCTCCAACATGGACGAAATCAAAGAACTGAT
CAAACTGTCCGGTAGCGTAACCGTGGGTGAAACCCCGGTTATCCGCATCAAGAAGTAATT
CTTGCCGCAGTGAAAAATGGCGCCCATCGGCGCCATTTTTTTATGCTTCCGCCAGCGGCG
GCAAAATCAATTCATCGCTCTCATGCTGCTGGGTGTAGCGCATCACTTCCAGTACGCGCA
ACCCCGCTCGGTGCACTGCATCGGTTAACGCCTTCCCTTTCAGCAAGCCACTGATGAGCT
GAGCACAAAACAGGTCGCCAGTCCCTTTCAGGTCGGTTTTTACCCGTGAATGGGAAATGA
CATTCACGCTGTCGGCAGTGACCACCACAACCTGCATCTCCTGATTTTCTTCATTACCGG
AGGCGCTGGTAACCACCACCCATTTTAATGTGTCTGAAAGCAGACTTTTTGCGGCAGCAA
TGGCACTGTCGAGATCGCGGCAATTTTTACCGGTCAGGATTTCCAACTCAAAGATATTGG
GGGTAATTCCCTGCGCCAGCGGCAGTAAATATTGTCGATACGCTTCGGGAAGGTCAGGTT
TGACATAAATTCCGCTATCAATATCGCCAATCACCGGATCGACCATGATCAATAGGTCAG
GATGGTCTTTGCGTAGCGCAGTCAGCCACTCGGCAAGGATTTTGATTTGCGATGCCGTTC
CCATATAGCCCGTGGTTACAGCACGAAGTTGGCGCAGCGCATCACGCTCCTGAAGCGCAC
GCAAATAGCCGCTAAACCATTCGTCCGGAATCGCACCACCGTAGAAAGTGTCATAATGCG
GCGTATTGCTCAGCAATACCGTCGGCACGGCAAAGACATTCAGGCCGTTCTGTTTGATAG
CAGGCACGGCAATGCTGTTGCCCACGCTGCCGTAAACCACCTGCGACTGCACGGCGACGA
TATCCGCCTGCAGTGCCCTACTCTTATCGTTAAACAACAACAAACTACTCATTTAATTTT
TTCTCCTTGCCGATGATCCTCATCGTAATCCAACCGAAACTTTACCTGATTCTGGCAGTC
AAATCGGCTATCACAAAACAAGGATAAGGTAATTCAATGAAGAAAATCATTTGTCTGGTC
ATTACACTACTAATGACACTCCCCGTTTACGCGAAGTTAACTGCCCATGAAGAAGCCCGC
ATCAACGCCATGCTGGAGGGATTAGCACAGAAAAAGGATTTGATATTTGTGCGCAACGGT
GATGAACATACCTGCTATGAAGCGGTTTCTCATCTGCGTCTGAAGCTCGGCAATACCCGT
AACCGCATTGACACTGCCGAGCAGTTTATTGATAAGGTTGCTTCGTCGTCATCGATTACT
GGGAAGCCGTATATTGTGAAGATCCCCGGTAAGAGCGATGAGAACGCACAGCCTTTTTTA
CATGCGTTAATTGCGCAGACGGATAAAACGGTGCCTGCGGAAGGAAATTAATCCGCTTTG
GGAAGGCATTTACAGGAGGTAACATGAAAAAACGCTTTATTTATCACGATGAAAAATCGA
ATAAATTTTGGTGGATAGATTACGAAGGGGATAGTTTAGCTGTCAACTATGGCAAGGTAG
GTAGTATTGGTAAATTCCAGACAAAAGAGTTCGATAATGAAGAACAGTGTCTGAAAGAAG
CCAGTAAATTGATTGCCGCAAAAATGAAGAAAGGCTATCAAGAAGATCCAAAGTTTAACT
TCATGGATCGCTACTATTTTGATGATGAAGAAATTGGGTTACATGTTAAAACGTCACACC
CAAACTTCCAGTGCCATTTTACTGATCCACTTTATATGTGTTGCTGGGATGAAGAATCTC
CTTTTGGCAGCGATGAAGGTGCTGATGCTCTAAACGTTCTTGAAAATAGCCTCCGTAAAG
AGCCGGATCTGGACTGTGCTGATTTCCCTCAAATGTTAATTGAAACTATGTGGGGTATGA
AATACATCGCTATGGACAGTATTCTTGAAGAGGATGTTCGTGCGCAATTACTAGTCGATG
AAATGAGCACTATCCAGAGCAATATGATTACCTACGCAACTGCATTCGGTCAGATTAAAG
TCATGGGTAAAATCTCCCATAAACTTAAAAAGATGGGACTCAATGCACTAGCGCGTCATC
AGCTTACCGCAAAAATTCTTCAATGGGGTGACGGTCAGGACTCACCAATACTTCAAAAAA
TGATTGATGACCTTACGGCGTTTCCTCACGAAAATTAAATACTGCATTTGTCGGCAGCAA
CAACTGTTAAAAAAGTGCGCTTTGTTTATGCCGGATGCGGCGTAAACGCCTTATCCGGCC
TACAAAATCGTGCTAATTCAATATATTGCAGAAACCTTGTAGGCCTGATAAGCGTAGCGC
ATCAGGCAGTTTTGCGTTTGTCATCAGTCTCCGATGCTATTAATCCTTAAATCCCCGCCC
CCTGGCTAAAATGCTCTTCCCCAAACACCCCGGTAGAAAGGTAGCGATCGCCACGATCGC
AGATGATCGCCACCACCACCGCGTCAGGGTTAGCTTTTGCCACCCGCAGTGCTCCGGCAA
CCGCGCCGCCGGAGCTGACGCCACAGAATATTCCTTCCCGCACCGCCAGTTCGCGCATGG
TGTTTTCCGCATCGCGCTGATGAATATCCAGCACCTCATCCACCAGAGAAGCGTTGAAAA
TCCCCGGCAGATATTCCGTAGGCCAGCGGCGAATGCCGGGAATGCTGCTGCCCTCTTCCG
GTTGCAGGCCGACAATGGTCACCGGTTTGGATTGTTCGCGCATAAAGCGTGAGACGCCGG
TGATAGTGCCGGTCGTCCCCATGCTGGAGACAAAATGAGTGATGCGCCCGCCGGTTTGCT
GCCAGATTTCCGGCCCAGTGGTGGTGTAATGCGCATAAGGGTTATCGGGATTATTGAACT
GATCGAGCAGCTTTCCTTCGCCACGATTCGCCATCTCCAGCGCCAGATCGCGCGCACCTT
CCATGCCCTGCTCTTTGGTGACAAGAATCAGTTCCGCACCATAAGCACGCATCGCCGCAC
GGCGTTCCTGGCTCATGTTGTCGGGCATCAGCAATTTCATGCGATAGCCTTTCAGCGCGG
CAATCATTGCCAGCGCAATGCCGGTGTTACCACTGGTGGCTTCGATTAAGACATCACCCG
GTTTAATTTCCCCGCGCTTTTCCGCCTCGACGATCATCGAAAGTGCCGCACGATCTTTCA
CCGAACCTGCCGGGTTATTGCCTTCCAGTTTTAACCACACTTCACTGCCGTTATCCGGCC
CCATTCGCTGCAACTTCACCAGAGGCGTATTGCCTATTGTTTGTTCTAATGTACTCACGA
TCTCTATCCATACGTGGTGTTGCCTGATGCGACGCTTGCGCGTCTTATCAGGTCTACAGG
TTACAAACCTTGCCATTAAAAAGCCCGGATCGCGGGAAGCGCCTCCGGGCGTTTAACATT
CACTCAACCTATCAGGCGCTTTGTGCGAGAGCAAGTTCCTCATCGCGGGTTTCGATACGC
TCGTCGCCGTTATACAGCCGCGCATGTTGCAGACCAACGAATAAACGCTCGCCACGCTGC
GGGGCATCGTCGCCATGCATCACGACCGTCAGCGGTTCGTTGTACCACCCCAGCGGCTGC
ACCACTAATTGGGTGTAGTGACCTTTCGGGCTGGCTTCCAGTACCTGTACCGGCAGCGGC
GAATCGAGGCTGGTACGGCGGCTGATATCCACTTCCCAAGGGCGCAGGAAGAGATCCACC
GGCCCCTGATACGCAGGTGTGTAGCCCAGCGGCCAGCGATGCGCGCCAACATGGAACTGC
CCGCCGCGAATGGTTCCCTGCAGGCGGTTCACTTCGCCCATAAATTCGAGCACAAAACGG
GTCGCCGGTTCGCGCCATACCTGATCCGGCGCGTCAGCCTGTTCAATATTGCCCTGGCTC
ATCACAACTACACGATCAGCTACTTCGGTCGCTTCTTCCTGATCGTGGGTCACAAAAACG
CTGGTGAATTTTAGTTCTTCATGGAGTTGACGCAGCCAGCGACGCAGCTCTTTACGCACC
TGCGCATCCAGCGCGCCAAACGGTTCATCAAGCAGCAGAATTTGCGGTTCCACAGCCAGC
GCGCGCGCCAGCGCCACGCGCTGTTTCTGGCCGCCGGAAAGCTGCGCCGGATAACGATCC
GCCAGATGGGCAAGCTGGACCATTTCCAGCAATTTTGTCACTTTCGCTTTGATGGCTGCG
GCATTCGGGCGCTCGCGACGCGGCAGCACCGTCAGGCCAAAAGCGATATTGTCGAACACC
GTCATATGGCGGAACAGCGCGTAATGCTGGAACACGAAACCGACTTTACGATCACGTGCG
TGCAGGCGGCTCACGTCGGTGCCGTGGAAGCGAATATGCCCGCTGGTTTGATGCTCCAGC
CCGGCGATAATGCGCAGCAGCGTGGTTTTCCCGGAACCGGACGGCCCCAGCAACGCGACC
ATCTGACCTGAAGGAATATCCAGTGAGATATCGTTCAGCACCTGGGTGCGACCAAACGAC
TTCTTAATATTGGCAATCTCAATGCTCATGATGTTCCTCCTGCTGTGCGCGTTTTTCCTG
ATTCTCCAGGCGCCACTGCAACATACTTTTTAAAAACAGGGTGATAATCGCCATCAGCGT
TAACAGCGCCGCAGCGGTAAAGGAGCCGACGGTGTTGTAGTCCTGCTCCAGCAATTCAAT
CTGTAACGGCAGCGACAGGGTTTCGCCGCGAATCGAGCCGGAAACCACCGACACCGCGCC
AAACTCGCCAATTGCGCGGGCGTTGGTCAACACCACGCCATAAAGCAGCGCCCAGCGGAT
GTTCGGTAATGTGACGCGACGGAACATCTGCCAGCCGGACGCGCCAAGCAAAATCGCCGC
TTCGTCTTCCTGGCTGCCCTGGCTTAACATCACCGGCACCAGTTCGCGCACCACAAACGG
ACACGTCACGAAGATGGTGACCAGCACCATTCCCGGCCAGGAGAACATAATTTGCAGGTT
ATGCTCGTCGAGCCAACCGCCGAGCGGGCCGTTAGAGCCGTAGAACAGCAAATACACCAG
ACCGGCAACCACCGGCGATACGGCAAACGGAATGTCCAGTAGCGTCAGCAGTAACTGGCG
TCCAGGGAAGTTAAAGCGCGTCACCAGCCAGGCCAGCAGAATGCCGAACACCAGGTTTAC
CGGTACGGCAATCAGCGCGATCATCACCGTCAGCCAGATGGCGTGCAGCATGTCCGGATC
GGCCAGATTCTGTAAAACCGGCATCAGCCCCTTGCTGAATGCCTGCACGAAGATGTAAAT
CATCGGCACCAGCAGGATGAACGCCGAAACCAGCATCCCGATGCCAATCAGAAACCATTT
GCCCCAGTTAATCGGGCGCGCGTCATAACGCTTCAATTGGGTAACTTCCGCCATTAATGA
CCTACCACACGCCGACCAAAGCGACTTTGCAGAGTGTTAATTGAGAACAGCAGCAGCAGA
GATGCCGCGAGGATCACCGAAGCAATCGCGCTCGCTGCCGGGTAATCAAACTCCTGTAAG
CGCACAAAAATCATCAGCGACGTCACTTCCGTCTTCCACGCGATATTTCCGGCGATAAAA
ATCACCGCGCCAAATTCACCAAGACTACGGGTAAACGACAGCGCCACGCCCGCCACCAGC
GCCGGAGAAAGCTCCGGCAGCACCACTTTGCAGAAACTCTGCCAGCGCGTTGCACCAAGC
GTTTCCGCCGCTTCTTCATATTCCGGGCCTAACTCTTCCAGCACCGGCTGCACGGTACGC
ACCACAAACGGAATGCTGGTAAAGGCCATAGCCACCGCAATCCCCAGCCATGTATAGGTG
ACTTTGATATCAAACTTCGCCAGCCATTCACCGTAAAAACCGTTTACGGAAAAGAGCGAG
GCCAGCGTTAAACCGGCGACAGCCGTTGGCAGCGCAAAGGGTAAATCCATCAGCGCATCA
AGCAGCGTGCGGCCTGGGAAGCGATAGCGGGTTAGGATCCACGCCATCAGCAGACCGAAA
ACGCCGTTAAAAATCGATGCCACAAACGCCGACAGCAGCGTTACTTTGTAGGCCGCGACC
ACCTGCGGGTTGGTGATCACCTCCCAGTACTGCGCCCAGCTCATCTGGGCCAGTTGCATC
ACCAGCGCGGAGAGCGGCAGCAGCAAAATCAGGCACACAAACAGCAGACTGGTGCCGAGG
CTTAAGGTAAAGCCCGGCAGCACGCGTCTGGAGGAGACAGCAAACATCAGTTACGCCCCG
CCGCTAACAGCTTGTCTAACTCGCCGCCGCTGGTGAAGTGGGTTTTCATCACTTCCGGCC
AGGAGCCAAATTTGTCTTCCACGCGGAACAGCTCGGTCTGCGGGAATTTGTCTTTCAGTT
TGTCCATCACCTCCGGGTTATTCACGCGGTAGTAATAGTCGGTGATGATGGTTTGCGCCT
GCGGGCTATAGAGCCAGTTCAGATAGGCTTTGGCGGCTTTTTCCGTACCGTTGGCCTGCA
CGTTTTTATCAACCCACGCCACCGGGAATTCCGCCAGAATGTTGGTTTTCGGAATCACCA
CTTCAAAGCCCTGCGCTTCATACTGTTTACGGATGTTGTTCACTTCCGATTCGAAGCTAA
TCAGCACATCGCCCAGGCCGCGCTCGGCAAAAGTGGTGGTCGCGCCACGACCGCCAGTAT
CGAACACTTCAACGTTTTTCAGGAACTGGGTCATAAACTGTTCGGTTTTGCCTTTGTCAC
CACCGTCAGCTTTATCCGCTGCGCCCCATGCCGCCAGATAGGTATAACGCGCGTTACCCG
ACGTTTTCGGGTTCGGGAAAATCAGCTTCACGTCGGAGCGCACCAGGTCGTTCCAATCGT
GGATATTCTTCGGGTTACCCTTACGCACCAGGAAGCCCATGGTGGAGTAGAACGGCGAGC
TATTATTCGGCAGGCGCGACTGCCAGTCGGCCGGGATCAGCTTGCCTTTATCGTGCAGGA
TTTGTACGTCGGTCACCTGGTTATAAGTGACAACGTCGGCTTTTAAGCCCTGTAAAATCG
CCAGCGCCTGTTTTGATGACCCGGCATGAGATTGTTTTATCGTCAGTTTGTCGCCGCCGT
TATCTTTTGCCCATTGTTGCTCAAACGGCGGATTCAGGGCGGCAAACAGCTCGCGGGAGA
CGTCATAAGAACTGTTCAGCAGTTCCGTTGCCTGTACATGGCCCGCCAGCAGCAGAGAAG
CGACCAGCGCGAGTGAGTTCTTTTTCAGTAAGTTAACGGCCATTGCGCACCCTTATAAAT
TTAATGACTTTCTAATAGCCATCATATTTATAACGGACGTGAAAGGAGTAACGGTTTTAT
ATACCGTTTGGTGATTTGGAAGTTGAAAAGGGAATAAGAACTTGGTTCAACAGGCGTAAT
TGTTGCAGTCAGTTTGGACACGAACAGCGCGGAGAAACCGGAGCGTACACATAGTACGTG
AGGATTTCGAGCACTGCCCGGGGCCAAAATGACAAATAAAATAGCCTGGTGAACTTAGTT
CAAGACGAAATCCTCCCCACAAATGCAGGGAGGAAACAGAGGTGAATCAGATACCGACGC
TAACCGTCTCCGGCAGTGTGCTGCCGCCATCAATCACATTCTGTGTACCGGTTAAATAGC
TGGATTCATCCGATGCGAGGAAGGCCGCCAGTTCGCCGACTTCCAGCGGATCGGCGAGGC
GACGCATCGGGATTGCTTTCGCCATTTCAGTCAGCACCGACTCTGGATCTTCCGGGTTCG
ACTGGCGGGCAATGCTTTCCGCCATTGGTGTGCGCACGTATCCCGGGCAAATGGCGTTAA
CGCGAATACCAGACTGCGCGTACTCCACCGCCAGCGATTTTGTCAGGCCAACAATCGCCG
CTTTCGTTAAGGCGTACGCCGTTTCGCCAGGATCGGCCACCATATCACCAGTGACTGAAG
ACATCATCACAATGCGACCATCTTTGCGGGCAATCATCTCCGGCAGCACCGCCTTCGTGA
CGTTCCATACGCCTTTAATATTGATGTCAATATGGAAATCGCGATCGTCATCGCTCATAT
CGAGGAAACTGCCCAGACGACAAACGCCTGCGTTATTCACCAGGATATCAATGCGCCCTT
CTTTTTCCTTCGCGCGTTTGATAGCTGCGGCTACCGACGCCGGGTCACGCACATCGGCGA
CAACCGCCGTACAGCGATGACCACGACCACACAGTTCGTCCGCCAGCTTTTCGATCTCAG
GGGAGATATCCAGCAAGATTAGGTTCGCGCCATGACGTGCAAAAGTTCTGGCAATTCCTT
CGCCAATTCCCTGCAATGCGCCCGTAATCAGTGCTGTCTTGCCCGTGAGTTTACCCATTT
TAATGCTCTCCTTGTTAATACAGAGCGTTACACTCCATTCCCTCTGAAAATACAGGATAA
ACAAAATATTGCTGCGGATCAGCTCACTAATTCAGGAAAATCTCAATCCAGTCGCTGCTT
TATGCATCATTTCAGGCGTTGTGTTAGCTCACTGCTGCGCTGAATCATTTTCAATGACTC
CACATCATTGAGTTGCACAAGGCCAACAAACAGTAAATCGGTAACAGAATTTTGCGCCGT
GCGGGTAGACATCGACGAGCTACGCCATTCGGTTTCTCCGGAAACGGTATCGAGGGTGAA
ATGCGCCAGCCGCCGCAGCGGAGAGTCAGTCAGAGAAGTAATGGCAATCACCGTTGCCCC
CTGCTTTCGTGCCGCTTCTGCGCACAAGACAATCTCTTTTTTACTGCCGCTGTAAGAGAT
AGCGATTTGTACATCGCCTTTTTTCAACGCCTGAGAAACGGTGGCTTGTACGTGCGTGTC
GGCTTCGCAGGCCACGCGATAGCCAATTTTCATCAGTTTGAACGACAGATCGCGCCCCAC
CAGCGCCGATCCGCCCAGGCCCGTTATCTGGATAAACGGTGCTTTACTGATGACCTCAAT
GATTTTTTGCAGCCGCGCGTAATCGAGCAACGCGCAGGTTTGCTCCAGCGCCAGCTCTTT
TTCGCGATTCAGTTTGCGCGCGATCACTTCCAGCGAATCATCACTGGTAATCGAACTGTG
CAGGTGCAGTGCCGTGGCATTCGTTTTCTCCCGGCTGGCACTGTATTCGCCTATTAACGC
CATACGCAATTCAGTAAATCCTTGCGCGCCGAGTTTTTGGGCAAATTTCACTATGCTCGA
CTGGCTAATGCCGAGCTGTTTCGCCATCTGCCGTGAAGAAACGGATTGCAGCTCACTCAC
GTTGGCCTGCAGAAAGTCAGCGATTTTTTGCTCGTTTTCGGTGAATTCACTCCCCGCATT
GCTTATTTTCGTCAGGTACAACATCTTCCACTCTCCTGGGCTGGCAGCATAAATTCCGCT
TAAGTTCTTATGACGCTCTTCACACTCTGCGAGTGTAGACTCAATGATTCCTTTAAGCCT
GTCAATTCGGGATATATGATTCCATACATCTGCAATTATTTGATCGTAAATAGTAAGGTC
ACCACCGATGCAATTTGAAAAGATGATTACTGAAGGCTCGAACACCGCCTCGGCTGAAAT
TGACCGCGTATCGACGCTGGAAATGTGCCGGATTATCAACGATGAAGATAAAACCGTACC
GCTTGCCGTTGAGCGCGTACTGCCGGATATCGCCGCGGCGATCGATGTTATCCACGCCCA
GGTAAGCGGCGGCGGGCGTCTGATTTACCTCGGTGCGGGAACATCCGGTCGTCTGGGGAT
TCTGGATGCCAGCGAATGTCCGCCCACCTACGGCGTGAAACCGGGTCTGGTGGTTGGTTT
GATTGCTGGCGGCGAATATGCCATTCAGCACGCGGTGGAAGGCGCGGAAGATAGCCGGGA
AGGCGGTGTTAATGATCTGAAAAATATTAATTTAACGGCACAGGATGTGGTGGTTGGCAT
TGCTGCCAGCGGTCGCACGCCGTATGTGATTGCCGGACTGGAATACGCACGCCAGCTCGG
CTGCCGCACAGTGGGAATTTCCTGTAATCCGGGGAGCGCCGTTTCAACCACCGCTGAGTT
TGCCATTACACCGATTGTAGGTGCCGAAGTTGTTACCGGTTCTTCGCGGATGAAAGCAGG
TACAGCGCAGAAACTGGTGCTCAATATGCTTTCCACCGGGCTGATGATTAAATCCGGCAA
AGTGTTCGGCAACCTGATGGTCGATGTGGTCGCCACCAACGAAAAACTGCATGTGCGACA
GGTCAATATTGTTAAAAACGCCACCGGATGTAGCGCAGAGCAAGCGGAAGCGGCGTTAAT
TGCTTGCGAGCGCAACTGTAAAACGGCCATTGTGATGGTGCTGAAAAATCTCGATGCCGC
AGAAGCTAAAAAACGCCTGGATCAACACGGCGGCTTTATTCGTCAGGTTTTAGACAAGGA
ATAACCCATGGCCAAAGAGATCAGCAGTGAACTTCTGAACACCATTCTTACCCGTGTCGG
CGGACCGGGAAATATCGCCAGTTGTGGTAACTGTATGACGCGCCTGCGTCTGGGTGTACA
TGACAGTTCACTGGTTGATCCCAATATCAAAACGCTGGAAGGCGTGAAGGGCGTCATTTT
GACCAGCGACCAGGTGCAGGTCGTTTTTGGGCCTGGTAAAGCGCATCGTGCCGCAAAAGC
GATGAGCGAGCTGCTGGGAGAAGCACCGGTACAGGATGCCGCAGAAATCGCCGCCCAGAA
CAAACGTCAGTTAAAAGCCAAACAAACCTCCGGCGTGCAACAATTTCTCGCCAAATTCGC
CACCATCTTCACGCCGCTGATCCCCGGTTTTATTGCCGCCGGTCTGCTGCTGGGGATAGC
GACGTTAATTGCCACGGTGATGCACGTTCCGGCAGATGCTCAGGGAACACTACCCGATGC
GCTGAATTTTATGAAGGTGTTCAGCAAAGGTTTGTTCACTTTCCTGGTGATTCTGGTGGG
CTATAACGCCGCCCAGGCATTTGGCGGCACGGGCGTAAATGGCGCAATTATCGCCGCGCT
CTTTTTGCTCGGTTATAACCCCGCAGCGACCACCGGTTACTACGCCGGTTTTCACGATTT
CTTTGGTCTGCCCATCGATCCGCGCGGCAATATTATCGGCGTGCTGATTGCCGCGTGGGC
CTGCGCCCGCATTGAAGGCATGGTGCGCCGCTTTATGCCGGACGATCTCGACATGCTGCT
GACCTCGTTAATCACCCTGCTGATCACCGCTACGCTTGCGTACCTGATCATTATGCCGCT
GGGTGGCTGGTTATTCGAAGGTATGTCATGGCTGTTTATGCACCTGAACAGTAATCCGTT
CGGTTGTGCGGTTTTAGCCGGGCTGTTCCTGATCGCCGTGGTATTTGGCGTGCATCAGGG
CTTTATTCCTGTTTACCTCGCGTTAATGGACAGCCAGGGATTCAACAGCTTATTTCCCAT
CCTTTCAATGGCAGGCGCGGGCCAGGTGGGCGCGGCGCTGGCACTCTACTGGCGGGCGCA
ACCGCACAGTGCGCTACGCAGTCAGGTACGCGGGGCGATTATTCCCGGCCTGCTGGGCGT
TGGTGAACCGCTGATTTACGGTGTCACCCTGCCCCGCATGAAGCCGTTTGTTACCGCCTG
TTTAGGCGGCGCGGCGGGCGGTTTGTTTATCGGCCTGATAGCCTGGTGGGGTCTGCCGAT
GGGCTTAAACAGCGCCTTTGGGCCGTCTGGTCTGGTAGCGCTGCCGCTGATGACTTCCGC
ACAAGGCATCCTTCCGGCCATGGCGGTTTATGCTGGCGGGATTCTGGTGGCATGGGTTTG
CGGGTTTATTTTCACCACGCTCTTTGGCTGCCGTAACGTCAATCTGGACTGATATCATGA
AACGGACAATGCTCTATCTTTCTCTGCTGGCTGTTAGTTGTAGCGTCAGCGCCGCAAAAT
ACCCTGTTCTGACAGAAAGCTCGCCAGAGAAAGCAGGGTTTAACGTCGAACGGCTTAACC
AGATGGATCGCTGGATTAGCCAGCAAGTTGATGTCGGTTATCCCAGCGTAAACCTGCTGA
TCATTAAAGATAATCAGATTGTGTATCGCAAAGCCTGGGGAGCGGCGAAAAAGTACGATG
GCAGCGTGTTGATGGAACAGCCTGTCAAAGCCACCACCGGGACGCTGTATGACCTGGCCT
CAAACACCAAAATGTACGCCACGAACTTCGCCCTGCAAAAGCTGATGAGCGAAGGCAAAC
TGCATCCTGACGATCGGATTGCGAAATATATTCCGGGGTTTGCCGATAGTCCAAATGACA
CCATTAAAGGCAAAAACACCCTGCGGATTTCTGACCTGCTGCATCACAGCGGCGGTTTCC
CGGCAGATCCGCAATACCCGAATAAAGCGGTCGCGGGCGCGTTATATTCCCAGGATAAAG
GCCAGACGCTGGAGATGATCAAGCGCACGCCGCTGGAATATCAGCCCGGCAGCAAACATA
TCTACAGCGATGTCGATTATATGCTGCTTGGATTTATCGTCGAGTCGGTTACCGGTCAGC
CGCTTGACCGCTATGTTGAAGAGTCGATTTATCGCCCGCTCGGCCTGACACATACGGTAT
TTAACCCGCTGCTGAAAGGCTTTAAACCGCAACAAATTGCCGCCACGGAATTGAACGGCA
ATACCCGCGATGGCGTGATCCATTTCCCGAATATCCGCACCTCCACTCTCTGGGGTCAGG
TGCACGATGAAAAAGCCTTTTATTCGATGGGCGGCGTTTCCGGGCACGCAGGTTTGTTTT
CCAATACCGGCGATATTGCGGTGTTAATGCAAACGATGCTGAACGGCGGGGGCTATGGTG
ATGTGCAGCTGTTCAATGCGGAAACGGTGAAGATGTTCACCACCAGCTCTAAGGAAGATG
CCACTTTTGGCCTCGGCTGGCGCGTGAATGGTAATGCCACCATGACGCCGACGTTTGGCA
CGCTGGCAAGCCCGCAAACCTACGGTCACACTGGCTGGACCGGAACGGTGACCGTTATCG
ATCCGGTGAATCATATGACGATTGTGATGTTAAGCAACAAGCCACATTCGCCGGTTGCCG
ATCCGCAAAAGAATCCCAATATGTTCGAAAGCGGTCAGTTGCCGATTGCAACTTATGGTT
GGGTAGTTGATCAGGTGTATGCGGCGTTAAAGCAGAAGTAATAAAAAGGCCAGTCAGTAA
TGTTACTGGCTGGTCTGAGAGTGCTGACAAACGCAAAACTGCCTGATGCGCTACGCTTAT
CAGGCCTACGTGGAGCCCACAATATATTGAATTAGCACGATTTCGTAGGCCGGATAAGGC
GTTCACGCCGCATCCGGCGTGTACAACGCGCACTTGGTCAACAATCTGAGGCCAGTCAGT
AATGTTACTGCCTGGCCTTTAATCAATGAATCAGAAACGCTTACAGCGCCATCAACTTGT
CCAGCGACGGTGCGAAATAATAGCCGCCGGTTACCGGTTTGGTGAAACGCAACATCGCAT
CACGCTTACCATCGGTATCGCCAAACATGCTCAGCAGTTGCTGCTCAATGTTATGCAGAC
GCGCGCAGTAGGCGCAGAAGTACAGACCGTGAGTGCCACTGGCAGTGCCGTACGGCAGGC
TCTGGCGAACAATCTTCAGCCCTTTGCCATCTTCTTTCAGATCAACGCGGGTGAGGTGAG
AGGTTTCCGGACGTTCGTCGCCGTCGATCTCTTCGTTGGCCTCTTTGGTGCGCCCGATCA
CCATCTCCTGATCGTGAACGCTCATCCGGTTGAGCTGCTTCAGGTTGTGTTCCCAACGCT
GGACAAACACATAGCTGCCGCCCGCATCCACGCCGTCTTTGATAACCGCCACTTCGCGAC
GCGTCTCTTCACCCGCCGGGTTTTCCGTACCGTCAACAAAGCCGCTCAGGTCACGCTCTT
CAACCCAACGGAAGCCGTGGATCTCTTCTTTCACTTCAATGCAGTCACCAAAGGCTTCCA
TCGCCGCCTGGGCGACAGAGAAGTTTACGTCGTGACGCAGAGAAAGAATGTGGATCAACA
CATCGAACTGGGTCGTCGGCGCAAGGCCTTTACCGTAGCCCGGAAAATCTTTCAGCTCTT
CTGCCCCAACGCCGCCGCTCAGAGCGCGCCAGGTGTTGTTACCAAAGGCAACCACCGCAC
CAAGATGCGCGTCCGGGAATTTCGCTTCAAAAGTTGCCAGTTTGTCGGCAAATGTTTTAC
TGGCCGCACGCAGGGCGTCAACTTCCCCTTTCACGTTGGCTTCGATCCAAATCGCCGCGC
GGCAATGTTCTGGCAAAATGCCACTCTGAACCTGAGACATTGTTCCTCCTGAAAATAATA
ATGCCACGCAATCCGTGGCATTGTTGAGCGCTATTTTACGTGTTTTTTCGCGGCGGCGGT
TTGTTCAGACGCAAATTAACGCCGCCAGATAATTTTACTGACTTTCCAGTTTTTCAGGGT
ATCGTCCGAAGGCATTAACCCTTCAGGACCACGCCATTCCCCGCTGAACTGGTAGCTAAT
ATGTTGACTGCCTTCGGCTTTACATTCGACGGCACGATTATCATCACCATCAGCTTTTTG
GCAATTGCCAAATGCTTTGCTGTAAAGGTCGCTAAACGGTGTACCGATTTTAACACCGGT
GTCAGCAGGAATATCGCTATCCAGCACGTCAATGCGACTGATCGTGCCTTGATCGCCGTT
AATCACCATCGCCACGTTGTCGCCCTTCATCACTTCAAAAAAGCGCACCACGTTGCCGTT
CGCGGTTTTCATTCCGCTGCGCAGGCGATAATCGCCATCAAGCGCATCGGCAATGGCTTG
TTCTTGCAGTGGTGTGGACGCCGTTAATTCACCCACGCCCTGCTCGCTCACTTTGGTGGA
CGACCCAAACCAGTTCCACGGGTTAGCGGCAGACCAGTTAACTGACGACATCGTGGAACA
GCCGGTCAGCATCAATGGCATAGCGCATAACATTAAACGCAGCGATTTCATGTCACTTCC
TTTGGTTATTCAATAACGTTGCTTGGAGTGCAAATTCACCAAAAAGTGCCGTTATTCTTT
TACTTCATAAAAACAAGCGCGTAAACGTCGATTGGTCAGCAGCCAGATTAACGCCACAAT
ATCCGCCACTACCAGCGCCAGACCGATACCGCTAACGGATTCACCGTTCAGCCACAGCCA
CGGTTGCCAGCAAAGTAAAACCACCTGCGCCAACAGCAACAGAAAATAGAGTACACGCCA
GGTGCGAGGAAACGTAGCCCGCCGACCGCTCAACAAAAACGCCAGCACCGCCGGAATGCC
AGGAATCAGCCCCAGCCAGAAATTATCGTGATCGGGATAAAACAGATTTAGCAGCGCAGT
ACCCTGCTCGCGCGACGCACCGGCAATGACAAACAGCACCCAGGTTCGCGCCTGAAGCAA
TAGCACAAGCCAGAAGAGCAAGGGTAAACGCAGGCGACCGTGCGCATCATAATGGACAGG
ATGAAACTCAGTACTCTTCATCTTCAATCAAACGCTTACCCAGACTCAGCACGTCGGCGT
GTTCATATCCCAGGCGTTCATACATTCCGAGCACCATGTCGTTATCTTCCGGCACATTGA
TCTGAATTTTCGGGCAGCCACGAGCAATCAGCTTTTTCTCCAGCCGATTAAGCAACGCAT
TGGCAATCCCACGCCCACGAAACTCTGGATGCACGCCAAGATAATAAGCAGACCCGCGAT
GCCCGTCATAACCGCCCATCACCGTTCCGACCACGTCACCGTTTACCTCAGCGACCAAAA
ACAAACTGACGTCATGGTTCATCTTACGCTCGATGTCCATTTCCGGATCGTTCCACGGAC
GCAGCAAGTCGCAACGCTCCCAAAGGGTGATGACCTCTTCGAAATCTTCCTGGCGAAATA
CGCGTATCTCCATGGTATTCGTTACCTTTTTGCGGGTTAAAAGGCTGATTATGGCGTGAA
CGGTCGAATTAGCCAATATCTGACGAAAATCGGTTGAAAAAGTGGCATAATGGGGAGTTG
TCAACTATTGAAATGAAAAGTAAAACAATTCTCAACAGCAAACCGTCGTAACGGATTACG
CGATACGATATAACATCTGGAACTTTATTATTACAACTCAGGCCGTATGAGCACTTTTAA
ACCACTAAAAACACTCACTTCGCGCCGCCAGGTGCTGAAAGCCGGTTTGGCTGCCCTGAC
GTTGTCAGGAATGTCGCAAGCCATCGCCAAAGACGAACTTTTAAAAACCAGCAACGGACA
CAGCAAGCCGAAAGCCAAAAAATCTGGCGGCAAACGTGTCGTTGTTCTCGATCCAGGTCA
CGGCGGAATTGATACCGGAGCGATCGGACGCAACGGTTCGAAAGAAAAACATGTGGTGCT
GGCGATTGCTAAAAACGTCCGTTCCATTTTGCGTAATCATGGGATTGATGCGCGTTTAAC
GCGTTCTGGCGATACGTTTATCCCACTTTACGATCGCGTTGAAATCGCCCATAAACATGG
CGCAGATCTGTTTATGTCAATTCATGCCGATGGCTTTACCAACCCGAAAGCTGCCGGTGC
TTCGGTATTTGCCCTCTCTAACCGTGGGGCAAGTAGCGCAATGGCGAAATACCTGTCTGA
ACGCGAAAACCGCGCCGATGAAGTTGCCGGTAAAAAGGCGACTGACAAGGATCACCTATT
GCAACAAGTGCTGTTTGATCTGGTGCAAACAGATACCATTAAAAATAGTCTGACGCTCGG
CTCGCATATTCTGAAGAAGATTAAGCCGGTGCATAAACTGCACAGCCGCAACACCGAACA
AGCGGCATTTGTGGTGTTGAAATCACCGTCGGTTCCTTCGGTGCTGGTGGAAACCTCGTT
TATCACCAACCCGGAAGAAGAACGGCTGTTAGGCACGGCGGCGTTTCGTCAGAAAATCGC
CACAGCGATTGCTGAAGGCGTGATCAGTTATTTCCACTGGTTCGACAACCAGAAAGCACA
TTCGAAAAAGCGATAAGTTATGAAACCCGACGCACACCAGGTTAAACAGTTTCTGCTCAA
CCTTCAGGATACGATTTGTCAGCAGCTGACCGCCGTCGATGGCGCAGAATTTGTCGAAGA
TAGTTGGCAGCGCGAAGCTGGCGGCGGCGGGCGTAGTCGGGTGTTGCGTAATGGTGGTGT
TTTCGAACAGGCAGGCGTCAACTTTTCGCATGTCCACGGTGAGGCGATGCCTGCTTCCGC
CACCGCTCATCGCCCGGAACTTGCCGGGCGCAGTTTCGAGGCGATGGGCGTTTCACTGGT
AGTGCATCCGCATAACCCGTATGTTCCCACCAGCCACGCGAATGTGCGGTTTTTTATTGC
CGAAAAACCGGGTGCCGATCCCGTCTGGTGGTTTGGCGGTGGCTTCGACTTAACCCCATT
CTATGGTTTTGAAGAAGATGCTATTCACTGGCATCGCACCGCCCGTGACCTGTGCCTGCC
ATTTGGCGAAGACGTTTATCCCCGTTACAAAAAGTGGTGCGACGAATACTTCTACCTCAA
ACATCGCAACGAACAGCGCGGTATTGGCGGGCTGTTCTTTGATGACCTGAACACGCCAGA
TTTCGACCGCTGTTTTGCCTTTATGCAGGCGGTAGGCAAAGGCTACACCGACGCTTATTT
ACCAATTGTCGAGCGACGGAAAGCGATGGCCTACGGCGAGCGCGAGCGCAATTTCCAGTT
ATATCGTCGCGGTCGTTATGTCGAGTTCAATCTGGTCTGGGATCGCGGCACGCTGTTTGG
CCTGCAAACTGGCGGGCGCACCGAGTCTATCCTGATGTCAATGCCGCCACTGGTACGCTG
GGAATATGATTATCAGCCAAAAGATGGCAGCCCAGAAGCGGCGTTAAGTGAGTTTATTAA
GGTCAGGGATTGGGTGTAACTCCCTCACCCCCACTCCCGCATCCGCTGATGCAGCGTCAG
TGACGGCTTCTCGGAAAACAGCTGCTGGTAATCCGTGGCAAATTGCCCCAGATGCCAGAA
TCCCCACTGCATGGCGGCGTCTTTTACCGTCATACTTTGCGACCACGGACTTATCAGTTC
GCGGCGTACGGCGTTCAGGCGAATGCGTTTCAGCCACGCGTTCGGGCCAATGCCTAAAAT
AGCGTGAAACGCGTTTTGTAGCGTGCGGCGGCTGACATGCAGTTGATTACACAAATCCAG
CACCGTCACCGGTTCGGACATGTTTTCCAGCACATATTCACGGGCGCGGGAAAGCAATCG
ACGGTAACTCTGATGACTGATGCTTTCCGCCGTCACCATTGGTTGCGCTTCTTCCAGCAT
GGCCCCCATCGCCATTAGCAAATTATCCCCCAGCACTTTTCGCACTGCAGGCTGATGGAG
ATTTTCCGGATTCTCGCAAAACGTCGCCAGCGCCTGTTGGACAAAGCCCCACAGCGCGGC
TTTATGCTGCTCTTTCACTTCCAGCGCCGACTGGTTACGCAACATATGTAATACCCGATC
CGGGTTATGCAAAAAGTTAGCCTGCCGGGTGATGACATCTTCAGAAAGCACCACGCCCAG
GATCGTGTAATCATCCGGCGTGCTCAGTTCAAATTCAGTGCCACCAGGGCGGGTGGCGAT
TTCCGCGCTTCCCAGACATTGCGAACCGATAAATCCCTGCTCACCGCGCGTCGCCGGAAT
GCCAAACCAGAACGAGTTCGGCCAGACCAGGCACGACTGACGCAGCGCCAGACCGGTGTA
TTCACGAAAAACCTGAATATCATCGAGTAGAATTTCCGTAAATTCACCATGAAACTTGCC
CGGATGCAGCTGATCGTAAATCTGCTGCCAGGCGGTAATCGTTAAAGCATGTTCATAGAC
ATCCGTTGTCTGTCGTTGATGAACATTATCCACTTCGACCTTCGGCGTGAGCTTCAGGTT
TTCGGGTAAGGGTTCATGATAAAGATGGTGCAAATTGGCTGTACGGGTCTTTTTCATGAT
GTTAATGCCGGGTGTTGTAGGACACCCGGCACCTCCGACAGGTTAATGGGGCTTGAGACG
ATAACGACTACTGCGTTTACGTAACGTCCCGGCAGAAAAGAGCTGTTCGAGCGCATTTCT
GGCTTTTTCCAGCGGCCAGCCAAAGTGGGCAGCCACTTCTCCTGCCGTCATTCCCTGACG
TACTGATGTTAACAGCGCCAACAACTCGTCAGCAGATTCCGCGACGATAACTGGCGCGTC
GGGTTCCCTTACGGGTTGCTTCGGCTGGCGGTTAAAGCCAGTAACCAGCCACTGGGTGTC
ATCGTCTGGCCGACCGATCTCCTTGCGGCTGATGACACGCCCGGTACGCATCGCGGCAGC
ACAACCTGCGTCCAGCGCCGCACGACACGCCGCCAGATCGCCTTCCACCACCAGCGTTAA
GCGACCAGGGTCAAGCACTTCGTGACTGAGCAGACGAACGTTAGCTGCTTTGAGCATGGC
ATCCGCTGCATCTATCGCGGCGACCATGCCGTCCACTTCCAGCAATCCCAGTGCATTGAT
CATCGGCAACCTCCGTTACGCACGCTGGATTGGATTACGCGCGATTTCCAGCACTGCATC
GGTAAAGGCGTTACAGGCTGCTTTACACGCTGCCTGGCTACCGGTTAAAAATGCTGCCGA
GTAGTTGGTTTCAGACGGTGGCGGGACATAGGTCGCCAGCTGTACGTCGGCAGACTTCAG
GGCTGCATCAATGCCATAGGTCGCTTCCAGCGGCGGTGCCACCAGATACGCCATCGGATC
GCCAAGCGTGATCCCGGCGGTTGATGAGAGATAAGAACCGGTACGCGAAACTACATGTGC
CAGGAATGCCGTATCTTGCGCGTCATTAGCCCACTGGAAAGCTGCGCCATTTTCAATATG
CGCAATCATCGCATCCAGACCTGCACGCACTTCCGCCGGGTTTGGCCCACCAAGCATAAT
CAGCACTTCACCGGCAGTCGGTGACGGGCCGTGTGCAGCGCCCGCATATAGCGAGCGGCC
ATACACCACTTCCACCATCGCCTGCTTGGTCGCTTCATCAGCGGCAATGTAGGTGACGTC
ATCGGAGTCGGCAGAAATCAGACCGAGGCTACGAATATGCGGCGGCAATTTCAGTTCACG
CGCAAAATCGGCGTTAACGGAGGCAATCACCCGCATAGCGGTGACAGACGGTCGAATCAA
ATCTAAAGCTGGCATGATGCCTCCTTATCGGGTCATGTTGATGCCGGATGCTTTCTGCTC
CAGCATACGTTTCGCCAAATCCACAATGACGGCTGCGGCTTCAACCGGCGGCGTGCCGCC
CTGGTGAATGTTAGAGATACAGGTGCGATCGGCCTCAACGGTGGTCGCCATACGCGGCGA
GTAAACGGCGTAGCAGGAGAGGCTTTCTGACTGACCCAACCCCGGACGTTCGCCCACCAG
CAGGATCACTACTTTCGCGCCGAGGATCTCACCGATCTGATCTTCAATCTTCACGCGACC
ATAACGAACAAAGAATGGTGTACCGACTTTCAGCCCGGCCTGTTTCAGGCCCGCCATCAG
CGGTGGCAGGATCTCTTCGTAGTTCACGGTGATCGCATCAGTTGACAGGCCATCAGAAAT
AACGACCTGTACGTCCGGATTGGCAACACACTGCGCTTTCAGCGCTTCAACAGCTTCTGC
ACACAGGCGGCGGCCCATATCCGGGCGAGTCAGGTAGAGATTTTTGTCGCTAATTTCAGA
GCGTACTTCCAGCAAGCCCTGCGCTTTCACCCACTCTTCCGGCACTTCTTTCAGTACGGT
ATCTTTCGAACGAGAGTGATCGGCCAGGAAACGCAGCAGCGCCTGCGTACGTGGACGCGG
ACCGGCACGACCGGTACAAACGCGGGCCACGGTGCTGCGGCGCAGTTCTGTTAATACGTC
TGCGCGATGCGGATTTTCAACACCAATCCACGCTTTTGCTTCAGCGGAACCTAAATCCAG
CGCACAGCTTTCCGAGGTCACCGGTGCCGCACAGTTGGTGGTGGCGCACTTTGCTTCTGA
CGGCGCGGGGGCCGCTTGTCCCATTGACGCCATCACGCTGCGTACAATTTCTTCAATCTG
TTTTTGATCCATGATATGTTATCTCCGCGTCATCAGAAGAACAGTGACGGATCGCCCGCC
CGTTTGGTCAGGCGACCGTTTGCCATAATGCCCATGCTTTCCAGCCAGCGTTCAAACTCC
GGTGACGGGCGCAGGTTGAGTAACTGACGCACAGTGGCGGTATCGTGGAATGCGGTGGTC
TGGTAGTTGAGCATGATGTCATCACCCAGCGGCATCCCCATGATGTAGTTGCAGCCTGCG
GTGGCGAGCAGGATCATCAGGTTTTCGTTGAGGTTCTGGTCAGCGTCAGCGTGGTTGGTA
TAACAGCAGTCACAGCCCATAGAGATGCCGCTCAGCTTGCCCATAAAGTGATCTTCTAAG
CCAGCACGGATAATCTGGCGGTCGTTGTAGAGATACTCCGGCCCAATAAAGCCGACCACG
GTGTTGACGATAAACGGATCGTAATGACGCGCCAGCCCGTAGTTACGTGCTTCCATCGTT
ACCTGGTCTGCGCCGAAGTTAGCGCCAGCGGATAGCGCAGAGCCTTGTCCGGTTTCGAAG
TAGAGGCAGTTTTCCCCGGCGATACGGTTGAACTCCGCGCCCACTGCGCGCGCTTCGTCG
AGCATCGCCAGCTCCACGCCAAACTCTTTCAGCCCTTTTTCGCTGCCACAGATACTCTGG
AAAATCAGCCCGCCCGGTGCGCCACGACGGATCGCTTCGATCTGGGTGGTGACGTGCGCC
AGTACACAGCCCTGAGTTGGGATGTTGAATTTGTCGATCACGCCATAGATGGTATCCAAC
ACGCGGCTTAAGTTTTCCACGTCGTCAGTCACCGGGTTAACGCCGATCACCGCATCGCCC
ACCCCGAAGGAAAGCCCTTCGTAGATTTGCGCGGCGATACTTTGCACGTCGTCACGGGTG
TCATTTGGCTGCAAACGGGCGCTAAAGGTGCCCGGAATACCGATGGTGGTATTGGCCTTT
TTGATTACCGGCATTTTCTTCGCGCCGTAGATCAGGTCCGCGTTGGAGCAAATCTTCGCT
ACCGCCGCGACCACTTCCGAGGTCAGCCCTTTGCGGGTAAAGGCAATGTCGTCCACGCTG
GTTTCATCGCTCAGCACATACTCACGCAGTTCGCTGATGCTCCAGTTTTTAATCTGGTTG
TAGGCCGTTTCGTTAACATCGTCCTGAATCAGCCGCGTCACGCAGTCATCTTCATAGGCA
ATCACCGGATTATTGCGGATGTCCGCTACGGTCATTTCCGACAACACCTGCTTTGCCGCC
ACGCGCTCCTGTGAGCTTGCCGCTGCGACGCCCGCCAGCACATCCCCCGAACGCAGTTCG
TTGGCTTTAGCCAGCACCTCTTTTACATCCTTAAACTGATATACATTGCCGAACAATGTG
GTCTTTAGTTTCATAAGTCGTTCCCTCAGGAAGAATCGATGATTGGCATTTTTCACAGCA
TTCTAACAATCACGTTTCATCGTCAGCCCTTGTCGTGTAAGGTGGTTGCCTAAACACGCC
CGTTATTCATCACGCCGAACGCGCCGGATACATGATCGGGGTTATCCAGTCGTTAAATCA
AGGTATCCGGTTTTGAGCAAGACACCACTCACAGCAAAGGCCATAGACGCCGCACAGCCG
CAGGACAAGCCCTATAAACTCACCGATTCACTGACGCCGGGGCTGTTTTTGCTGGTGCAT
CCCAACGGTTCGAAATACTGGCGATTCAGGTATTGGCTGAATAAACGAGAGTTTTTGCAG
GCCATTGGAGTTTACCCGCTAATCACACTCAAAGAAGCACGCAGGCGCGCCACGGAGAGC
AGATCCCTTATTGCCAATGGAATTAACCCAGTGGAACAAGCCCGCAAGGAAAAAGCCATT
GATGCGCTCAACATGGCGGCAGGATTTAAGAAGGTGGCGGAAGACTGGTTTGCTACCAGG
GTTGGAGGGTGGTCGGAATCCTATGCAAAACAGGTCAGATCGGCACTAGAAAAAGACGTC
TATCCGGTACTTGGCAAGCGGTCGATTGTCGATATAACCGCCCGTGACGTGCTGGCATTA
CTCCAGAAGAAAGAACGTACCGCACCGGAGCAGGCCCGCAAGCTACGCCGGCGCATCGGT
GAGATCTTCAAGTTTGCCGTTATCACCGAACTGGTAACGAGGAATCCGGTTGCAGATCTT
GATACGGCACTGAAGGCCCGCCGACCTGGTCACAACGCGTGGATACCGATTAGTGAAATT
CCGGCCTTCTACAAAGCCCTTGAGAGGGCCGGGAGCGTCCAGATTCAGACGGCAATACGT
TTGCTTATATTAACGGCATTAAGGACCGCAGAACTGCGTTTGTGCCGTTGGGAATGGATA
AACCTGGAGGACGCAACAATCACATTGCCCGCTGAAGTCATGAAGGCCCGCCGCCCGCAT
GTGGTCCCGCTATCACGGCAGGCGGTCGAGCTATTGCAGGACCAGTTCACACGCAGCGGA
TACAGTGCTTTCGTCTTTCCAGGCCGATTCATGGATAAACCCTTGTCAGCCAGCGCGATA
CTTAAAGCGCTTGAGCGTATCGGGTACAAGTCGATAGCCACAGGCCACGGCTGGCGCACA
ACGTTCAGCACCGCACTTAACGAATCAGGCAGATACTCGCCGGATTGGATTGAGATCCAA
CTAGCCCACGTCCCGAAGGGAATAAGGGGCGTTTATAACCAGGCTGCCTACCTGAAGCAA
CGGCGAGCAATGATGCAGGATTACGCCGACGCTATTGATTCAATATTGGCAGGTAACGGC
AATCCTCTAGAACCGGAATGAATAATTAAGCGGCTTTTTTGCAAAGCGCAATTTTGCATT
TTGTATAAGTATTTGTTTTGTGTGGTTTAACTATCACCTGATAAGAAACCTGTATTCAAT
TTGCCGGATTCGTCCGGCTTTTCTTTTTCGCTAATTATTCCATTATTCCAATTAAGTGGA
ATAAATTATTCAATATCAAGAACTTAAATCCATGTTTGCAACGAAAGATCCAGAGTTCGA
AAATAGGATCAACACAAATAAAAGCCCCCGGAATGCTGCAACATGCCGGGGGCGGTATGA
GAAACAAGCTAAAGGAGAATTTCTCATGTCTGATATGCTAGCAGTAGAACAAGAAACAAA
CAATGATGTTCGTCAATTTTTAAACAAAATTAACGAGTTACGGAATAAAGCACCCAAAAA
CGAAGAGACTAAACACGAAGAACACACGCCAGATAATCACGAGGAAACAGATCATCACGA
GGCAAAACAGCAGGAGCAAGCCTGGCGTGGCAACCTGCGCTACCTGGACACATTAAACCG
ACTTGATGAAGTATTGCCCCGCAAACTGTACGAAAGATGGGAGAAAGAACATACAGTCAA
CGACGAGGCTGTGCTACGTGCTCTTTGTTACTTCGCTGGTACTGGCAAAAACTCACAGTT
GGGATGGTGCAGGGTTGGTAGGGGAACAATCGACAAACGAGCCAGGCTATCAAAAAACAC
GGTTAAAAAATGCCTCGATCGTCTGGTCAACCACTTCAAACTTGTTGAGCGTACTGAAGG
CTATATACCAGGATCGGCAGAAAGGGAGTGCAACGAATACCAGTTATTATTCAAGCCGTA
CAACATGAAATAACGGAATCAGGCGGGCAATGTTCCCGCCTTTTCTTTGCCTTAATTCCA
TGAATTCAGGTGGGTCAAAAGTTGCCGTTAGTGGTGGGTCAAAAGTTGCCGTTAAGGTGG
GTCAAAAGTTGCCGTTAAGGTGGGTCAAAAGTTGCCGAGTAAGAATTCTACTATTAAGAA
TTCTAGGCGACGGGAGTTTTTTAGCCTCCCGGTCGGTCATAGAGAGTCGCCTAGAGTTAA
ACAGAAGAATTATTTCGCCGCCTGATAGGTCGGCTGGTTGCGAGCATTAACCATGCTGAT
TAGCGCAATCATTTCCAGCAAGCTGGAAACGCCCATTCACTCACGCACAACCTGAACAGC
AGACCAACAAACCATCATGGCATTCGTTCATGGGGAGCGCGGTATATCTCAAAGGGTGAT
TTCTTATTGGTGGGCCTTCGGAAGGCTTCGAGCAATTGCCAGCTTAAAAGACGGGCTTAG
CAGTGATGGTTATCCGCCACGAATGTCCGTCATATTGCATTGCGCAGAAACGCGTGGCAC
TGAGGGAGTTTTCCGAATTAGTTTTGGGGACCCTTTCCCTGCTTCTGGAGCAAAAGACGA
ACGGCAAATGCAGTGCTTCCTTGTACGACTGCAGCGAAGAAGAAAAGCTGTTTGTTAAGC
GCCTGAAGTTAATCAAAGCGGATATCCACGCCCAGCTGAAGGCCTGTGATTGCGATATTT
CTGAATGACAGGTGGAATCATGAAACACGTTTTTAAATATCTTGATTTTGCAGAAGACCG
CGAACACGCAGAATCAGTGGCGACCAAAGAGTTAAAACTGGACCACGTAGAAAAATTCGC
TATCCGCGATCTAGCCAATGATATCAAAGAGCGTGGGTGTGTTGAGCTTGTCCAGCCTGG
TGGATTCGATGAGCTGGTTCAGATCTATGAGGCCGGAGGCGATGGAATAGAGCCACTCAA
TTGTGGAATCGAATCAAGGAAGGTGGCAATTGCTGCCCTGCTTCGCGTCATGCGTGAACC
AGACTTTCAATGCCTGGAAATGGTTCACGAAATCATAAGAATTGCTAGAGATTTGGAAGC
GCCAGTTGACGCTCCGTTAGATTGCTAACGCCAAAATTAGCGCTGAATTAATGGGTAATT
ATTGCGGTTTTTGTCAATTTTCAACCTCAATTCTTGCGAAAAATGGCAAAAATAACGGTA
TTTTTCATCATTTATTGGGGGTTTTATGGAAGGCGAACTGATAGAAAACAATGGGTTAGA
CATTTATGACACCAGCGAAACACCGAAAAAGCGCGGTCGGCCAGCTAAATATAATGAAAA
AATAGCAACGCAAATCGTCCTATTGGTAAGCGAAGGTTATAGTTTGCGCAAGATCAGCAT
GATGCCAGGGATGCCGAGCCACCGTCAGATGATGCGCTGGCAACTGGAGCATATGGACTT
CAGGGAAGGGATAGCCTGGATGTCGTGGCTATGGTGCGCTGAAGCTGGCCGACGTGCCGT
CGAGATAATCGACGAGGTTGATATAAACGCAGAGGATGGGCCGAAGCAGTTGCGCAAAGC
AGAAGCAAAGGCAAAGGCACTACTGGCAGCAGCCAAGCTGAATAGTTTGAAACATTCACC
ATTTGGAGATGACAAACAATGAGCCTGATCCGCACTGAAACCAGAGACACAAAACGCGCA
GCTGACCCACTGCACGACCTGCGTAGCAAGCCGTTTTCTGAGTGGGGCGAAGATGAAATC
AGGCGTTTTAATCTGATAGACGCGCTTCTTGAGTTTGTCTACACAGACACATCCAGCCCG
TTCGGTATCGGCATGACCTTCGATTACACGGAGTGCTGGGAAATTGGTGTTCGTGACGAC
TGCCTGGTAATGACACGCGTTAAGCCGGTGCATCCAGAATATGCGAAGCACTGGAACATG
AAAGGCGTCATGAATGACAAAACCCGCTTCCACGCCGACAAGTGGGTAGGGTACAGCAAG
GTGCTTGCCTGGGTGAGCTTATCGCACAAAGACACCTTCACGGGTGCGAAACGGTTTCAA
TACTTCCAAACGATGTACGACATGGAACGGCAAATCAACGCAAACCTGCCGGTTGGCGGC
CTTCCCAACGTTGACACAGAGCGAACTGGCAAACTGTTCCAACGCGATGACTTTTCTGAG
GATAGCCATGCCAACGATCCGAAGTTGGTTGGTGATGATTACGTCCCCCAGGCACCGGAG
CAAATCAACTGAATTTTCGGACAAACGCGCGCGTAGCCGACGTCAGCGGCAAGACTGGCG
GTCATTTCCCCGCTCCTACGCGAAAAATCCCTCACAACTACCCTGCAAATTTTCCAGATT
TCACGTACACGCGCCAAAAATAAAGGCCCAGGCAGTTAGCAACCTACCCGGGCCTTTCTC
ACAATCCCCGCTGACATTATATCACCCATCTTTCCGTTTTCAGGTGGGAGACTGATGGCC
GCCGACGTTGCACAATTGATTAATTTCTGAACATTCAAATCAACTCCCACCAAAGCCAAC
AAGATGGGAGGTGAATTTTGTGATGCAGATCGCTTTTTCCCTTCAGGCATTTTTGTTTAA
TTCAATCAACGAAAGGCAGTTCCCAACAACAAAATAAAGATGGGAGGTAAAAATGAAACG
GTGGGAAGTGGCTTTACTGGTGATGGTAATGTTGGTTTGCTGTATTGAACTGTGAAGGAG
GACGCCATGAAACTTTTAATCGCAATCATCCTGATGGTGCTGACTGGTGTTTGCTTTGCA
GATGTTGGTGATTACAGGCTGAACGGGGAGGATAACGCAAGAATTGAATCAGTCGTTACT
GATAACTGTGAAAAAACAGCCGTATTGGTAGGCGGTGACAGGCTTGCGAGGGTTGAGATC
GAATATATAGCGACATTGTGCAAGCCGGTGGCTTTGGTGATTATTTACGACAGATTTGAC
GATATAGCGGCAATCCCTCTTAAGGTGACGTTGAAAAAGGTATTGAAAGAGAATAGCGAT
GAAAAGATTAACCTATTGAACAAGATGGGGGATCTGGCTGGTCGTATCGTTGCAGAGCAG
TATTTAGGCATGAGTTTTGAGTAAGGAGGCAATCATGAAAGTGTTAGGTAATATTTTATG
GTGGGCTTTTGTTGGTTTCATGGCTTACGCCACTTTGATTAAGCCGGACAACACTGATCC
AGCTGTTGTGAACTATGAAGAGCCTTTGCCTATGGAGCTTGCCAACTATGGCGAACCAGG
TGAAGGGGCGAAAATCATGAATGCCGCAAAAATAATGGGTCGCGACTACGCATGGAAACA
TGTAAAAGAAGACAGGTTGCCATGTCTGTTTGCCGCCGGGGTTGTTGCTGATAACATCCT
GGTAAAATACCATTTCAGCAATGAAACTGAGTTCAAACTTAAAGCGGCAGCGGTCAGAGA
ATGCGCCAACGTAGCAGAAAACAACGGCTTTGTTTTGGTAGGTAGAGTATTTGAAAAACG
TAATTGATTGCGAATAGCAACAACTAAACAACCAATACACCCGGCCCCTCGCCGGGTTTT
TTGTGATCTGCGTCAATATTCCCTTCCGTTACGCTTACCCTCCACCAATACGCGTGTTAA
CCTCCCAATGGATTCTATGAGATGGGAGATAAAAATCATGAGTTACGAAATCAAAATTTG
CGACATCCTCAAAGGCGCTGCGATGGAAGGACAATATAAGGGCGCTCAACGTGGGGCCAA
ATGCGAGGAGATCGCAAACGAGTTAACTCGCCGGGGAGTTAAAAACAACAAGGGAGAGGT
TATTACTAAGGGCGGCGTTAGCCATTGGCTGGAAGGTAGACGGGAGCCAAATTTCGACAC
TCTGGCTGAACTGTGCGACATGTTCGGCGTTTATGCCCTGATGCCGATGCGTGGCGGTAA
ATGGATTCGAGTTCACCCGGAAGACCGTGGAGAAATGGAATTACGCGAGGCTGTAGCTGA
ACGAGATGCTATTATCGACGACCTGAAGGCCCGTATCGCTGAGCTTGAGGCGGCACTAGC
AAATAAACAAGTCCCAGCAGAAGCGGAAGAGATGGGAGGTGAAAAAGTGGAAGAAGTGGC
AGCAGAGCAAGCGCCCAACGATGAAAAAGAGATGGGAGCTAAGGAGTGGGTTAACCCGAA
CCCGAAAAAATACAGCGTCGGCATGTTGTGTCAGGTACTGGCTGCAATGGGCGGCGAATA
CCTGGGCAACAACGCAGGGTTACAGCAGAAGATCACTGTGTTGGATAACGACGGCAACCG
GAAGCCAATCAGTAACGGCGCGTTTTATCGACTGATTGAGCAGGCCAAAGGGAGAGGATT
GATTAGCGTTGAACAGGAAATCAAACACAAGAAAGACGAAAACGGCAACCAGATCGGCAA
AGGCAAGAAAGGTGACAAGCTGATAACTTTGCTTCCCAACTGGATTGATAAGCTGGGAGA
CGAATAAACCAGCCTTCAACCCCATCTCATCAATCAACGCCCGGCCCCGCTGCCGGGTTT
TTGCTATGCACCACAATTACCCCAACCGGATACACAGCCGGATACAATTCCACCAGCACC
CAGCCACCCAGCGCCACCGCTGGCGAATACCGCATTCAGGAAGGAAATGCGAGTGATTTC
ACCGTCACCGGCACAACCGATCCGCCAAAAAGAGGCGTACCAATGTCGATATAGTCCCCC
GCGCGGACAATCACTTCGTCAATGACTGCCAACGGGAGTTGTTGTAGCTGTGGGCGCAAC
AACATGCCCAGAGCTTTACCAAAGTCCTGCCCGGCCACCACCAGCAGGGGATGCGGATTC
GGAAAACGCGCGACGAAATCGACCAACGCGTTGATGACCGTCAGTACCGCGGCGTAACGC
ACAGGCAGCGAGGCGGGAAGCGCCAGCACGTACGCGTCAGTTTTGGGATCAAGATCCAGC
TGAATCAGCGCCTGTTGCCAGGCCCCCACCAGATCCGTTTCATCAATCGGGATCGCCACC
GGCAAATTGCGCAGCGGCAGTTGTACGCCCTCAAGCCAGATTGTGCTGCCAGAGAGCGAA
AGGGTATGCGCGCCCGCGCCAATCACCGTGGCGCGCACGGTTTGCGCCGGAAACTGTACG
TTCATCTCACGCAGGCGCGGATGGTCATGCAGCGCAGTTGCCAGCAGCGGGCCAATATCG
GCAAAACAGAACGGGTCGGCGGGCTGGTGGCGATAACATTCGCCCACGCCGCCAGAAAGC
GTAATGATTTCGGGCGTAACACCTGCGGGCAGCAAACCGGTTTGCATCAATGCCTGCGCG
AGCGGTGAGAGCGTTCCGTCAATCACTTCGACAATCAGTTCTGCCATCCGCCGGGTCACC
TGCACCAGCTGCGCGCCGGTCAGCGAACGGGCGTCGGTGCCTGCACCGAAGCACTCATCC
ACAATCATCTGCCCCGGTTTATGAGCGTAAACCACGCGCCCGTGGCTGTCGGTTTCCAGC
AGGCGACCACCGACGTTGAGGCAGGCAGTGCCGCTGATTTTTCCGGCATCGAACAGGGCG
TAGTTCGCGGTGCCACCGCCGATGTCGATATTCAGTACCCGACACAGCCGTTGTTCAGAA
AGGGTTTGTGCCCCGGCTCCGTGACCGGCGATCACGGATTCGAGGTGCGGCCCGGCGCTG
GCAACGACAAAATCGCCCAGCGACTGAGAGAGCGCCATCACCGCCGGGCGAGCATTGCGG
GTTTTCGCGCTTTCACCGGTGATGATGATGGCACCAGAATCAACGCTTTCCGGCTCAATA
CCCGCAGCATGATATTGCTCGAGTATTAAGGTTTTCAGTTCCGCTTCTTTTAAACCGCCC
TGTTTATCGACAGGGGTAAAGAACACCGGACTTTGCCAGCTAATTTCGCGTTTAATGAAT
TCGTAGCGCGGCACCTGCGACACCGCCGCACGGTTAACCAGCTCCAGCCGGGAGAAAATC
ACCTGGGTGGTGGTGGTGCCGATATCGATACCGACGCTCAATAGCTGGCGAGTGTTCACG
ATTGTGCCTCCGCTTCGGTTTTAGTCGCGGTCGCGTCTTCTTTTGGCACCAGCATCATCG
CCACGCCAATCGCCGTTACGCCGCCGATCAACTTGCCGACAATCATCGGGAAGATCATGG
CGTTCATGTTGGCAGCGGCGAAGCCTAAGTGGTCGCCCAGGGCGAAAGCAGCGGAAACGG
CGAAGGCGCAGTTGATGACTTTGCCGCGGGTATCCATCTGCTTCATCATGCCGAACATCG
GGATGTTGTTGGCAAGCGTTGCCACCATGCCGGCTGCCGCGATGTTGTTCATATTCAGTA
CTTTACCGACGCTCATCAGCGGTTTTTCAAACCAGCGAGTCAGCAGCAGCACCATCGGAT
ACGCCCCTAACAGAACGCAGGAGATAGAACCGATAACTTCAATGGCGCGCATCACCTCAC
CGGGTTTATCGCCAGGGGCCATAAAGATAGGATCCAGACCGGGGATCAGTTCCCAGCCAA
GCAGGAATTTCACTACCGCAGCGGCAAGACCGAGGGTGATCAATGCAACGAGGAATTTGG
CGAAGATCTGGAAGCCGTTGATCATTTTTTCCGGGATGAATTTCAGCCCCAGCGCCACCA
GAATCGCAACAATGATCACCGGGATCATGTTCATCAGGATCAGGGCGAAAGTGAATTCCA
CCGGCTGGCCGTTGATCTGCACACCGGAGTACATAGCAACCAGACCACCAGCGATACAAC
CAATCGGAATGGTCACAATGCCCGCCAGCACGCCGAGCGCCAGATAACGACGGTCAGAAG
GTTCGATAATGCCGAGCGCCACCGGAATGGAAAACACAATCGTTGGCCCCATCATCGACC
CGAGAATTAACCCAGAGTATAGCCACGCGGCTACGTCGCCGCCCGCCAGCTCTTTGGCGA
GGAAGAAGCCGCCCATATCGCACGCCAGCAGTGTTCCGGCGAACATCGATGGGTTAGCGC
CGAGCATTTCGTAAACCGGAATAATTACCGGCCCGAGAACGTGAGCCAGTACCGGTGCCA
GCGCGGTCATACCGACCATCGCCAGGCCCAGTGCGCCCATTGCCATAAAGCCTTCTTCGA
ACTGACCGCCTGATCCTTCGATACTTTTACCGAACTTACCGAGGAAACGAGCAGAACCGC
CGAACTGCGACAGGATCCTGTCTACGGCAGCTATCAGCATAAAGAACATCATGATGTACA
TGATGATTTCGTTAATTCCCATCGCCTTTACTCCCTGTTAGTTGTTATTTATTGGCGGAT
GCGGCGTAAACGCCTTATCCGCCCTACATGTGCAATCCCGTAGGCTGGATAAGACGCGGC
AAGCGTCGCATCCGGCAATTGCACCGCGCCACTGGCGGATGCGGCGTGAACGCCTTATCC
GCCCTACATGTGCAATCCCGTAGGCTGGATAAGATGCGGCAAGCGTCGCATCCGGCATTT
ATTGCGCCGCTGCGTACAGGCCGACAATCTGCTCCAGGCTGGCGGTACGCGGGTTACTGC
GCAGACAAATATCTTCCAGCGCGGCCTGCGCCCATGCGCCGTAATGCGCAGATGTCGCAC
CAACATCGCCCAGTCGTTTACCAATCCCAACTTCCGCAATCAGCTCACTTACCGCGTTAA
TAGCGTCACGATCGTCGGATTTTTTAGTTCGCAGTGCCCGACCAATCTGACTAAAGCGTT
CACGACAAACCATCCGGTTAAATTCCATCACCGTTGGCAGCAACATGGCGTTCGCGAGAC
CGTGCGGAATATGCAGCGCCGCGCCCGGCTGATGCGCCATCGCGTGGCACAACCCAAGAC
CCGCACTGGAAAACGCCATTCCCGCCATACATGAAGCCAGCAACATGCTCTCGCGCGCGG
CAAGGTCGTGACCGTAGCCCACCGCTTTCGGCAGCGATTTGCCAATCATCGCAATGGCAC
CAATCGCCAGACTGTCGGTAAACGGTGTAGCGTTCAGGGCGCTGTATGCTTCAATGGCAT
GGGTTAACGCATCAATGCCGGTCATCGCCGTGACATGCGACGGCACACCTTCGGTCAATG
CGGCGTCGAGGATCGCCACATCCGGCATCAGCGAGGCATGGGCTAACACCTGCTTGCGCC
CGCTCACCGCGTCGATAATCACCGTTACATTGGTGGTTTCAGAGCCGGTTCCGGCGGTAG
TTGGAATGGCAATCAGCGGCAAGCGCGGTTGCAGAACGCTGGTTTCTGACATCTCTGCCA
GCGTGCTATCCGGGTTCGTCACCAGCAACGTCACGGCTTTCGCCGCATCCAGCACCGAGC
CGCCGCCAAACGCGATCACCCCATCACAGCCTGACTCACGCAACTGCGCCACGGCTGCAC
ACACGTCGGTAATGCACGGTTCGCCCACCGGACATGGCCAGAGCGTCATGGCGATACCTT
TAACGGTCAGGCTACGCGTCAGCCCGGCGGTCATCCCTGCCTGATGCAAAAAGCTGTCTG
CCATCACGAACAGATGTTTCAGCCCACGCGTTTGCGCTTGCTGTCCGCAACTGCTCACCG
AGCCCGGACCGCAAAGCGTCACCGGTGGAACGCTAAATGTTTTTACCCGTTGCAGATTCA
GGGTATCGAACGCCTGAAAGAGCGCGGTCTGCAATTCATTTTGCATATAGCCCCTCCGCT
TTCTCTCGCCCACTACTGGCGATCGCCAGCGGGGTCATAAACAAACTGTGCTGCGGTAAA
TGCACCTGTAACGCCGGGAATTGTTTGCGAAACAGTTCCGCCACGCCCGGTTGCATACAA
GAGCCGCCCGCCAGCCATAAATCAGTAATGCCCTGCCCTTCAATATGCCGGGCGACAATG
TCCGCCATTTTTTCGTACACCGGTTTCACCGCAGGCCAAATCTCTTCACCGTGACCGCGC
TTGTACTGCTCCGCCTCTTCCAGCGAAATACGGCGATTTCCGGCGAGAGTCAGAGAGATG
TGATGTCCGCCGGTGGCTTCATCCGCCGAGTACGTCACCTTGCCCTTTTTCACGATGGCA
ATGCCGGTAGTGCCGCCGCCGATATCCACTACACCGGCGTTGTCCAGTTGCAGCAGATCC
GCAACTGCGGTTGGCTCATCCAGCACATGGCTCACTTCCAGTCCGGCAGATTCCAGCACG
TTGATGGAAATACGCGGGTCCGTACCTGGAGGAAATGAAGTCGCCGCATGGCTAAAACGA
CGACCGAATTGCTGCTCGAGCGTGTCGAGATGGCGACGAACAATGGTGACAGCGCCGAAG
AAATCCCAGACGATGCCGTCGCGAACCACATCGGCCCAGTCGAGGCATACCGCCACTGGC
TGACCGTCGCGGTCGACAACCATCGACACCACATCGCAGGTGCCCAGATCCACCCCCAGC
CACAGCGGAGATTCCGTCGCGGCGGGCGTCTGGTTACACAGCGTTGCCGCCGTTTGCAGA
CGTGGGGTGAGCCATTGTTCGTCGTGCGCCATCTGTTACTCCTTAAACAATGCGAAACGC
ATCGACTAATACACAGCGACGCAGACGGACAAACGTACGCGCGCTGGTTACCCCTTCACC
GGTTGGCGTGGTGATGGTCATGGTGGTCCAGCCTTCCCCGCCCAGCCCCAGCCCGGCAAT
GCACGGTCCGTTCTTAACGAAAATGCTGGTATCAATAGCATTCGCCATCTGGTTCATGTT
TTCGATGTTGCGCGAGTGCATTGCCGCCGTGTGGTGGCAACCGCCTTCCAGTTTCACCGC
TAGCGCAATGGCATCCGCCACGTTGGCGACGCGCACGACGGGCAACACCGGCATCATCAG
TTCAGTCACGGCAAACGGATGTTCTGCGGTGGTTTCCACAAACAGCAGGCGCGTTTCTTG
CGGAACTTTAAGGCCGATTGCCGCCGCGATTTTGCCTGCGTCGCGACCAACCCAGTCACG
GCTGACGGTGCCTTTTCCGCGCTCGTCGATATTTTTCAGCAACACCGGTTGCAGCTGCTG
CGCCTGTTCTGCGGTCAGTTTCACCGCGTGCTGGCCTTCCATCAGACGCATCAGTTCATC
GGCTACGCTATCAACAACAATCAGTACCTTTTCGTCGGCACAAATGATGTTGTTATCGAA
AGAAGCGCCTTTGACGATGGACTGAGCGGCACGGGCGAGGTCGGCGGTTTCATCCACCAC
TACCGGCGGGTTGCCAGCGCCTGCGGCAATCAGACGTTTATTGGTGTGTTTACGCGCCGC
TTCTACTACCGCTTCGCCGCCGGTTACCACCAGCAGGCCGATACCCGGAAACTTGAACAA
GCGTTGCGCGGTTTCGATATCCGGATTTGCCACAGTAACCAGTAAGTTTTCCGGCCCACC
TGCGGCAACAATCGCCTGGTTGAGCAGCGTAATCGCCCGCTGGGAGACTTTTTTCGCCGC
CGGATGCGGGGCAAAAATGACGCTGTTGCCCGCGGCAATCAGGCTGATGGCGTTGTTAAT
TACGGTTGCCGCCGGGTTAGTGGAAGGCGTCACCGAAGCCACCACGCCCCAGGGTGCGTT
TTCAATTAGGGTCAGGCCGTTGTCGCCAGTCAGCACTTGCGGAGAGAGGCACTCAACGCC
TGGTGTGCCGCGCGCCTGAGCGACGTTTTTTGCAAATTTATCTTCAACGCGCCCCATGCC
GGTTTCACTGACGGCAAGTTCCGCTAAATCTCTGGCGTGTTTTTCGCCTGCTTCACGAAT
GGCAGCAATGGCTAACTGGCGCATTGCCACGCTTTTTAACCCTTGCTGGGCGACTTTGGC
TGCCGCAACGGCGTCATCCAGGGACGCGAAAACGCCCATCTCATGAACGGCGGCGGACGG
CGTGTCACTGCTTTGCATTTTCAGCAGTACCGCTTTCACCACCTGTTCAATATCCTGTTG
ATTCATGATGTTCTGCCTTATTTGTGGAAAATTACCTGACCGCCAGACACCACCTCATCG
ACAATGCCAATCACGCACAGATCGACCGGTGACGTTTCGCTTTTATGCGCCTGGCGGGCG
GAACTGCCACTCACCAGTAACACCCACTCCCCGGTTCCCGCGCCAATATTGTCGATGGCG
ACGGCGCATTGCCCGTCAGGATTACCTTGTGGATCAATCATTTCCACCATCAGCAATTTG
TCATGCGCCAGTCCGTGATGGCGTACGGTACAAACAATTTGTCCAGTGACGACTGCCAGT
TTCATACCCGCCTCCGTGGCGTATTTCAGGTAAAAGCTCCCCCTACCCTCCGCAGAAGGT
AAAATGAAAAAGGAGAGAGCGTGACGCCCGAATCGACGTCACACAGGGTGATTACAGGTT
GCTGCTATCGCCTTTCAGGCCGATCGGGAAGACTTCTTCCAGGTCGCCGTGCGGACGCGG
GATAACGTGTACAGATACCAGCTCGCCGATACGCTGTGCCGCTGCGGCACCTGCATCGGT
CGCGGCTTTACAGGCTGCAACATCACCACGAACCATGGCAGTACACAGGCCGCCGCCAAT
CTGCTTAACACCAACCAGCTTGACGCGCGCAGCTTTCACCATCGCGTCAGAAGCCTCAAT
CAGTGCAACCAGGCCCCGGGTTTCGATCATTCCTAATGCTTCCATTGTGCTTTCCTCTTT
ATCAGGGTCCAGAACGGGACCGTTCATTCAACCAGTGTTTGTAAACTGCTTTCGCGGTTC
ACTTCTGTCTGACGCGGCACAGCTGCCACCAGCGCCAGCTCGATAATTTCCTGCACGCTA
CAACCACGAGAGAGATCGTGCATCGGCGCGGCAAGTCCTTGTATCAGTGGCCCGACGGCA
CGATATCCGCCGAGTCGTTGTGCGATTTTGTAACCAATATTTCCGGCTTCCAGCGACGGA
AAAACCATCACATTGGCCTTGCCCTGTAGCGGGCTGGCAGGCGCTTTTTGCGCCGCCACT
TCCGGCACGAAGGCGGCGTCAAACTGTAACTCGCCATCCACCACCAGCTTTGGTGCGCGC
TCACGGACGATTTCTGTCGCCTGCTGGACGTTAGCAACACAGGGGTGACGGGCGCTACCA
TTGCTGGAAAACGACAGCATCGCCACGCGCGGCTCTTCTCCGGTGATGGCGCGCCAGGTT
TCGGCACTGGCAAGCGCGATATCCGCCAGCTGCGCCGCCGTCGGCTGTGGCACCACGCTG
CAATCGGCAAAGCCCAACGCCGGGCCGCTGTACTGTGGCAACATCAGGAAAATGGAAGAG
AGCGTTTTACAGCCTGGCTGCAAGCCGATAATGCGTAATCCGGCACGCAGCACATTTGCC
GTGGAAGAGAGGTTGCCCGCGATACAGACATCCGCTTTACCGGCGCTGACCATTGCTGCG
GCGAACATCAGAGGGTCGGTAAGTTTTTCCAGCGCATCCGGCGGCGTTTTTTCGCCCGCG
CGGGCCAGCCAGCGATGAGCAAATTCTTCCCGCATTGCGAGGTTGCCATGCGGATCAATC
ACCTGTAGCCCGTCCATCGCCACGCCGTGACTGAGCGCAAACTGACGAAGTTCAAACGGA
TTGGCGACCAGAATGGGCGTTGCCAGACCTTGTTGATGTAAATATTGCGCGGCTTTCAGC
ACACGTTGGTCTAACGCATCCGGAAAAACCACTCTGGCGGGCGCTCGCAACGCCAGTTCA
CGACAACGTTCAATAATCATTGCGTTTCCCCCAGTCGTTGTTGGATCTGCTTCACCGTTA
GCGGCTGCTTCGTTACGCTCAGGATCATCATCACGTAGACCGTGCTCGAAAGGCGGTTCA
GCGCCTGCAAAATGTCCGGGCGTAATACTTCAAAGCTGCGGGTGATAAAGACCTGCGCCG
CTACGGTTTCGGTTTCCCGCACTTTGGTGCGTAGCAGATTGAGCAACGCAGCATCGCGCC
CGTGGCTGGCTTCCGGCACCAGATGATCGTGGTCGAGATAGCGCAGCGGCTGATGAGAAA
GCCGATGCAGATCTTCGTCAGAAAGCCCGACAATCGCCTGGCAGCCCAGCGGTTCCCCCA
GCGCATCGGCGCGCATAATGTTGCCAAGACGCGAACGGATATCCGCCAGCCACGGCTGCC
ACGGTTCCGCCAGTTCAATTTGCAGCCACACTGCCAGCGCAATGGTGCTGTCGAGAACCG
CGCGAAAACCCAGACGCGGATCGCTTTTGGCGACCATTTTTTCCGCCGACAGGTGAGTCA
GCGTATCCGGCTTTTTTGCCACCGGCTGGCGACACAGTTCGCAGCACGCCTGCGGATGTT
CATCGCTACTGGTCAGCCCATGAACGGGCTGCGGCTGCTGCTGTTCATCGTCAACAAACA
GGCGGCCCTGCTCGTCAATAAACTTGATGCGCAGATGGCGGCTTTCCAGCAACTCCCGGG
CAGAGGGCGTCAGGCGACTGTCCGCAGGGAGATGGATCTCTGCGCCTTCGCTGAGCGTAT
GGTTCGCTCTTAGCCATGCTTCGGTGATGAAATCTTTCATAGGGATTGCCAGTTAGCCGG
CCAGGCGACATACAGGAATTTCACGCTGGATGTCGTACCAAATTCGATGCTGGAGCCTTT
CGGGATAAACATCACGTCGCCTGCTTTGGCGATCATGGTTTGGCCTTCGTGGCGAACATG
CAGCTCCCCTTCCAGCACCATGTCGATTTCGTCGTAGTTCAGGGTCCACGGGAAGAATGC
GTTCTCCCACTGCATAAAACCGGCGGCCATGCTGCTGCCGTCGTCTCCGGTCACAAGATC
AGTCAAGCCCACGCAATGCGGCTCTGCGCCGTCGAAACGACCAAACTTGACGCTACTGCC
ATCAATCACTTTGATGCCGCCTTTGCCGGTCACCGATTTGAAGCTCGGCTGCATTGCGCC
CTGCTCCAGCGACTGTTTTTCCTTCATCACTTTTTCCATCAGCTGTGCGACCAGGCTTTC
GGTAAACTGGCCTTCCGGCAGCTGGGCAATGATGGTTTCGCGGATGCGCTGGCTTTCGGT
TTTGTCGGCTGGCACGCTGGCGGGCACGGACGCCGTTACCGGGATCGATTCATCACATTC
GGTGATGGTAAAACCCAGTAGATCCGCCACTTCACGGGCTTCCGGGGTAATAATGCTGGC
GCGCAGAACCACGGACATTGCCTGTTCGCCGCGCGCGTGTGCTTCACGAATATCATTCGC
TGTGATGAGTTTTTTCACCTGCTTCCTCCTGTTTGGTGAGAGATGCCAGATAATCCACCA
GTTGCTGCACGCTTTGCGGGTCGTGGCTGTTTAGCTCGAACATCGGCTCTTCGAAACCCG
TCTCAAGCAATAACTTTCGCGTTGCGGCGACGTCAGCATCTGGCATGTCCGTTTTACTGA
TGACGGCGATTTGCCGTTTGCTGACGCCAATATCCAGCAACCCGGCAGGCAACCGACTTT
CCGGGTCATTTGCGCCATGGACATAGATCAGCATGTCTACATCCTGTAGCGTGGTAATTA
AGGCGTGATACCAGCGGGGATGGTTAAAATATTCACCCGGCGTATCAATATCGCCCTTAT
CATTAAATTCCACGGCCTGTGTTTTTCTGGCGAGGGTATAATTCCCCTGCAACGCATTAA
ATAACGTTGTTTTTCCTGCCCCGACGCTACCCACAAACGCAATTCGTTTCATGAATGCCT
CGTATTAACTTTTGGTCATTTCACAAAGCGTATAATTTAATAAGCGACCTAAACCGCTGA
CGGTTTGTGATAACGCTTCTTCTACTGCGCCCACCGAGCCATAAATCACCAATGCACCGC
TGAATCGGTCGAGAAAACCGATATGCACATCAGCGGCTTTCAGCGCTAAATCACCGGCGA
TCATCGCCGTTTCGCCGGGAGTTAGCGTCATAATGCCAATTGCGCCCGCATCCGGAACGC
CGATTTTCTTCGCCAGTTCCTCACCGGGATGCGCGATGAGATGCGCCAGTGTGACCTGTT
TGCCGGGCACAAATTCCTGAATGATGCGTTCTTTATCCATGAGTCGCCGCCTGTGAAAAA
CTTTCGTGTATCGTGACAATTTTTCGTCAGAGTAAATAACAAAATTCGGCAAGCGCGTTT
AAAAGGTGAGGTAGATCACTAAGAATGGAGAGATATTCGCTGTGGTGCATAAACTTTCAT
ATGCAACGCATGAATATAAATAAAATAATATCGAGATATTATATAGACTGCTTTTTTTTA
TTATTCGCAAACTCAGTAATAAGCTTTACTAATATATTGCAGCTAAACTGCTTACCCTGA
ATATTCAGGGTAAGCGTGAGAGTTAAAAAAAATTACAGCGGTTGGGTTTGCGCTTCTACC
ACGGCCAGCGCCACCATGTTGACGATACGACGCACCGATGCGATCGGCGTTAACACGTGA
ACCGGTTTCGCCACACCCATCAGCACCGGGCCGACAGTCACACCTTCCGAGCTGGAAACA
CGCAGTAAGTTGTAACTAATGCGGGCAGCTTCCATGTTCGGCATCACCAGAATATTGGCG
GAACCTTTCAAAGAGCTGTCCGGCATACGGTCGTTGCGAATCGCTTCCACCAGCGCTGCA
TCGCCGTGCATTTCACCATCAATCATCAGTTCTGGTGCACGTTCCCTGACCAGTTCCAGC
GCCTGACGCATTTTGCTCGACGACGGGCAGTCAGAAGAACCAAAGTTGGAGTGCGACAAC
AAAGCAACGCGCGGCTCAATACCAAAACGACGGACAGTTTCTGCCGCCATCAAGGTGATC
TCCGCCAGCTCTTCTGCATCCGGTTCATCATTAACATATGTATCGGCAATAAAGGTGTTA
CCACTCGGCAGCAGCAGCGCGTTCATGGCACCTGCGGTGTGAACGCCATCGCGATAACCA
AAGACATTTTTCACCACGCTAAAATGTTCATGATAATCACCCACCGTACCGCAAATCATT
GCATCGGCTTCCCCACGCTGAACCATGATCGCGCCGATCACTGTCGGGTTACTGATCAGC
GCCCGCTGCGCCTGTTCCTGAGTGACGCCGCGACGCTTCATGATCTGGAAGTATTCGGTC
CAGTACTCTTTAAAGCGCGGATCGGATTCGTTATTGACGATCTCAAAATCAACGCCCGCT
TTGATCTGCAAGCCCAGTTTCTGAATGCGCATTTCGATCACGTTCGGACGACCGATAAGG
ATCGGTTTCGCCAGTCCCAGCGTTACCAGTTCCTGAGTGGCATGCAGAACGCGCGCCTCT
TCCCCTTCCGGCAGAACAACGCGCTTCGGCGCTTTGCGAGCCTGGGAGAAAATCGGCTTC
ATAAACAGGTTGGTTTTGTAAACGAACTCAGTCAGCTTGTCGATGTAGACGTCGAAATCA
GCAATCGGACGAGTCGCCACGCCCGACTCCATCGCGGCTTTAGCGACCGCAGGAGCGATC
TTAACGATCAAGCGCGGATCAAACGGTTTTGGAATGATGTATTCCGGACCAAAGCTCAGA
TCCTGATCGCCATACGCTGAAGCCACCACTTCGCTCTGTTCCGCATGGGCGAGTTCTGCA
ATCGCACGTACCGCCGCCAGTTTCATCTCTTCGTTGATGGCGGTTGCGCCAACGTCCAGC
GCGCCACGGAAGATGAACGGGAAGCACAGGACGTTGTTCACCTGGTTCGGATAGTCAGAA
CGACCGGTGCAAATGATGGCATCCGGACGCACTTCTTTCGCCAGCGGCGGCAGAATTTCC
GGTTCCGGGTTCGCCAGCGCCAGGATCATTGGCGCACGAGCCATTTTCTTCACCATTTCC
TGGGTCAGCACTTTCGGGCCGGAACAGCCCAGGAAAATATCCGCGCCTTCAATCACATCA
TCGAGGGTACGTTTGCCGTCATCCACCACCGCATATGCGGCTTTGGTTTCCGCCATGTTT
GGCTCACGGCCCTGATAGATAACGCCTTTTGAATCGCAAACCACGATGTTATGTTTTTGC
AGACCCAGCGCTACCAGCAGGTTCATACAGGCGATTGCTGCGGCACCCGCGCCGGAAACC
ACCATCCGCACGTCGGAGATGTTTTTCTCCACCACGCGCAAGCCGTTGAGGATGGCGGCA
GTGCTGATAATTGCCGTGCCGTGCTGATCGTCGTGGAATACCGGAATATTCATCCGCTCG
CGCAGTTTCTGTTCAATATAGAAACATTCTGGCGCTTTAATGTCTTCGAGGTTGATGCCG
CCGAAGGTTGGTTCGAGCGCGGCGACAACTTCAATAAATTTGTCCGGGTCGAGTTCGTCA
ACTTCAATGTCAAATACATCAATCCCGGCGAATTTCTTAAACAGAACGCCCTTGCCTTCC
ATCACCGGTTTGCCTGCCAGCGCGCCAATGTTGCCTAACCCCAGCACCGCCGTACCGTTA
GAGATCACCGCCACCAGGTTACCTCGGGCGGTATATTTGTAGGCTTTTAACGGGTCTTTT
TCGATTTCAAGACAAGGTGCGGCAACGCCTGGTGAGTAGGCCAGCGCCAGATCGCGCTGT
GTTGCCAGAGGCTTGGTTGGAGAAACCTGGATTTTCCCTGGAACTGGAAATTCATGGAAA
TCAAGTGCACTTTGTTTTAACTGGTCATCCATTTGGTTGTTCCTTTCACGTAACGTTCAC
AAATAAAGTGTGTGGGCAACAGCCCCTGCCCACAACGTGGCGCACATTATTACCCTGCCG
GAGTCTACAGACTTTGAGCAAGTCCAAACTCTCACCATTAATATAATGTTTTGGTAATAA
TCCTATAACACTGATGTTACCTGCTTAATCCAGCAATACCATGCCTGTCTGCTATGCTTT
TTTGATGCGTTTAGCGAAATTTCTCAGAAGTGTGAATTAACGCACTCATCTAACACTTTA
CTTTTCAAGGAGTATTTCCTATGAACGAGTTAGACGGCATCAAACAGTTCACCACTGTCG
TGGCAGACAGCGGCGATATTGAGTCCATTCGCCATTATCATCCCCAGGATGCCACCACCA
ATCCTTCGCTGTTACTCAAAGCTGCCGGATTATCACAATATGAGCATTTAATAGACGATG
CTATCGCCTGGGGTAAAAAAAATGGCAAGACCCAGGAACAACAGGTGGTCGCAGCGTGTG
ACAAACTGGCGGTCAATTTCGGTGCTGAAATCCTCAAAATCGTACCCGGTCGCGTGTCAA
CAGAAGTTGATGCACGCCTCTCTTTTGATAAAGAAAAGAGTATTGAGAAGGCGCGCCATC
TGGTGGACTTGTATCAGCAACAAGGCGTTGAGAAATCACGCATTCTGATCAAGCTGGCTT
CGACCTGGGAAGGAATTCGCGCGGCAGAAGAGCTGGAAAAAGAAGGTATTAACTGCAACC
TGACGCTGCTGTTTTCTTTTGCACAGGCACGGGCCTGTGCGGAAGCAGGCGTTTTTCTGA
TTTCGCCGTTTGTCGGGCGTATTTATGACTGGTATCAGGCACGCAAGCCGATGGACCCGT
ATGTGGTGGAAGAAGATCCGGGCGTTAAATCGGTGCGCAATATCTACGACTACTATAAGC
AACACCACTATGAAACCATTGTGATGGGCGCGAGCTTCCGTCGCACCGAACAAATCCTCG
CCTTAACCGGCTGCGATCGACTGACTATCGCACCGAATTTACTGAAGGAGCTGCAGGAAA
AAGTTTCGCCAGTGGTACGTAAATTAATCCCACCTTCTCAGACGTTCCCACGCCCAGCTC
CCATGAGCGAAGCGGAGTTCCGTTGGGAGCACAATCAGGATGCGATGGCGGTAGAAAAAC
TGTCTGAAGGCATTCGTCTGTTCGCCGTTGATCAACGCAAACTGGAAGATCTTCTTGCCG
CCAAACTATAAACCAGCCACGGAGTGTTATATGTCCCGAAAAGACCTTGCCAATGCGATT
CGCGCACTCAGTATGGATGCGGTACAAAAAGCCAACTCTGGTCATCCCGGCGCGCCGATG
GGCATGGCTGATATTGCCGAAGTGCTGTGGAACGATTTTCTTAAACATAACCCTACCGAC
CCAACCTGGTATGATCGCGACCGCTTTATTCTTTCCAACGGTCACGCGTCGATGCTGCTC
TACAGTTTGCTACATCTGACCGGTTACGACCTGCCGCTGGAAGAACTGAAGAACTTCCGT
CAGTTGCATTCGAAAACCCCAGGCCACCCGGAGATTGGCTATACGCCAGGCGTTGAAACC
ACCACCGGCCCGCTTGGACAAGGTTTGGCGAACGCCGTCGGGCTGGCGATAGCAGAGCGT
ACACTGGCGGCGCAGTTTAACCAGCCAGACCATGAGATCGTCGATCACTTCACCTATGTG
TTTATGGGCGACGGCTGCCTGATGGAAGGTATTTCCCACGAAGTCTGTTCGCTGGCAGGC
ACGCTGGGACTGGGCAAGCTGATTGGTTTTTACGATCACAACGGTATTTCCATCGACGGT
GAAACAGAAGGCTGGTTTACCGACGATACGGCAAAACGTTTTGAAGCCTATCACTGGCAT
GTGATCCATGAAATCGACGGTCACGATCCGCAGGCGGTGAAGGAAGCGATCCTTGAAGCG
CAAAGCGTGAAAGATAAGCCGTCGCTGATTATCTGCCGTACGGTGATTGGCTTTGGTTCG
CCGAATAAAGCAGGTAAGGAAGAGGCGCACGGCGCACCACTGGGGGAAGAAGAAGTGGCG
CTGGCACGGCAAAAACTGGGCTGGCACCATCCGCCATTTGAGATCCCTAAAGAGATTTAT
CACGCCTGGGATGCCCGTGAAAAAGGCGAAAAAGCGCAGCAGAGCTGGAATGAGAAGTTT
GCCGCCTATAAAAAGGCTCATCCGCAACTGGCAGAAGAGTTTACCCGACGGATGAGCGGT
GGTTTACCGAAGGACTGGGAGAAAACGACTCAGAAATATATCAATGAGTTACAGGCAAAT
CCGGCGAAAATCGCTACCCGTAAGGCTTCGCAAAATACGCTTAACGCTTACGGGCCGATG
CTGCCTGAGTTGCTCGGCGGTTCGGCGGATCTGGCTCCCAGCAACCTGACCATCTGGAAA
GGTTCTGTTTCGCTGAAGGAAGATCCAGCGGGCAACTACATTCACTACGGGGTGCGTGAA
TTTGGCATGACCGCTATCGCCAACGGCATCGCGCACCACGGCGGCTTTGTGCCGTATACC
GCGACGTTCCTGATGTTTGTTGAATACGCCCGTAACGCCGCGCGGATGGCGGCACTGATG
AAAGCGCGGCAGATTATGGTTTATACCCACGACTCAATTGGCCTGGGCGAAGATGGTCCG
ACGCACCAGGCTGTTGAGCAACTGGCCAGCCTGCGCTTAACGCCAAATTTCAGCACCTGG
CGACCGTGCGATCAGGTGGAAGCGGCGGTGGGCTGGAAGCTGGCGGTTGAGCGCCACAAC
GGACCGACGGCACTGATCCTCTCAAGGCAGAATCTGGCCCAGGTGGAACGTACGCCGGAT
CAGGTTAAAGAGATTGCTCGTGGCGGTTATGTGCTGAAAGACAGCGGCGGTAAGCCAGAT
ATTATTCTGATTGCCACCGGTTCAGAGATGGAAATTACCCTGCAAGCGGCAGAGAAATTA
GCAGGAGAAGGTCGCAATGTACGCGTAGTTTCCCTGCCCTCGACCGATATTTTCGACGCC
CAGGATGAGGAATATCGGGAGTCGGTGTTGCCTTCTAACGTTGCGGCTCGCGTGGCGGTG
GAAGCAGGTATTGCCGATTACTGGTACAAGTATGTTGGTCTGAAAGGGGCAATTGTCGGG
ATGACGGGTTACGGGGAATCTGCTCCGGCGGATAAGCTGTTCCCGTTCTTTGGCTTTACC
GCCGAGAATATTGTGGCAAAAGCGCATAAGGTGCTGGGAGTGAAAGGTGCCTGATGGTGA
TTGCCGGATGCTGATTGCCGGATGCGACGCTGACGCGTCTTATCCGGCCTACAGCGTCTT
ATCCGGCCTACATGTCCCGCCATTTTGTTTAACGGGTGATCCACAACGTGGGCCAGGCGT
CTGGCCCATGCCAGTTATCGCAGGTGGGTTCTGCGGCGTAACGCACCAGGCGAAAACGCT
GACCGTCAAAGCGCCAGCGCGCCTGAATGCCACAATCGCTTAATCCGCGCCCTTTCGCTA
AGGTCACCAGTTCACGCGATTTCTCATCAAATGTTGCGTTCATCAGTTCCAGTTCATTCG
TCTCCTGACCGTTGTTGAACGGCAAACGCAACCGAACCGGGCGCGAAGCTAGTGGCTTTT
TACGCGACACAATCCATGCCAAATCAATGGTGTTATAGGCCCCTGCCTCACAGCTAATCA
TCATCAGCGCTTTATCATCAGTCAGCGCAGTGACATTCACCTCACGACGCAATGGATCAA
GCGAGCAGCGCAGACCATTCATCCGCCAGTTTCCATAATCCAGCAAATCGTTGCGTTCTT
CGAGTGAGAGTGGCGTCGGCGTTGGGTTAACCACCGCGACCTCTTTCAGCGCAGGCGCGG
GCGGTACGCTGAGCGGCGGTTCGTCCCCTTTCTTGATCCACGCGGTTTCACTGCCAACGC
GCTTTTGCTGAGCATCAATAAACAACAACGCTGCTTTTAAGCCACTCAGAGAAATGGTCT
GATCGCCATCGCGTAAGGTGATTGCCTTCCCTTCCTGAATCATCTGCAAAAACGCGGTGA
TGGTTGCCGTATCATCGGTTACTAATAACCATGGTGAAATCCGCCACTTGTCACCACTTA
ACGCCAACGGCTCGCCATCTAACAGCAGCCGTGGCGCTATCTCCCCTTCTGACGCCTCCG
GCGACTTCAATCCGCCGCGCTCAATACGTAAAACGGCATCGGTATGCGCCCCGGCGCTGC
GGCTCAGGGTCATCACCAGTCCATTATGATCGCCCGTATTACGCGCCACGCAGAAATTTT
GGTTATTACAGGTGACCTGCCAGTCGGAAAACGCCCGTTGCGCTGGTGCCGCCCACACCA
AAGACGTCGGCAACAAAGCGAAAAAAAAGAGAAGGAAAATGCGATAGCGCATGGACGGTA
CGACCCCAGAAGTTCAAACAAACAGCACAAGTCGTATCTTCGTTGCGCAGGTAGCGCGGC
TCAATCGGATTTGTCGGATTGAGCCAATAATAAACAACGAAATATTATTGTTATTTTTCA
GTCCATTAAATGTGACGTTTGCAAATAGTTAAGCAATAACACCGTCTTACCGTCACGTAT
CTCGCCGGTTTTGATCATCTCCAGCGCCTGGCTGAACGGCAGCTCGAGCACTTCAATATC
TTCATCTTCGACACCGCCACCGGCGTTAGCGCGCTGATTGTCACTGTATTCGGCGATAAA
AAAGTGGATTAGCTCAGTCACACCGCCTGGCGACATATACAGTTCAAATAATTTGCGCAC
TTCACCCACTTCATAGCCCGTCTCTTCAATCGCTTCTTTGCGAATACACACTTCCGGTTC
GTCGTTATCCAGCAGCCCGGCGCAGCTTTCAATCAGCTGCCCGCTTTCATTGCCATTAAC
CCAGGTAGCGACACGGAACTGACGAATCAGAACCACGGTCTTTTTCTTCGTGTTGTACAG
GAGGATCGTCGCACCATTGCCGCGATCGTACACTTCACGTTTATGGCGGATAACTTCGCC
GTCTTTGCGCGTGAGATCGTAAGTAATGTTGTGCAGGGTGAAATAGTTATCGGAGAGAAT
TTTGTCTTTAATGAGGGTGATTTGTTGCGTCATACCGACTCCACAGCGCGAAATGAACAA
TTATCTTACGCTGTGAAGTCGGGTTTGTCTGCGCAGGCTATCAGTGAGATTTGACTGATT
TTACCCCCAGCCAGTCAATAATCCCCTGTGCCGCATGACGTCCTTCTGCCATTGCGGTAA
CCACCAGATCCGCACCACGCACGGCGTCACCACCAGCGAAGATTTTCGGATTGGTGGTCT
GGTAACGGTACTGGCTTTCCACATCCGCGATGATGCGGCCCCATTTGTCTACCGTTACAC
CGTGCGACTCCAGCCACGGCATCCCGTGCGGATTGAAGCCAAACGCCATAATCACCGCGT
CGGCTGGCATGACAAATTCACTGCCTTCCACCGGCACTGGACGCCGACGCCCCTGGGCAT
CCGGCTCTCCAAGACGCGTGCGCAGGAAACGAATCCCGCAGACGTGACCTTGTTCATTCA
GCTCAAGCGCCACCGGCTGGACGTTAAATTCGAAGTTGGCCCCCTCTTCGCGGGCGTTCT
TCACTTCTTTCTTCGAGCCTGGCATGTTAGCTTCATCACGACGATAAGCGCAGGTGACGT
TACTCGCGCCGTGGCGCAGTGCGGTACGCACACAGTCCATCGCGGTGTCGCCGCCGCCCA
GTACCACGACGTTAAGTCCGGCGGTATTGATAAACGGCTCTTCCGGTAGCTCTTCGAGCC
CCATCACCTGTTTAGTGTTGGCAATGAGGAACGGCAGCGCGTCATAAACGCCCGGCGCAT
CTTCATTGGGTAAACCCGCTTTCATGGAACGGTAAGTGCCTACGCCAACGAAGACCGCGT
CGTATTGTTCCAAAAGCGAATCCAAAGAGACATCTTTACCCACTTCACAATTGAGTTCGA
AGTGAATCCCCATCGCGCTGAAGATTTCCCGACGGCGTGCCAGCAGGGATTTATCCAGTT
TGAAAGAAGGAATGCCGAAAGTGAGCAAGCCACCGATTTCTGGATGGCGATCGTACACCG
TCACCCCCACGCCATTGCGGGTCAGAACATCCGCACAGGCCAGCCCTGCCGGACCTGCAC
CGATAATCGCCACCCGCTTGTCCACTTTGGTGACATGGCTTAAGTCAGGACGCCAACCTT
TCGCCAACGCCTGATCTGAAATGTAGCGTTCAATGTTGCCGATAGTTACCGCGCCGTGCT
CATCGCGAATAGTACAGGCACCTTCACACAAACGGTCTTGCGGACAAACGCGTCCGGTAA
TTTCCGGCAGGGTGTTGGTCTGGTGAGAAAGCTCGACGGCGGCGTCGATGTTTCCGGCTT
TCACCAGTTCAATCCACTGCGGTATATGGTTATGCAGCGGGCAGGTCCATTCACAAACGC
TGTGCTCGCCGCACTTAAGGCAGCGCGAGGCTTCCCGTTGTGCCTGGTCGGCGCGAAATG
GCAGATAAATTTCATCAAAACCGGTTTTGCGCGCTTCAATCGCCAGTTTATCCGGCTCGC
CACGCGCGGGCGTTGCCTGCATTTGTTCGACTTTACTCATTACCGGCATTTCTTGCGCCG
CGGTACTGGCATGCCACGGTTGATGTTCCTGACGCGCGGTGCGCAAGCGGCGGGATTTCG
CCATGCCGGAGAGTGCGACGTCAGTGACCAGTTGCAGCGCGTCCGCCGGGCAATTCTCAA
CACAGGCAGGACCGTTTTCGCGCCCCGCACAAAGGTCGCATTTATGCGCCGTGGCTTTTA
CTTTTCCTGCCGCGACGGGTGTCAGGACGATTTGCATCGTACCAAAAGGACAGGCCACCA
CGCAGGATTTACAGCCAATACACTTTTGCTGATTGACCTGAATGCTGTCATCAACGTGGC
TGATTGCGCCATTAGGGCAGCTACGGGCGCAGGGCGCATCTTCACAATGGTGACAGGTCA
CTGCACTACGTTGCTGTTGATGTTTGATAACCGTAATTCGGGGATGAAAATGGTGTTGGC
TCAGGACATGTTGCTCATCATTGTGAGCCATGACACAGGCGATTTCACAAGCATGACAAC
CCAGACATTGCTGACTGTTGGCCATAATAAAACGATTCATAACGACCTTCTTTTTTGGTT
GTAAAAACCTTATTCTTTATATGAGTGTTGTTATTACCCGACTTACAGGGGAATCGGCAA
TGTTCATGTGCCCAGAATAAGTAACTATTTCGCTATAAACTGTGGCAGATCAAATAATCC
CATCACTGACTAAATTGCGTTTCAGCGAACTGGAACATTAATGATTTTTTGTGGAGAAGA
CGCGTGTGATTGTTAAACGACCCGTCTCGGCCAGTCTGGCCCGGGCCTTTTTTTACATTG
TGCTGCTGTCGATTCTTTCCACGGGTATCGCTCTGCTAACTCTGGCGAGCAGTTTGCGCG
ACGCTGAGGCTATCAATATTGCCGGATCGCTGCGTATGCAGAGTTACCGCCTGGGCTACG
ACTTGCAAAGTGGCAGTCCACAACTCAATGCACATCGCCAGTTATTTCAGCAGGCACTGC
ATTCACCGGTATTAACCAACCTCAACGTCTGGTATGTGCCAGAAGCAGTAAAAACTCGCT
ATGCGCATCTGAATGCCAACTGGCTGGAGATGAATAATCGGCTCAGCAAGGGCGATTTGC
CGTGGTATCAGGCCAATATTAATAATTATGTTAATCAGATAGACCTGTTCGTACTGGCTT
TACAGCACTACGCTGAACGCAAAATGCTGCTGGTGGTGGCGATTTCCCTGGCTGGCGGCA
TCGGTATTTTCACGCTGGTCTTTTTTACTTTGCGCCGCATACGCCATCAGGTGGTTGCCC
CGCTGAATCAGCTGGTTACCGCCAGTCAGCGTATTGAACACGGGCAGTTCGACTCGCCGC
CGCTGGATACCAACCTGCCGAATGAGCTTGGTCTGCTTGCAAAAACCTTTAACCAGATGT
CGAGCGAGCTGCATAAATTGTACCGTTCGCTGGAAGCGTCAGTAGAAGAAAAGACCCGCG
ATCTCCACGAGGCCAAGCGTCGTCTGGAGGTGTTGTATCAGTGTTCGCAGGCGCTGAACA
CTAGCCAGATTGATGTGCATTGTTTCCGCCATATTTTGCAGATTGTTCGCGACAATGAAG
CGGCTGAATATCTGGAGTTAAATGTCGGTGAAAACTGGCGGATTAGCGAAGGGCAACCAA
ACCCGGAATTGCCGATGCAGATTTTACCGGTGACAATGCAAGAGACGGTTTACGGCGAAC
TGCACTGGCAAAATAGTCACGTTTCATCATCAGAACCGCTGCTTAACAGCGTTTCGTCGA
TGCTGGGACGCGGTTTGTACTTTAATCAGGCGCAGAAGCATTTTCAGCAATTATTGTTGA
TGGAAGAACGTGCGACCATCGCCCGCGAATTGCACGACTCGCTGGCTCAGGTACTTTCTT
ACTTACGTATCCAGTTGACGTTACTGAAGCGTTCGATACCGGAAGATAACGCCACCGCAC
AAAGTATCATGGCCGATTTTTCCCAGGCGTTGAATGATGCTTATCGGCAGTTACGCGAGC
TGTTGACTACTTTCCGCCTGACGCTGCAGCAGGCGGATCTCCCCTCCGCATTGAGGGAAA
TGCTGGATACGTTACAAAATCAAACCAGCGCCAAACTGACCCTCGACTGCCGTCTGCCAA
CCCTGGCACTGGATGCGCAAATGCAGGTGCATTTGTTGCAAATTATTCGCGAAGCGGTGC
TGAATGCGATGAAGCACGCCAACGCCAGCGAAATCGCCGTCAGTTGCGTCACCGCGCCGG
ACGGCAATCACACGGTTTATATCCGTGATAACGGGATTGGTATCGGTGAACCGAAAGAAC
CCGAAGGTCATTATGGTCTGAATATCATGCGCGAACGCGCGGAACGGCTAGGTGGGACGC
TGACTTTTTCACAACCTTCCGGCGGCGGCACGTTAGTGAGTATTAGCTTTCGCTCTGCGG
AGGGTGAGGAAAGTCAGTTAATGTAATGCCTCCTACTGACCAAAGAATACTTGCACTTAA
GGTTCAGTATAAAAGGGCATGATAATTTACATTAACTCCTTTTTTTCTCCACGATTGGCT
CGTACCTTGCCGCTACAGTGAAGCAAGTCAAGCCTACAACGATACGCAGAAACACGAGGT
CCTCTTTTAATGGCGAATTTCTTTATTGATCGCCCCATTTTTGCCTGGGTGCTGGCAATC
CTGTTGTGTCTGACAGGTACCCTGGCGATTTTTTCATTGCCCGTTGAACAATACCCCGAT
CTCGCGCCACCGAATGTGCGAGTGACCGCTAACTATCCCGGCGCATCGGCCCAGACGCTG
GAAAACACCGTGACCCAGGTTATCGAGCAAAATATGACCGGCCTCGATAATCTCATGTAT
ATGTCATCTCAGAGCAGTGGCACCGGTCAGGCATCTGTCACTTTAAGTTTTAAAGCAGGC
ACCGATCCGGACGAAGCCGTGCAGCAAGTACAAAACCAGCTGCAATCAGCCATGCGAAAG
TTACCGCAGGCGGTGCAAAATCAGGGCGTGACGGTGCGTAAAACCGGCGATACCAACATT
CTGACCATTGCCTTCGTCTCTACCGATGGTTCGATGGATAAACAGGATATTGCTGATTAT
GTTGCCAGTAATATTCAGGACCCGTTAAGCCGCGTGAATGGCGTCGGGGATATCGATGCC
TATGGTTCGCAATATTCCATGCGTATCTGGCTGGACCCGGCGAAACTCAACAGTTTCCAG
ATGACGGCTAAAGATGTCACTGATGCCATTGAGTCACAGAACGCGCAGATTGCGGTTGGG
CAACTTGGTGGTACACCTTCCGTCGATAAGCAGGCGCTCAACGCCACCATTAACGCCCAG
TCACTGCTGCAAACACCAGAACAGTTCCGCGATATCACCTTGCGGGTCAATCAGGACGGC
TCAGAGGTAAGGCTGGGCGATGTCGCCACCGTCGAAATGGGGGCGGAGAAATACGATTAT
CTTAGCCGCTTCAATGGTAAGCCAGCCTCCGGGCTGGGGGTAAAACTGGCCTCCGGCGCT
AACGAAATGGCGACAGCGGAGCTGGTGCTCAATCGTCTCGACGAGCTGGCGCAGTATTTC
CCGCATGGACTGGAATACAAGGTGGCGTATGAAACCACCTCGTTTGTTAAAGCCTCCATT
GAAGACGTGGTGAAAACGCTGCTGGAAGCTATCGCTCTGGTTTTCCTCGTTATGTATCTG
TTCCTGCAAAACTTCCGCGCCACGCTGATACCCACTATCGCCGTGCCGGTGGTGTTGATG
GGAACCTTCTCCGTACTTTACGCCTTCGGTTACAGCGTCAACACCTTAACCATGTTCGCG
ATGGTGCTGGCGATCGGTCTGCTGGTGGATGACGCCATCGTGGTGGTGGAAAACGTCGAA
CGTATTATGAGTGAGGAAGGACTCACTCCTCGCGAAGCCACACGTAAATCGATGGGGCAG
ATCCAGGGGGCACTGGTCGGGATTGCGATGGTTCTTTCGGCGGTATTTGTACCAATGGCC
TTCTTCGGCGGCACCACCGGTGCCATCTATCGCCAGTTCTCTATTACCATTGTTGCGGCG
ATGGTGCTGTCAGTACTGGTAGCGATGATCCTCACTCCGGCTCTGTGTGCCACACTACTT
AAGCCACTGAAAAAAGGTGAGCATCATGGGCAAAAAGGCTTTTTTGCCTGGTTTAACCAG
ATGTTTAACCGCAACGCCGAACGCTACGAAAAAGGGGTGGCGAAAATTCTCCACCGTAGC
CTGCGCTGGATTGTGATTTATGTCCTGCTGCTTGGCGGCATGGTGTTCCTGTTCCTGCGT
TTGCCGACGTCGTTCTTACCGCTGGAAGACCGTGGCATGTTTACTACCTCGGTACAGTTG
CCCAGCGGTTCAACGCAACAACAGACCCTGAAAGTCGTTGAGCAAATCGAGAAATACTAC
TTCACCCATGAAAAAGACAACATCATGTCGGTGTTTGCCACCGTTGGTTCTGGCCCTGGG
GGTAACGGGCAAAACGTGGCGCGAATGTTTATCCGCCTGAAAGACTGGAGCGAACGCGAC
AGTAAGACCGGCACCTCGTTTGCCATTATCGAGCGTGCAACGAAGGCGTTTAACCAAATT
AAAGAAGCTCGCGTTATCGCCAGCAGCCCGCCAGCAATTAGCGGTCTTGGTAGTTCTGCA
GGTTTTGATATGGAGTTGCAGGACCACGCTGGAGCGGGTCACGATGCGCTGATGGCAGCA
CGTAATCAGTTGCTGGCGCTGGCGGCGGAAAACCCGGAGCTAACCCGTGTGCGCCATAAC
GGCCTCGACGACAGTCCGCAGTTGCAGATTGATATCGACCAGCGTAAAGCTCAGGCGCTG
GGCGTTGCTATCGACGATATTAACGACACACTGCAAACCGCCTGGGGTTCGAGCTATGTG
AATGACTTTATGGATCGCGGTCGCGTGAAGAAAGTCTATGTGCAGGCAGCTGCGCCGTAT
CGCATGCTGCCAGATGACATCAATCTCTGGTATGTCCGAAATAAAGATGGCGGCATGGTG
CCCTTCTCTGCTTTCGCGACCTCACGCTGGGAAACAGGCTCGCCGCGTCTGGAACGCTAT
AACGGTTATTCTGCGGTTGAGATTGTTGGGGAAGCCGCACCGGGGGTCAGTACCGGTACG
GCGATGGATATTATGGAATCGTTAGTGAAGCAGCTGCCAAACGGCTTTGGTCTGGAGTGG
ACGGCGATGTCGTATCAGGAGCGGCTTTCCGGCGCGCAGGCTCCGGCGCTGTACGCCATT
TCCTTGCTGGTGGTATTCCTGTGTCTGGCTGCGTTGTATGAAAGCTGGTCGGTGCCGTTC
TCGGTAATGCTGGTCGTGCCGCTGGGGGTAATCGGCGCGCTGCTGGCAACCTGGATGCGC
GGGCTGGAAAACGACGTTTACTTCCAGGTGGGCCTGTTAACGGTCATTGGTTTATCGGCG
AAAAACGCCATCCTGATCGTCGAGTTTGCTAACGAGATGAACCAAAAAGGCCACGACCTG
TTTGAAGCGACGCTCCACGCCTGCCGTCAGCGTTTACGCCCGATTCTGATGACCTCGCTG
GCATTTATCTTCGGCGTATTGCCAATGGCAACCAGCACGGGTGCCGGTTCCGGTGGTCAG
CATGCGGTGGGTACTGGCGTAATGGGCGGGATGATTTCGGCCACTATTCTGGCTATTTAC
TTCGTGCCGCTGTTCTTTGTGCTGGTGCGCCGCCGCTTCCCGCTGAAGCCGCGCCCGGAA
TAAGCAATAAAAAAGGCGACATGCCAATGTGTCGCCTTTTTCAACTTTCCGATTAAGAAC
CTGCTCAGCGGGTTCTTGCTGTTTGTACTTTGTCTCAGGAATTACTTACGAAGCATAACT
TCGATAAAGTCTTTCCAGTTCCCCAGTTCACGTTCAATCATAACAACCTCTCTTATAATT
ATGGGTATTCTACGGAAACAATATACCGTGGTGAAGCTAATTTACTCGATTGCTGCGATG
ACTACCTCCGGGGGACAAATCTTATGTAAATACTATGGTCCTGCGGTGATGATTTGTATG
TGATACACAGCAACATTTCGAGATATTCATACGGCATCTAATACTGATTTAATTCTGGTT
AAAATACAGACAGATAACAAGATGAATATTCTTAATGTTTACGTTAAAAATGTTTAATAT
TATTTAATAGTTGTTAATTTGAATACTTCGATAATGTTATATTTCCTGATAATCATTTGC
AGGCAAAATGTTTTCACCCTTAAATGAGTATTTATTCTCATAAATCGAAAAAGGATTCAT
TATGGTTACACTTTACGGTATCAAAAATTGTGACACCATTAAAAAGGCTCGCCGTTGGCT
GGAAGCCAATAACATCGACTATCGTTTTCATGATTACCGCGTCGATGGGCTGGACAGCGA
ATTATTGAACGATTTTATCAACGAATTAGGCTGGGAAGCGTTACTCAACACCCGTGGTAC
AACCTGGCGTAAACTGGACGAAACCACCCGCAATAAAATCACCGATGCGGCCTCTGCGGC
GGCATTAATGACTGAAATGCCTGCAATTATCAAACGTCCATTGCTCTGCGTGCCCGGTAA
GCCTATGCTGCTGGGTTTCAGTGATTCCAGTTATCAGCAATTTTTCCATGAGGTGTAGTC
TATGTCGTGCCCGGTTATTGAGCTGACACAACAGCTTATTCGCCGCCCTTCCCTGAGTCC
TGATGATGCAGGATGCCAGGCTTTGTTGATTGAACGTTTGCAGGCGATCGGTTTTACCGT
TGAACGCATGGACTTTGCCGATACGCAGAATTTTTGGGCATGGCGTGGGCAGGGTGAAAC
GTTAGCCTTTGCCGGGCATACCGACGTGGTGCCGCCTGGCGACGCCGATCGTTGGATCAA
TCCCCCGTTTGAACCCACCATTCGTGACGGCATGTTATTCGGGCGCGGTGCGGCAGATAT
GAAAGGCTCGCTGGCGGCGATGGTGGTGGCGGCAGAACGTTTTGTCGCACAACATCCCAA
CCATACGGGGCGACTGGCATTTCTGATCACCTCTGATGAAGAAGCCAGTGCCCACAACGG
TACGGTAAAAGTCGTCGAAGCGTTAATGGCACGTAATGAGCGTCTCGATTACTGCCTGGT
TGGCGAACCGTCGAGTATCGAAGTGGTAGGTGATGTGGTGAAAAATGGTCGTCGCGGATC
ATTAACCTGCAACCTTACCATTCATGGCGTTCAGGGGCATGTTGCCTACCCACATCTGGC
TGACAATCCGGTACATCGCGCAGCACCTTTCCTTAATGAATTAGTGGCTATTGAGTGGGA
TCAGGGCAATGAATTCTTCCCGGCGACCAGTATGCAGATTGCCAATATTCAGGCGGGAAC
GGGCAGTAACAACGTTATTCCGGGTGAACTGTTTGTGCAGTTTAACTTCCGCTTCAGCAC
CGAACTGACTGATGAGATGATCAAAGCGCAGGTGCTTGCCCTGCTTGAAAAACATCAACT
GCGCTATACGGTGGATTGGTGGCTTTCCGGGCAGCCATTTTTGACCGCGCGCGGTAAACT
GGTGGATGCGGTCGTTAACGCGGTTGAGCACTATAATGAAATTAAACCGCAGCTACTGAC
CACAGGCGGAACGTCCGACGGGCGCTTTATTGCCCGCATGGGGGCGCAGGTGGTGGAACT
CGGGCCGGTCAATGCCACTATTCATAAAATTAATGAATGTGTGAACGCTGCCGACCTGCA
GCTACTTGCCCGTATGTATCAACGTATCATGGAACAGCTCGTCGCCTGATGAGTGGTTCT
GCAAGAGGAAATAAGCATGGACTGGCTGGCTAAATATTGGTGGATTCTGGTGATTGTCTT
TTTGGTAGGCGTCCTGCTGAACGTGATTAAAGATCTCAAGCGCGTCGACCATAAGAAATT
TCTCGCCAACAAGCCGGAGCTTCCCCCGCATCGTGATTTCAACGATAAGTGGGACGATGA
CGACGACTGGCCGAAAAAGGATCAACCGAAGAAGTAAGCTGAGTGCTCAACCGTAGGCCG
GATAAGGCGTTAACGCCGCATCCGGCAATGGTGAACGATGCCTGATGCGACGCTCACGCG
TCTTATCAGGCCAGGTAATCTGTCTTTTACATCATTTCAATCACATCATCATCGCCAGGC
TTACCGCCACTTAGCGCTTCGTCGAAATAATGTTTCGGAATGGTATAACGCAAGTGATCC
AGGGCAAATTGCATACTGCGATTGTCGATCGCATGGCCTAAATCCTCCACGATATCCAGC
GTCACGTCACCACCGGCACTGATTAACGCTTCCTGCGCCGCAACCGCATGCGCCAGATCG
ATAACCGGATCTTCACCGCCATGAATCAGGTGAATTGTCGTGGCTGTAGACGCAGTTTCC
GGCAGGCTCGCATAGCGTCCGTTAAAAGCAATGACGCGTGAAGCAAGGCCCGGTTCGGCT
TTAATGCTCTCCAGCACCATAATCGCGCCTTGAGAGAAACCGATGAGCGCCGTGGCGTTA
GCCCCTACTCCGCTCTGTTTCTGCCAGTAGCGCACCGTTTCAATAAACGTCGGCATGATC
GCATCCACACGCGCCTGGCGATTATCTTCCGTAATACCCTGCACCGAAAACCACTGACGC
CCCGCCGGATTACCGCTCGGCTCCGCGCCACCGACACTCACCACCAGCGCATCAGGAAAC
AGCGGTGCAAACCAGTTGCCTATTTCCCCCATTGCCACCGGGTTATCCCCGACACCGTGG
AAAAGCAGTAACAACTGTTGCGCAGGTTTATCCGGGCTTTGAACAACAAAATGGTCATGT
TTCATGGCGAACTCCTTAACTGATGTCATTAATTTTACGCCGCTGACTCACAATGACCAT
GAGATAAAATTGAAGGAGTCAGTGAAATAATTGCCATTGCGTTATGCGATCGCGCAGACG
CTCAGTGCGAACATCATTAAGTGCGAACAGCGCCTGCGCGGCCTCTTCCCGCTGACGGAC
CAGTAACATCTTGCGGCCTGAAAGTTTAAGTGTGGTACATAACTGCGCATCACTGGCGTT
TTTCTGTAAACGCCCACGCAGCGCCGGTAATGCCAGTTCACTGGTTTGTAACAGACGCAA
TAAGCAACCTAACGACGTTAATAGCGGACGATGAGCGAAAGCAAAACCGGCCAGTTCAAG
CCAGTCGTCGTCAGAAAGGACGGCATCGTTTAGTGGATCAACAGGAAGCGTTTCGCCATT
CCACTGCGCGAGAGCTTGCGCATCGCGACGTAAACGGTAATGCTCACGTTCAGCCAGCTG
TTTACCCGCATCACTCATCGGTAACAGCGCCATCGCCGTATAGCAACCGCTGCTGGCTTC
CCGATGATTACCCATCCGCACCAGCACAAAACCGCAGCGTTGCCAGAAACGCCATAACTC
CCCGGTGTAACCAAAACTCACCGAAAGATAGTCGAGGTCTTGCGTATATTGCAAAGCACC
AGCAATAAGTTGCCGCCCTGTGCCTTCCCGCTGACGAGCCGGATGAACTGCTATCCGGCT
GACCCGCCGTCCACGCAATGTCGCCGCCAGTGGATTGTTGCCGTGCGCCGCCAGCGACTG
GGCCACCAGATTACCCCGCGGGCGACGAAAACCTGCCCATACCGCCTGACTGAGTTGTTG
AGATAATCCACCCTCATCCACCAGCCACAGCGCCCCGGCAATCTCGTTTTCGCCAGCCGC
CTGTAAAAAATGTTGCCCTGGTGCATCCATCATCCGGCGTAAATCCAGCGGCGAAGTCCG
ATAGTGCGCACCAGACAAGAGCTGATAAACCTTTAACGGCGTTTCTGGATCGCTTTGCCA
TAACGTCTGTTCAAATGCGGAAATGACAATATTGCCTTGTGGTGTATGGGTGAAGTTTTC
ATCGTCAAAAACCAGTGCCTCGCTGACCATTTTTTCCAGCGGGCATCCCTGCGCCCAGCG
GATCGGCTGTTGCAGTTCAAAACGGTGTAAATGCGGAAAGCGAGCGCAAAATTTCAGCAA
AAAACCACGTCCGGTGCCTTCGTAGCCCTGCACCGTAGTGGTTAACAACGTTCGAGGAAA
ACGCGATACCAGTTGATGCAACAATGGCGCAGGTATGGCTGCGGCTTCATCGACCACCAG
CCAGTCGGCTTGCTCATCGCTGGCTAACAAGGCATCCGGCGCAATAAAGCGAAACTTCTC
GCCCGCAAATTGTGCCAGTACATCCGTTGACGCTTTTGCGGGCGCGGTGACAATCGCTCT
GCCCGCAATACGAGAAATGAGTTGCCCTGCCAACGCCGACTTACCGCGCCCACGCGCAGC
CGTTACCGCTGCCACGCCCGGCGGCATGGTCATTAGCTGCTTTAAGAGTTGCTGTTGTTC
TGGTTGTGGTGCGCCAGTCGCGGGGTACCAGTCAGTACGGGGAGTAAAATGCGCCAACGA
GAATGGCTGGTTTTGCCGCCAGAGGATAGCCTCGTTATCCGCCGTAAGTACGCGTTTGAG
ATGCTGGACAAAATGCGGCGTCGCAATAGGGTCAGGGCAATCACTCCAGCGCAGCGAGTC
GGCATCAGGTTGGTTTTCCCACTCTTCCCATACAGGGAGTAACAAAACCAGCCAGCTTCC
CGCTTTCAACGTTCCGCTAAGTGCGGCAAAGGCAGCGGCATCAAAGCCGTGGCGGGCGTC
GAATACCGCATGCCGGAACTCGCGCCCAAGTAAAGTTTGTAGTGCCGAGGGAGAACAGTG
GTTTTCAGCATCTGGCCGCGGCGAAATCCACAGCCAGTCGCCAGGTAAGGCATCACGCAA
CTTAAGAGTATGCTCAAAACACCAACCCTCTTCCCCGCTCAACACCAGCAAGCGGCGGAT
CCCTTCACGTTTCATTTGCGCTGTTAATGTGTGAAGCGCAGTCAGTTCAGCCATCCCTGC
CCCGGAAGTTAAATGCTTTTACCAAAAGTATTGCATTGTGCCGGATCGCCGCTGTCGAAA
CCACGTTTAAACCAGCTGTAGCGTTGCTGAGAAGTGCCATGAGTGAAACTGTCTGGTACT
ACTCGCCCCTGACTTTGCTGTTGTAAACGGTCATCGCCGATGGCCTGCGCCGCGTTCAGC
GCCTCTTCCAGATCGCCGGTTTCCAGAACGCCTTGCTGCTGCATACTATGCCCCCAGACA
CCGGCAAAACAGTCGGCCTGGAGTTCCATACGCACAGATAAGCGGTTTACTTCCGCCTGC
GTCGCGTTTTGTTGCAGTTGACGAACTTTCGGCTCGATGCCTAACAGTTTCTGCACATGA
TGACCGACTTCATGGGCGATAACGTACCCCTGGGCAAAATCGCCATCCGCGCCAAGTTTG
TCTTTCATGTCATCATAGAAGGAGAGATCGATATAAACCGTGCCATCCGCCGGGCAATAG
AACGGCCCCATTATGGACTGGCCCGCCCCGCAGCCGGTACGCGTCATTCCACGGTACATG
ACCAGCTTCGGTTGCTGATAGGTCTTACCCATCTTCTCGAACTGTTGTCCCCAGGTGTCT
TCCGTGGTTGCCAGAATCACCGAGGTGAATTTTGCGGCTTCGTCTTCATTTGGGCTAATT
GACCGCGTTGATTGTTGTTGGGAAACCGGCTGCCCGGTCATCAACCCGGTTAAATCAACA
CCATAGTAGCCTGCAACCAGCACGACTATCAGTAAAATCAGCCCGCCTTTACCGCTTGGC
AGGCGAAAACCGGGACCGCCCATAGATGGACCACCAGAGCTGTTGCGCCTGTCTTCAACA
TTGTCACTTTCACGTCGCCCTTGCCAACGCATAGATACCTCAACAATATATTCATTATAG
AAATGATCGTAGGTGGTTCAGAGGAAGATTACCACAGGAAAGCGGGATGAAATGGCGGAG
GAATGAGCGTTCAATGCATATATTCCGAGAGCGGTTGTCTTGCCGTGCCAGCTGCACGGC
AAGATGATGAACAGAAAAATCAGTCCAGCTGTACACCCAGGCGGCGGGCGACGGCTTCAT
AGGCTTCGATCAGGCCACCGAGGCTCTGGCGGAAACGGTCTTTGTCCATTTTCTCCAGCG
TTTCTTTGTCCCACAGGCGGCTACCGTCCGGGGAGAACTCATCACCCAGTACCACTTCGC
CTTTGTACAGACCAAATTCCAGCTTGAAGTCGACCAGAATCAGACCAGCATCATCGAACA
GTTTTTTCAGCACGTCGTTCGCTTTGTAGGTCAGCTCTTTCATACGCGCCAGGTTCTCTT
TGCTCACCCAGCCAAAGGTTTCGCAGTAAGATTCGTTGACCATCGGATCGTGCATGGCGT
CGTTTTTCAGGAACAGATCGAACAGCGGCGGGTTCAGCTCAATACCTTCTTCGATTCCAA
GACGTTTCACCAGAGAGCCAGCAGCACGGTTACGCACGACACACTCAACCGGCACCATAT
CCAGCTTTTTCACCAGACATTCGGTATCGGAGAGCAGACGCTCCATTTGAGTCGGGATAC
CCGCTTCAGCCAGTTTGCTCATAATGAAGTAGTTGAACTTGTTGTTCACCATACCTTTGC
GATCAAACTGCTCAATGCGCGCGCCATCCCCTGCTGACGTATCATTGCGGAATTCGAGCA
CCAACAGGTCCGGGTTTTCCGTGCTGTATACGGTTTTCGCTTTACCACGATACAACTCAG
CTTGCTTTTGCATCTTTATCACTCCTGGGTGTGAATTAACGTTTTAAAATCTTTTGCTGT
CTGGTGTGCCGGATGTTTTGTCGGATGCGGCGTGAACGCCTTATCCGAACTACGTCCGAC
AAACAAATTTCGTGCGAATTACCGCTAAAATCGCGTTTTCCTGCAGACGCACACGTTTGC
GTATCATATCAGAAAAAAGGGCCGGATGATTCCAGCCCTGTATTTTTACTTGCTAAACGC
AGCCTGGAAGACAGCTACCAGCGCGTCGTTCTGACTCTGAGTCAGAGTATGACCTTTCGG
ATCGATGAACTGTAGGCTGCTGCGGTTATCTAAATCGCCAACCTGCAGTTTATAGTCACC
GGATGCCAGGCCTGGATCGCTCGCGCCCAGTTCCTGCCAGTCGCTGTCAGACAGCGGCTT
ATAAGTTACGGCCATGTTGCCCTGCGAACGGGTGCTGTCGGTCACTTTCATGCCCACTTT
TTCCAGCGCCGCTGGCAGACGTTGCCAAACCACATTGAACGGCCCGCGTACGACCAGCAT
TGGTAAACCGGTGTCATCAGCTGCACTTTGTACGTCCATAGTGGTGGAGGCACGATTTTG
CGCAGCGTTCGCGGCGTCAGTGGCAGATTTATCCAGACCGGCGGAAATAACGTTCATCAT
CTCCGTGCTGTAACGCTGCATGGAAGCCGCGTCTGCAACCGGTTTGCCCGCCTGTTCCAG
GTTCAGCAGTTTAACCGTAACCGCCTGCTGATAACCCTGCGGCTTAACAGAGATTTGATA
ACGACCACGATACTGCTCGTCTTCGTCCAGACGGTTCCATTGTACCCAATCGGTGGTCAG
TGTCTGACCAGCATCATCACGTTGGGTGATGGTGTAGTTTTTCGCCTGCAGCACGCTAAC
CACCTGCGGCCACAGAGTATTGCCACGACCATTTTCCACCAGCAATGAAGCGGTATCGCC
CGTGAACTGGGTACGCGCGCCAGAAACCAGTGCCAGCGGCTGGGCTGGTGGACGAATGTC
CAGCGCCTTACCGACAGCACCACTACCGTTGGTCACCGGGATTGCATAATCACCGGAGGT
CACCGGCAAAATCATTCCAGCCGGGGCATGAAGCTCCGCAAGCGGTGCCGCTTCCAGGTA
GGCTTCATCACCACTGACCTGACGCTTATAGCGTGAGTCAGAACTACAGGCAGCGAGTAA
TAAAACAAGCGAAACACCCGCAACCTTTGCCAGGCGCGACTTTTGAACAGAGTAAGCCAT
CAAATCTCCCTAAACTTTACAGCAAACCGGCATGCTTAAGCGCCGCTCTGACCGTCTCAC
GACCACTGTCGGTGATTGGTGTCATTGGCAGGCGCAGCGTATCGGTCGCCACAAGACCCA
GTTCCTTACATGCCCATTTCACCGGGATTGGATTGGGTTCGACAAATAGTTTGTTGTGTA
ATGGCATCAGACGCTGATTAATAACGCGTGCCTCGGCAAAATGCCCTTCTGCTGCCAGTT
TGCACATCTGGGCCATATCACGCGCTGCGACGTTAGCCGTAACGGAAATAACCCCATGAC
CGCCCAATTGCATGAAGTCCAGCGCGCTCGCATCATCGCCGCTCAGCAGAACAAAATCAT
CTGAAACCAGCTCTTTGATCTGGTTTACACGCGTTAAGTTCCCTGTTGCCTCTTTGATTC
CGATAATATTTTTTACTTTCGCCAGACGGCCCACCGTTTCCGGGAGCAGATCGCAGCCAG
TACGGGACGGCACATTATACAGAATTTGCGGCAGGTCAGTATGCTCAGCGATGGCTTTGA
AATGCTGATACAAACCTTCTTGCGACGGACGATTGTAGTAAGGGGTTACCGTCAGGCAGC
CGACGATACCACTGTCATTGAAGCGCTGCGTCAGGCTAATGGCTTCCGCAGTAGCGTTAG
CGCCGGTCCCGGCAATTACCGGAATGCGCCCATCAGCCAGATCCAGCGTCATCATCACCA
CATCAGCATGTTCGTCATGATTTAAGGTAGCGGACTCGCCAGTGGTGCCAACAGAAACGA
TCGCCGAAGTACCGCTGGCGACATGATAATCAATCAGTTTTTTCAAGCTAGCCCGACAGA
CATTACCTTTTTCATCCATCGGAGTAACAATCGCGACAATACTTCCCGTGAACATGGGCC
ATCCTCTGTGCAAACAAGTGTCTCAATGGTACGTTTGGTATGGCATTAAAAGCAAGCAGA
CAGAACCGTTCTGATTGTTGTATGCATGTTTTTTTTATGCTTTCCTTAAGAACAACTCAC
CCCTTAAAGGAATAACCAGTTTGACACTGTCATCGCAACATTATCTGGTGATCACTGCGT
TGGGTGCCGATCGCCCTGGAATTGTGAACACCATCACCCGTCATGTCAGTAGTTGCGGCT
GTAATATTGAAGACAGTCGCCTGGCGATGCTGGGAGAAGAGTTCACGTTTATTATGCTGC
TTTCCGGTTCATGGAATGCCATTACTCTGATTGAATCAACGTTACCGTTGAAAGGTGCCG
AACTGGATCTTTTAATCGTGATGAAGCGCACGACGGCGCGTCCGCGTCCGCCAATGCCAG
CATCTGTCTGGGTTCAGGTCGATGTGGCAGACTCCCCGCATTTAATTGAACGCTTCACAG
CACTTTTCGACGCGCATCATATGAACATTGCGGAGCTGGTGTCGCGCACGCAACCTGCTG
AAAATGAACGGGCTGCGCAGTTGCATATTCAGATAACCGCCCACAGCCCCGCATCTGCGG
ACGCAGCAAATATTGAGCAAGCGTTCAAAGCCCTATGTACAGAACTCAATGCACAAGGCA
GTATTAACGTCGTCAATTATTCCCAACATGATGAACAGGATGGAGTTAAGTAATGAATCC
ACTGAAAGCCGGTGATATCGCACCGAAATTTAGCTTGCCGGATCAAGACGGAGAACAAGT
TAATTTGACCGACTTCCAGGGACAGCGTGTTCTGGTTTATTTCTACCCGAAAGCCATGAC
CCCCGGCTGTACCGTACAGGCCTGCGGCTTACGCGATAACATGGATGAGTTGAAAAAAGC
GGGCGTTGATGTGCTGGGTATCAGCACCGATAAACCCGAAAAACTCTCCCGTTTTGCGGA
AAAAGAGCTGCTTAACTTTACGCTCCTGTCTGATGAGGACCACCAGGTGTGCGAACAATT
CGGCGTCTGGGGTGAAAAGTCCTTCATGGGCAAAACCTACGATGGCATTCATCGCATCAG
CTTCCTGATTGACGCTGATGGCAAAATCGAACATGTCTTTGACGATTTCAAAACCAGCAA
TCACCACGACGTTGTGCTGAACTGGCTGAAAGAACACGCCTGATTACTTTGCTCCATTCC
GTGCTGGCTGCGCTTGCGGCCAGCATACCTCACTTCTCGTGATCAAGATCACATTCTCGC
TTTCCCCTGCGACACGGGTGTCGAATCCATTTTTTGCTGAACGTTAATGACCATCATTTT
TGTACCGTTCAGAATCCAGTTAATACATAACTTATTGAATATATTGAGTTAATCAGAATG
GCATCCTTTATGCAATATGAAATGCAATGTTTCATATCATTTTCAAGGAGCCGACATGAA
CCGCTTTGTGGTGGCCGAACCACTGTGGTGTACAGGATGTAATACCTGTCTCGCTGCCTG
TTCGGACGTGCATAAAACGCAAGGTTTACAGCAACACCCGCGCCTGGCCCTGGCGAAGAC
GTCAACAATCACTGCCCCTGTCGTGTGTCATCACTGTGAGGAAGCCCCTTGCCTGCAGGT
CTGCCCGGTCAATGCCATCTCTCAGAGGGATGATGCGATCCAACTCAACGAAAGCCTCTG
TATTGGCTGCAAGCTTTGCGCCGTGGTCTGCCCATTTGGCGCAATCAGCGCTTCAGGAAG
CCGTCCGGTGAATGCCCATGCGCAATATGTTTTTCAGGCTGAAGGCTCACTCAAAGACGG
CGAAGAAAACGCGCCAACACAACATGCTTTGCTGCGCTGGGAACCTGGTGTCCAGACCGT
CGCGGTGAAATGCGACCTGTGTGATTTCTTGCCAGAAGGTCCGGCCTGCGTTCGCGCTTG
CCCGAATCAGGCGTTACGGCTGATCACCGGTGATAGCCTGCAACGTCAGATGAAAGAAAA
ACAGCGCCTTGCCGCAAGCTGGTTTGCCAATGGCGGGGAGGATCCCCTTTCCCTCACTCA
GGAGCAACGCTAATGGATGCCCTGCAATTATTAACCTGGTCGCTGATTCTCTATCTGTTT
GCTAGTCTGGCTTCGCTGTTTTTACTCGGTCTGGACAGACTGGCTATTAAGCTTTCCGGC
ATCACATCGCTGGTGGGCGGCGTGATTGGCATCATCAGCGGAATTACGCAATTACATGCT
GGTGTAACTTTAGTCGCCCGTTTTGCCCCCCCTTTTGAATTTGCCGATTTAACCCTGCGA
ATGGATAGCCTCTCGGCATTTATGGTGCTGGTTATCTCCTTGCTGGTGGTGGTTTGTTCT
CTCTATTCATTGACTTATATGCGCGAATACGAGGGCAAAGGCGCGGCGGCGATGGGCTTC
TTTATGAATATTTTCATCGCATCGATGGTTGCCCTGCTGGTGATGGACAACGCTTTTTGG
TTCATCGTGCTGTTTGAAATGATGTCGCTGTCTTCCTGGTTTCTGGTCATTGCCAGGCAG
GATAAAACGTCGATCAACGCTGGCATGCTCTACTTTTTTATCGCCCACGCCGGATCGGTG
CTGATAATGATCGCCTTCTTGCTGATGGGGCGCGAAAGCGGCAGCCTCGATTTTGCCAGT
TTCCGCACGCTTTCACTTTCTCCGGGGCTGGCGTCGGCGGTGTTCCTGCTGGCCTTTTTC
GGTTTTGGCGCGAAAGCCGGGATGATGCCGTTGCACAGCTGGTTGCCGCGCGCTCACCCT
GCCGCACCATCGCACGCTTCGGCGTTGATGTCTGGCGTAATGGTCAAAATAGGTATTTTC
GGCATCCTGAAAGTAGCGATGGATCTGCTGGCGCAAACGGGTTTGCCTCTGTGGTGGGGC
ATTCTGGTGATGGCGATCGGCGCAATCTCCGCGCTCCTGGGCGTGCTATATGCGCTGGCG
GAACAGGATATCAAACGGCTGCTGGCCTGGAGTACCGTCGAAAACGTCGGCATTATTTTG
CTGGCAGTCGGTGTGGCGATGGTCGGTCTGTCACTGCACGACCCGCTGCTCACCGTGGTT
GGACTGCTCGGCGCACTGTTTCATCTGCTCAACCATGCGCTGTTCAAAGGGCTGCTATTT
CTCGGCGCGGGAGCGATTATTTCGCGTTTGCATACCCACGACATGGAAAAAATGGGGGCA
CTAGCGAAACGGATGCCGTGGACAGCCGCAGCATGCCTGATTGGTTGCCTCGCGATATCA
GCCATTCCTCCGCTGAATGGTTTTATCAGCGAATGGTACACCTGGCAGTCGCTGTTCTCA
CTAAGTCGTGTGGAAGCCGTAGCGCTACAACTTGCGGGTCCTATTGCTATGGTAATGCTG
GCAGTCACTGGTGGGCTGGCAGTAATGTGCTTCGTAAAAATGTACGGTATTACTTTCTGT
GGTGCGCCGCGCAGTACACACGCTGAAGAGGCACAGGAAGTGCCAAATACGATGATCGTC
GCCATGCTACTGCTCGCGGCACTCTGCGTATTAATTGCGCTTAGTGCCAGTTGGCTGGCA
CCGAAGATAATGCATATTGCCCATGCGTTTACCAATACCCCTCCCGCCACTGTCGCCAGC
GGAATAGCACTTGTACCCGGCACGTTTCATACACAGGTCACCCCCTCATTACTGTTGCTG
TTACTACTGGCGATGCCTTTGCTGCCTGGCCTTTACTGGCTGTGGTGTCGTTCGCGCCGC
GCAGCGTTTCGTCGCACAGGAGATGCCTGGGCATGCGGCTACGGCTGGGAAAATGCGATG
GCCCCGTCAGGCAATGGCGTGATGCAGCCGCTGCGTGTGGTCTTTTCTGCGCTATTTCGT
CTACGACAACAGCTCGACCCTACGCTGAGGCTAAATAAAGGTCTTGCGCACGTCACCGCC
AGGGCTCAGAGCACAGAACCCTTCTGGGATGAGCGGGTGATCCGCCCCATCGTGAGCGCC
ACCCAACGGCTGGCCAAAGAAATACAGCATCTGCAAAGCGGCGACTTTCGTCTCTATTGC
CTGTATGTGGTCGCCGCACTGGTTGTGCTGCTAATCGCTATTGCCGTCTAAGGAAATCAC
CATGAGACAAACTCTTTGCGACGGATATCTGGTCATTTTTGCGTTAGCACAGGCCGTGAT
TCTGCTGATGCTAACCCCACTTTTTACGGGTATTTCCCGGCAGATACGCGCGCGTATGCA
CTCCCGCCGCGGGCCGGGGATCTGGCAGGATTATCGCGATATCCACAAACTGTTTAAACG
CCAGGAAGTTGCGCCGACATCTTCAGGTCTGATGTTCCGCCTGATGCCGTGGGTATTAAT
CAGCAGCATGCTGGTGCTGGCGATGGCCTTACCACTGTTTATTACCGTTTCCCCTTTTGC
GGGCGGCGGCGATCTGATCACCCTTATCTATCTTCTTGCCCTGTTTCGTTTTTTCTTTGC
TCTTTCCGGGCTGGATACCGGAAGTCCGTTTGCGGGAGTCGGTGCCAGTCGCGAGTTGAC
GCTCGGCATTCTGGTCGAACCAATGCTTATTCTCTCACTGCTGGTATTGGCGCTGATAGC
AGGTTCCACGCATATCGAGATGATCAGCAATACGCTGGCGATGGGCTGGAACTCGCCGCT
AACCACCGTACTGGCGTTACTGGCCTGTGGTTTTGCCTGCTTCATTGAGATGGGAAAAAT
TCCCTTTGATGTTGCTGAAGCAGAACAGGAATTACAGGAAGGCCCGCTGACCGAATATTC
CGGTGCCGGGCTGGCGCTAGCGAAATGGGGGCTGGGGCTGAAACAGGTCGTGATGGCATC
ACTGTTTGTGGCCCTGTTTCTGCCCTTTGGGCGCGCGCAAGAACTTTCTCTCGCCTGCCT
GCTGACTTCACTTGTCGTTACGCTGCTCAAGGTTTTGCTGATTTTTGTACTGGCCTCAAT
CGCAGAAAACACGCTGGCACGCGGGCGTTTTTTACTCATTCACCATGTGACCTGGCTTGG
CTTCAGCCTTGCTGCGCTTGCATGGGTCTTCTGGTTAACCGGTCTGTAAGGAGCACTGAC
GGAATATGGAAAATCTTGCTCTGACGACGTTATTGCTGCCTTTTATCGGCGCACTGGTCG
TTTCGTTTTCGCCACAACGTCGGGCCGCCGAATGGGGGGTTTTGTTCGCCGCGCTGACCA
CGCTGTGCATGTTGTCACTGATCTCCGCGTTTTATCAGGCCGATAAAGTTGCCGTCACGT
TGACGTTGGTCAACGTGGGGGATGTGGCGTTGTTTGGCCTGGTCATTGATCGCGTGAGTA
CGCTGATTCTGTTTGTGGTGGTGTTTCTCGGTTTGCTGGTCACGATCTACTCCACGGGTT
ATCTGACGGATAAAAATCGCGAACACCCGCATAACGGCACGAATCGTTATTACGCATTTT
TACTGGTGTTTATCGGCGCGATGGCGGGACTGGTACTCTCCTCGACGCTGCTCGGTCAGT
TGTTGTTTTTTGAAATTACAGGCGGCTGCTCCTGGGCGTTGATCAGTTATTACCAGAGCG
ATAAAGCGCAGCGTTCAGCACTAAAAGCGTTACTTATCACTCATATCGGCTCGTTGGGGT
TGTATCTTGCCGCCGCCACGCTGTTTTTGCAGACCGGAACGTTTGCGCTTAGCGCGATGA
GCGAGTTACACGGCGACGCACGTTATCTGGTTTATGGCGGCATCCTGTTTGCCGCGTGGG
GGAAATCGGCCCAGCTACCGATGCAAGCGTGGCTACCGGACGCAATGGAAGCGCCAACAC
CGATCAGCGCCTATCTCCACGCCGCATCGATGGTGAAAGTGGGCGTTTACATTTTTGCCC
GCGCTATTATCGACGGCGGCAATATCCCGCATGTGATTGGCGGCGTTGGCATGGTCATGG
CACTGGTCACCATTCTTTATGGCTTTCTGATGTATTTGCCACAGCAGGATATGAAGCGGT
TGCTAGCCTGGTCGACCATCACTCAACTTGGCTGGATGTTCTTCGGCTTGTCGCTCTCCA
TCTTCGGCTCGCGGCTGGCGCTGGAGGGCAGCATCGCCTACATCGTCAACCACGCGTTCG
CTAAAAGCCTGTTTTTCCTTGTAGCAGGTGCGCTGAGTTACAGCTGCGGCACGCGCTTGT
TGCCGCGTCTGCGTGGCGTATTGCACACCCTGCCGTTGCCAGGCGTGGGTTTCTGCGTGG
CAGCGCTGGCGATTACCGGCGTGCCGCCGTTCAACGGCTTCTTCAGTAAATTCCCGCTGT
TTGCTGCCGGTTTTGCGTTGTCAGTGGAGTACTGGATCCTGCTGCCCGCCATGATTCTTC
TGATGATTGAATCGGTCGCCAGTTTCGCCTGGTTTATTCGCTGGTTTGGTCGCGTTGTGC
CTGGCAAACCGAGCGAGGCCGTCGCCGATGCCGCACCGCTGCCAGGATCAATGCGCCTGG
TGTTGATTGTACTGATTGTGATGTCGCTGATTTCCAGCGTAATCGCCGCGACCTGGTTGC
AGTAAGGAGATGATGAATGACCGGTTCTATGATCGTAAATAATCTGGCGGGACTGATGAT
GCTGACATCGCTGTTTGTGATTAGCGTCAAAAGCTATCGCCTGTCATGCGGATTTTACGC
CTGCCAGTCACTGGTGCTGGTGTCTATTTTCGCCACTCTCTCGTGCCTGTTCGCCGCAGA
GCAACTGCTGATCTGGTCCGCCAGCGCCTTTATCACCAAAGTGCTGCTGGTACCGTTAAT
CATGACTTACGCTGCACGAAATATTCCCCAGAACATCCCGGAAAAAGCGTTATTCGGTCC
GGCAATGATGGCACTGCTCGCGGCGTTAATTGTCCTGCTTTGCGCATTTGTCGTTCAGCC
CGTGAAGCTACCGATGGCTACCGGGCTGAAACCGGCGCTGGCGGTAGCGTTAGGTCATTT
TCTGCTTGGCCTGCTGTGCATTGTCAGCCAGCGCAATATCCTGCGGCAAATTTTTGGTTA
CTGCCTGATGGAAAACGGCTCCCATCTGGTGCTGGCGCTTCTTGCCTGGCGAGCACCGGA
ACTGGTGGAAATAGGTATCGCTACCGACGCCATCTTCGCCGTCATTGTGATGGTGTTACT
GGCAAGAAAAATATGGCGTACCCACGGCACGCTGGACGTGAACAACTTGACCGCGCTGAA
GGGATAATGAGATGAGTTATTCTGTGATGTTCGCTTTACTCCTGCTCACGCCGCTGCTTT
TTTCGCTGCTCTGTTTTGCCTGCCGGAAACGGAGACTTTCTGCGACTCGCACGGTGACCG
TATTACATAGCTTAGGGATCACACTGCTGCTGATTCTGGCACTCTGGGTGGTCCAAACTG
CCGCTGATGCAGGAGAAATATTCGCTGCGGGACTGTGGCTTCATATTGATGGTCTGGGCG
GTTTGTTCCTCGCCATTCTTGGTGTGATTGGCTTTCTCACCGGTATTTACTCGATTGGCT
ACATGCGTCATGAAGTGGCACACGGCGAGCTTTCACCCGTTACGCTGTGCGATTACTACG
GTTTCTTCCATCTGTTTTTGTTCACCATGCTGCTGGTTGTTACCAGCAATAACCTGATTG
TGATGTGGGCGGCGATCGAAGCCACCACCTTAAGCTCGGCGTTTCTGGTAGGCATTTACG
GTCAGCGTTCATCGCTGGAAGCTGCATGGAAGTACATCATTATTTGTACTGTTGGTGTCG
CTTTTGGTCTGTTCGGTACCGTGCTGGTATACGCCAACGCCGCCAGCGTTATGCCGCAGG
CAGAAATGGCGATATTCTGGAGCGAGGTTCTTAAGCAATCGTCCTTGCTTGACCCAACAT
TAATGCTGTTGGCCTTTGTGTTTTTGCTAATTGGCTTTGGTACCAAAACCGGGCTATTTC
CCATGCACGCCTGGCTGCCGGATGCTCACAGTGAAGCGCCGAGTCCGGTCAGCGCCCTGC
TCTCCGCCGTATTGCTGAACTGCGCGCTGTTGGTGCTGATTCGCTATTACATCATTATTT
GCCAAGCCATCGGCAGCGATTTCCCCAACCGGTTGTTGCTCATCTTCGGCATGTTGTCGG
TTGCCGTGGCGGCATTTTTCATTCTGGTACAGCGGGACATTAAGCGTCTGCTGGCGTACT
CCAGCGTGGAGAACATGGGGCTGGTCGCGGTGGAGCTAGGCATTGGCGGGCCGCTGGGAA
TTTTTGCCGCGCTGCTGCACATCTTAAACCACAGTCTGGCAAAAACGCTGCTGTTCTGCG
GTTCCGGCAATGTACTGCTCAAGTACGGCACGCGCGATCTCAACGTCGTCTGTGGGATGC
TCAAAATCATGCCATTTACCGCCGTGCTGTTTGGCGGCGGTGCGCTGGCGCTGGCAGGGA
TGCCGCCCTTCAACATTTTTCTTAGCGAATTTATGACCATTACCGCCGGACTGGCACGTA
ATCACCTGCTGATTATCGTCCTGCTGTTATTGCTGTTAACGCTGGTGCTGGCGGGCCTGG
TACGGATGGCTGCGCGGGTGTTAATGGCGAAACCGCCGCAGGCCGTTAACCGGGGTGATC
TCGGCTGGTTGACCACCTCGCCAATGGTGATTCTGCTGGTCATGATGCTGGCGATGGGAA
CGCATATTCCACAACCTGTCATCAGGATCCTGGCGGGCGCTTCCACTATAGTCCTCTCAG
GGACGCACGATCTGCCTGCACAACGTAGCACCTGGCATGATTTTTTGCCTTCAGGCACCG
CATCTGTTTCGGAGAAACACAGTGAACGTTAATTCATCGTCAAATCGTGGCGAAGCGATT
CTCGCCGCCCTGAAAACGCAGTTCCCCGGCGCGGTGCTGGATGAAGAGCGACAAACGCCT
GAACAGGTCACCATTACGGTGAAAATCAATCTGCTGCCTGACGTTGTACAGTATCTTTAT
TATCAACATGATGGCTGGCTTCCGGTCCTGTTTGGCAACGACGAGCGGACACTTAACGGT
CATTACGCGGTTTATTATGCCCTTTCAATGGAAGGGGCCGAAAAATGCTGGATTGTGGTG
AAGGCGCTGGTCGATGCCGACAGTCGGGAGTTTCCGTCAGTCACACCGCGCGTCCCTGCC
GCGGTCTGGGGCGAGCGAGAAATTCGCGATATGTACGGGCTGATTCCGGTTGGCCTGCCG
GATCAGCGTCGCCTGGTGTTGCCCGATGACTGGCCGGAAGATATGCATCCGCTGCGCAAA
GATGCGATGGATTATCGACTGCGCCCTGAACCGACGACTGATTCCGAAACGTATCCGTTT
ATCAATGAGGGCAACAGCGATGCGCGGGTGATCCCTGTCGGCCCGCTGCATATCACCTCC
GATGAACCGGGTCACTTCCGCTTGTTTGTGGATGGCGAGCAAATTGTCGATGCTGATTAC
CGCCTGTTTTATGTCCATCGCGGCATGGAGAAACTGGCAGAAACGCGGATGGGCTACAAC
GAAGTGACCTTCTTATCGGACCGCGTGTGTGGGATTTGCGGTTTTGCCCACAGTGTGGCC
TATACCAATTCGGTTGAAAATGCACTGGGGATTGAGGTGCCGCAACGAGCACATACTATT
CGCTCGATTCTGCTGGAAGTCGAACGGCTACACAGTCATTTGCTTAACCTTGGCCTCTCC
TGCCATTTCGTTGGTTTTGATACCGGCTTTATGCAATTTTTCCGCGTGCGGGAAAAGTCG
ATGACGATGGCGGAATTGCTGATCGGGTCGCGTAAAACCTACGGTCTGAATCTGATTGGT
GGTGTTCGCCGCGATATTCTCAAAGAGCAACGTCTGCAAACGCTGAAACTGGTGCGCGAG
ATGCGCGCCGACGTGTCGGAGCTGGTAGAGATGCTGCTTGCTACGCCGAATATGGAACAA
CGCACTCAGGGCATTGGCATTCTCGACCGACAAATCGCCCGTGATTTGCGCTTTGATCAC
CCCTACGCCGACTACGGCAATATTCCAAAAACACTGTTTACCTTTACCGGCGGCGATGTT
TTCTCCCGCGTGATGGTCCGTGTCAAAGAGACGTTTGATTCGCTGGCAATGCTGGAATTT
GCCCTCGACAACATGCCGGATACCCCACTGCTGACCGAAGGCTTTAGCTATAAACCTCAC
GCATTCGCGCTGGGCTTTGTTGAAGCGCCACGCGGTGAAGACGTGCACTGGAGCATGCTC
GGTGATAACCAAAAATTGTTCCGCTGGCGCTGCCGTGCCGCCACCTACGCCAACTGGCCG
GTGTTGCGTTACATGCTGCGCGGCAATACCGTTTCTGACGCACCGCTGATTATCGGTAGC
CTTGATCCCTGCTACTCCTGTACCGACCGTGTGACGCTGGTAGATGTGCGCAAGCGCCAG
TCAAAAACCGTGCCGTATAAAGAGATCGAACGCTACGGCATTGATCGTAACCGTTCGCCG
CTGAAGTAAGGACAGAAGATGCTGAAGTTACTGAAAACTATTATGCGCGCCGGAACCGCG
ACGGTGAAATATCCCTTCGCGCCACTGGAGGTCAGCCCTGGCTTTCGCGGAAAACCGGAC
CTGATGCCCAGCCAATGTATTGCCTGCGGTGCCTGCGCCTGTGCTTGTCCGGCAAATGCG
CTGACTATCCAGACCGACGACCAGCAAAATTCGCGCACCTGGCAGCTCTATCTGGGGCGT
TGTATTTACTGCGGACGTTGTGAAGAAGTGTGCCCGACCAGAGCCATCCAGCTTACCAAT
AACTTTGAACTGACCGTCACCAATAAAGCCGATCTCTATACCCGCGCGACGTTCCATCTA
CAACGTTGCAGCCGTTGCGAACGCCCGTTTGCCCCGCAAAAAACCATCGCACTGGCTGCT
GAATTGTTAGCACAGCAACAAAATGCGCCACAAAACCGCGAAATGTTGTGGGCGCAAGCG
AGCGTCTGCCCGGAATGCAAACAACGCGCGACGCTGATCAACGACGATACAGATGTACTG
CTGGTGGCTAAGGAGCAGCTATGAGTCCAGTGCTTACACAACATGTCAGCCAGCCCATCA
CGCTGGACGAGCAAACGCAAAAGATGAAGCGGCATTTGCTACAGGATATCCGTCGCTCGG
CTTACGTTTATCGCGTCGATTGCGGCGGCTGCAACGCCTGTGAAATCGAAATTTTTGCTG
CCATTACACCAGTATTCGACGCAGAACGTTTTGGCATTAAGGTTGTTTCATCACCGCGTC
ACGCCGATATTTTGTTATTTACTGGCGCAGTCACCCGGGCGATGCGTATGCCTGCACTTC
GGGCGTATGAGTCTGCCCCCGATCATAAAATTTGTGTTTCCTACGGCGCGTGCGGTGTCG
GCGGCGGTATTTTCCACGATCTCTACAGCGTCTGGGGCGGTAGCGACACCATTGTCCCCA
TTGATGTTTGGATCCCCGGCTGCCCGCCAACACCGGCCGCCACCATTCACGGTTTCGCCG
TGGCGCTCGGTTTGCTGCAACAGAAGATTCACGCTGTGGATTATCGCGATCCCACCGGGG
TGACTATGCAACCGTTGTGGCCGCAGATCCCGCCATCACAGCGTATCGCCATTGAGCGAG
AAGCGCGGCGGCTGGCGGGCTATCGTCAGGGGCGAGAAATTTGCGATCGGCTCCTGCGCC
ATTTAAGCGACGATCCTACAGGAAATCGGGTTAACACCTGGTTGCGCGATGCCGACGATC
CACGTCTCAATAGTATCGTTCAGCAACTCTTTCGCGTACTCCGGGGGTTACATGACTGAA
GAGTGCGGGGAAATTGTTTTCTGGACGCTGCGAAAAAAGTTTGTCGCCAGTAGCGACGAG
ATGCCGGAACACAGCTCTCAGGTAATGTATTACTCGCTAGCTATCGGCCATCACGTTGGC
GTGATTGATTGTCTGAATGTCGCCTTCCGCTGCCCACTGACGGAATACGAAGATTGGCTT
GCACTGGTCGAAGAGGAGCAAGCCCGACGTAAGATGCTGGGGGTGATGACTTTTGGTGAG
ATTGTTATTGACGCCAGCCACACCGCCCTGTTGACCCGGGCATTCGCGCCACTGGCGGAT
GACGCGACGTCTGTGTGGCAGGCGCGTAGCATTCAATTCATTCATCTGTTGGATGAAATT
GTGCAGGAACCGGCCATCTATCTGATGGCCAGAAAAATTGCGTGAGAAGGATTTCTCATT
AATAAGGACTGTTGATGGCTATGTCAGACGAGGCGATGTTTGCCCCGCCACAAGGAATAA
CAATTGAAGCGGTAAACGGAATGCTCGCGGAGCGGTTAGCACAGAAACACGGCAAGGCGT
CTTTATTACGCGCCTTCATCCCGCTGCCGCCGCCGTTCAGCCCGGTACAACTTATTGAAC
TGCATGTTCTCAAAAGCAACTTCTATTACCGCTACCATGATGATGGCAGCGATGTGACGG
CAACAACAGAGTATCAGGGCGAGATGGTCGATTATTCGCGTCACGCCGTCCTTCTCGGCA
GTAGTGGAATGGCGGAGCTACGCTTTATTCGCACCCACGGCAGTCGTTTTACTTCCCAGG
ATTGCACACTGTTTAACTGGCTGGCGCGGATAATCACCCCGGTTCTGCAATCATGGCTCA
ATGATGAAGAACAGCAGGTGGCGCTGCGTTTGCTGGAGAAAGATCGCGATCATCATCGGG
TACTGGTTGATATTACTAATGCAGTGCTGTCACATCTTGATCTCGACGATCTGATCGCTG
ACGTCGCTCGTGAGATCCATCATTTTTTCGGTCTGGCTTCAGTCAGTATGGTACTGGGCG
ATCATCGAAAGAACGAGAAGTTCAGCCTGTGGTGCAGCGATCTTTCTGCCTCACATTGTG
CGTGTCTGCCACGCTGTATGCCTGGCGAAAGTGTATTGCTGACACAAACGCTACAAACCC
GACAACCGACCTTGACGCACCGTGCAGATGATCTGTTTCTCTGGCAACGCGACCCGTTAT
TACTCTTACTTGCATCTAACGGCTGCGAATCTGCGCTCCTTATACCGCTTACCTTTGGCA
ACCATACACCGGGTGCATTGTTGCTGGCGCATACCTCTTCCACTCTCTTTAGTGAGGAAA
ACTGCCAGCTACTACAACACATAGCCGATCGCATCGCTATTGCCGTTGGCAATGCCGATG
CCTGGCGTAGCATGACCGATTTGCAGGAAAGTTTGCAGCAAGAAAACCACCAGCTTAGCG
AGCAGCTCCTTTCGAATCTGGGCATCGGTGACATTATCTATCAAAGCCAGGCAATGGAAG
ACCTGCTCCAGCAGGTAGATATTGTGGCGAAGAGCGACAGTACGGTGTTGATTTGTGGTG
AAACCGGAACTGGCAAAGAGGTGATCGCCAGAGCGATCCATCAACTTAGCCCGCGACGCG
ACAAGCCGCTGGTCAAAATCAACTGCGCTGCCATCCCCGCCAGTCTTCTGGAAAGTGAGT
TATTCGGTCATGACAAAGGGGCGTTTACTGGTGCGATTAATACCCATCGTGGTCGTTTTG
AAATTGCCGATGGCGGCACGTTGTTTCTCGATGAAATTGGCGATCTGCCGTTAGAACTTC
AGCCTAAACTGCTGCGCGTATTGCAGGAGCGGGAGATTGAGCGTCTCGGCGGGAGTAGAA
CGATCCCGGTGAATGTCAGAGTCATTGCCGCCACCAACCGTGATTTGTGGCAAATGGTTG
AAGATCGCCAGTTTCGCAGCGATCTCTTTTATCGCCTGAATGTCTTCCCACTGGAATTGC
CGCCGCTACGCGACCGTCCGGAAGATATCCCTCTTTTAGCAAAACATTTCACGCAAAAAA
TGGCGCGCCATATGAATCGCGCAATTGACGCCATCCCGACCGAGGCACTACGCCAGTTGA
TGTCGTGGGATTGGCCGGGCAACGTGCGCGAGCTGGAAAACGTGATTGAGCGGGCGGTAC
TGTTGACTCGTGGTAACAGTCTGAATTTACATCTAAATGTCCGACAAAGCCGTTTACTGC
CGACGCTAAATGAAGATTCAGCGCTTCGCAGTTCAATGGCGCAGTTACTGCACCCGACGA
CGCCAGAGAATGACGAAGAAGAACGTCAGCGCATTGTTCAGGTATTGCGAGAAACCAATG
GCATTGTTGCCGGGCCCCGTGGCGCAGCGACGCGATTAGGGATGAAGCGCACCACGCTGC
TGTCACGAATGCAGCGGCTGGGGATCTCGGTTCGCGAGGTGTTGTAATCTGCTTTTGCAG
GAGTATGCATGAGAAACAAACTCTCTTTCGACTTGCAGTTGAGCGCCAGAAAAGCGGCAA
TCGCTGAACGGATTGCCGCCCATAAAATTGCCCGCAGTAAAGTGTCGGTCTTTTTAATGG
CGATGTCCGCTGGCGTGTTTATGGCGATCGGATTTACTTTTTACCTTTCCGTTATCGCCG
ATGCCCCGTCTTCACAGGCATTAACCCATCTGGTGGGCGGCCTTTGCTTTACACTCGGCT
TTATTTTGCTGGCGGTTTGCGGCACCAGCCTGTTCACCTCGTCGGTAATGACGGTGATGG
CAAAAAGTCGGGGCGTTATTAGTTGGCGAACTTGGCTGATTAACGCACTTCTGGTGGCCT
GCGGTAATCTGGCAGGTATTGCCTGTTTCAGTTTGTTAATCTGGTTTTCCGGGCTGGTGA
TGAGTGAAAACGCGATGTGGGGAGTCGCGGTTTTACACTGCGCCGAGGGCAAAATGCATC
ATACATTTACTGAATCTGTCAGCCTCGGCATTATGTGCAATCTGATGGTTTGCCTGGCGC
TGTGGATGAGTTATTGCGGGCGTTCGTTATGCGACAAAATCGTCGCCATGATTTTGCCCA
TCACCCTGTTTGTCGCCAGTGGCTTTGAGCACTGTATCGCCAATTTGTTTGTGATTCCGT
TCGCCATTGCCATTCGCCATTTCGCCCCTCCCCCCTTCTGGCAGCTGGCGCACAGTAGCG
CAGACAATTTTCCGGCACTGACGGTCAGCCATTTTATTACCGCCAATCTGCTCCCGGTGA
TGCTGGGTAATATTATCGGCGGTGCGGTGCTGGTGAGTATGTGTTATCGGGCTATTTATT
TACGTCAGGAACCCTGAAAAATCAGCCCGGCGAAACAGTTCGTCGGGCTGAAGATTATTC
TTGCGCGATTTGCCCATCGGGCCAGGCATGAATCACGGCTTTGATCAGCGTCGCCAACGG
AATGGCGAAGAATACGCCCCAGAATCCCCACAAACCACCGAAGATCACCACCGATAAAAT
AATCACCAGCGGATGCAGGTTAACCGCTTCGGAGAACAACACCGGCACTAACAGGTTGCC
GTCCAGCGCCTGAATAATCAGATACACCGCGAAGCAGCTCCAGAATTCAGTACCTGCGCC
AAACTGGAATAGCGCCACGCCAACCACCGGAATGGTCACCACAAATGCGCCAATGTACGG
AATAAGAACCGAGAAGCCGACCAGCACTGCCAGCAGCAGCGAATAGTTCAGCCCGAAGAG
CAAGAACCCCAGCCAGGTGGCGATCCCCACCACGATCATCTCCAGCACTTTGCCGCGGAT
ATAGTTGGTGATTTGTTGATTCATCTCCTTCCACACCTGTCCTGCCAGCCCACGGTTACG
CGGCAGCACCCGGCGAACGGCGTTCAGCATCTGCTCTTTGTCTTTCAGCAGGAAGAAGAC
CATCAATGGCACCAGCACCAGATAGACGGCTATGGTCAGCAAACCGACCAGCGAGGCGAG
GGAAATTTTCACCACCGAATCGCCCATGGTCAGCATCCGACTGCGCATATTTTCGGCCAT
TGCATCAATAATGCCCGCGTCCATTAACGCCGGATAGCGGCGCGGCAACGTGGCGGCAAA
GTCAGAAAGCTTATTGAGCATCCCCGGCATATCGCGGATTAAGTAGATGCCCTGTTGCCA
GGCGATAGGCAGTACCACGAACGCCATCAGTAGCAATATACCGACGAAAACCACCAATAC
AATCGACGTCGCCCAGCGGCGGGAGCAGCCAATAGATTGCAGACGCACGGTTGGCCATTC
CAGCAAATAGGCCAGCACAATAGCCACCAGCAACGGAGCAAGCAGGCCACTAAAGAAAAA
GATAATGCCAAATCCGGCAACTAAAATAACCAGCAAGGCAATCGCTTCCGGGTCGCTAAA
ACGGCGGCGATACCATTGCATCAACATTTCGAGCATAAAGACCTTCCCTGAACCTCAAGA
GCGGGATTGCGATCCGCAATTGTATCGAAATGTCACAAAAAAGACTTCGCTTTTTATGAC
GGATTCAGGAAACTGAAAAGTCATTTGAGTGGGCTAATCTTCGCCGTTACACTCAAAGGC
GGCGCGGTGGGAACGATATTTCACAGTATCGGTCAAATGACTATCTCCAGAAATACAGGA
TAGAGGTTATGTTCAGGCAGTTGAAAAAAAACCTGGTTGCAACCCTCATTGCTGCTATGA
CCATTGGTCAGGTAGCCCCGGCGTTTGCCGACAGCGCAGACACCTTGCCGGATATGGGAA
CCTCCGCAGGAAGCACGCTTTCCATTGGTCAGGAAATGCAGATGGGCGACTATTATGTCC
GCCAGCTACGCGGCAGCGCGCCGTTAATTAATGACCCGCTGTTAACGCAATATATTAATT
CGCTGGGGATGCGTCTGGTTTCGCATGCCAATTCGGTTAAGACACCGTTTCATTTTTTTC
TGATCAACAACGACGAAATTAACGCCTTTGCTTTCTTTGGCGGCAACGTGGTGCTGCACT
CTGCCCTGTTCCGTTATTCCGATAACGAAAGTCAACTGGCTTCAGTTATGGCGCACGAAA
TCTCCCACGTCACCCAACGTCACCTGGCGCGAGCGATGGAAGATCAGCAGCGCAGCGCGC
CGCTGACCTGGGTCGGCGCGTTAGGTTCTATTTTACTGGCGATGGCCAGTCCGCAGGCGG
GGATGGCGGCGCTGACCGGTACACTGGCGGGAACGCGTCAGGGGATGATCAGTTTCACCC
AGCAAAATGAACAGGAAGCGGACCGCATTGGTATTCAGGTGCTGCAACGCTCGGGATTCG
ATCCGCAGGCGATGCCAACCTTCCTCGAAAAATTACTCGATCAGGCGCGTTACTCCTCGC
GCCCGCCGGAAATTTTATTGACTCACCCGTTGCCGGAAAGTCGTCTGGCAGATGCCCGCA
ACCGTGCTAATCAGATGCGCCCGATGGTGGTGCAGTCGTCGGAAGATTTCTATCTGGCGA
AAGCGCGCACACTGGGGATGTATAATTCCGGACGTAACCAGCTCACCAGTGATTTGCTGG
ATGAATGGGCGAAAGGAAACGTTCGTCAGCAACGAGCAGCACAATATGGTCGTGCTTTAC
AGGCGATGGAAGCCAATAAATACGACGAGGCGCGTAAAACGCTGCAACCGTTACTGGCGG
CAGAACCTGGCAACGCATGGTATCTCGATCTGGCTACTGATATCGATCTTGGGCAAAACA
AAGCCAATGAGGCGATCAATCGTCTGAAAAATGCCCGCGATTTACGCACCAATCCGGTGT
TGCAGCTCAACCTGGCGAACGCTTATTTGCAAGGCGGTCAACCACAAGAAGCGGCCAATA
TTCTGAATCGCTACACCTTTAATAATAAAGATGACAGCAACGGCTGGGATTTGCTGGCAC
AGGCGGAAGCCGCGCTAAATAACCGCGATCAGGAGCTGGCTGCGCGAGCAGAAGGTTATG
CGCTCGCCGGACGACTCGATCAGGCCATTTCGCTGTTGAGTAGCGCCAGTTCGCAGGTGA
AATTAGGCAGCCTGCAACAAGCGCGTTACGATGCGCGCATCGACCAGTTGCGCCAGCTGC
AGGAACGCTTTAAGCCTTATACCAAGATGTAATTCGCATTAAAGGAAGAACAATGACCAA
ACAGGTAAAAATCTACCATAACCCACGCTGTTCAAAGAGCCGGGAAACGCTGAACCTGCT
GAAAGAAAACGGCGTGGAGCCAGAAGTGGTGCTCTACCTTGAGACACCCGCCGATGCGGC
AACGCTGCGCGATTTGCTGAAAATACTGGGGATGAATAGCGCCCGTGAATTGATGCGCCA
GAAAGAGGATCTTTATAAAGAACTGAACCTGGCTGACAGTTCGCTTAGCGAAGAGGCGCT
GATTCAGGCAATGGTGGATAATCCGAAGCTGATGGAGCGCCCGATTGTGGTCGCGAATGG
CAAAGCGCGGATTGGTCGTCCACCGGAGCAGGTACTGGAAATCGTGGGTTAAGATGTGCT
CCATCGCTAGTTGAAGCACATTGCCGGATGCGACGCTTGCCACGTCTTATCCGGCCTACG
AATACTATGGATTAACTTCGCGTAGTTCGGATAAGGCGTTCGCGCCGCATCCGACAATAA
ACACCTTATCTACAACTTCAGAATTTCTTTCACAAACGGAATGGTCAGCTTACGTTGCGC
GGTAATCGACGCACGATCCAACTGATCCAACGTCATAAATAGCGTGCGCATTTCTCTGTC
GAGCCGCTTCAGCAAGAAACGCCCCACATCTTCCGGCAGTTCAAAACCACGCAAACGCGC
GCGTAACTGTAGCGCCTGCAACTTATCTTCATCAGAAAGTGGCTGCAATTTGTAGATCTG
CCCCCAGTCGAGTCGCGACGCGAGATCCGGTAATCCCAGATTCAACTGCCGCGGTGGACG
ATCGCCGGTGATCAACAACCGTGTTTTGCCCGATTCCAGAATTCGATTGTAGAGATCGAA
AATCGCCATCTCCCACAACTCATCGCCTGCAATACACTCAATGTTGTCGATACAGACCAG
CGACAAATGCTCCATACCGTCGAGCACTTCCGGAACAAACCAGGTGCGTTTATCCAGCGG
GACATAGCCCACCGCATCGCCACGCTGCGACAATTCCGCGCAAGCCGCGTGCAGCAGATG
GCTGCGCCCCGCGCCTTCGCGTGCCCAGAGATAGATGTAACCGCTATGTTCCTGACGCAG
CACGTTTTGCAGCGCGGCCAGTAAAGAGGAGTTATCCCCCGGCCAGAAACTTGCAAAGGT
TTCGTCGTCAGGAAGATAAAGTGGCAAAGAGAGCTGTGCCGGTGTGTTCAGAGATACCTC
AACCAGGATTTCACAAAATCGCGAGAAGTTTACCACAGAATCCCATGATGTTTGAACCGG
GCAGCAACACTGCCCGGTCGGTACATTATTTGTCTGTTATATCCGCGTCTTCTGCGTCCA
GCACCACTTCTTCAGGGCGCAGCACACTGATCAGTTTGAAGATCAAACTTAAGCCGATAC
CGACGATGGTCGCCAGCGCCATACCTTTTAACTCCGCCGCGCCGATGTTTACCTTCGCGC
CACTGACGCCGATGATCAAAATCACGGAAGTCAGGATCAGGTTCTGTGCTTTGTTGTAAT
CCACTTTCGATTCGATCAAAACACGAATACCGGAAGCACCGATGACACCATAAAGCAGCA
GCGAAACGCCGCCCATCACCGGCAATGGGATCATCTGGATAGCGGCAGCCAGTTTACCGA
CGCAGGAAAGCAGGATAGCGAAAATCGCCGCCCCGCCGATAACCCAGGTACTGTAAACAC
GGGTGATCGCCATCACGCCAATGTTTTCTCCGTAAGTAGTATTTGGCGTAGAGCCAAAGA
AGCCGGAAATCACGGTCGACAAGCCATTAGCAAACATCGAACGGTGCAGACCTGGATCGC
GCAGCAGATCTTTTTTGACGATATTAGCCGTTACTACCAGGTGCCCTACGTGTTCGGCAA
TAACCACTAACGCCGCTGGCAGAATAGTCAGAATGGCAAACCACTCGAAGCGCGGCGTAT
AGAGGGTTGGCAGCGCAAACCAGTGAGCATTAATAATCGGCGTGGTATCGACAATTCCCA
TTGCGAAAGAGAGCGCGTACCCCACCAGCACGCCAATTAAAATCGGGATAATTGCCAGGA
AACCACGAAACAGCACGGAACCTAAAACCGTGACCGCCAGGGTGGTAATAGAGATGATGA
TGGTTTTGGAGTCTGGCGTTTGCCCTTCAGCCGGGAGTAAACCCGCCATACCGGCAGCTA
CGCCCGCCAGCTCCAGACCGATGACGGCAACGATTGCGCCCATTGCCGCAGGTGGAAACA
GCACGTCCAGCCAGCCGGTCCCCGCTTTCTTCACGATAAAAGAAACCAGGCAGAACAGCA
CGCCGCACATAATAAAGCCGCCCAGCGCGACTTCATACCCTAACGGCAACAGTAACAATA
CCGGTGAAATAAAGGCAAAGCTGGAACCAAGATAAGCCGGAATTTTCCCTTTACAGATGA
AGAGATACAGCAGCGTTCCAATACCGTTAAATAACAGTACAGTCGCCGGGTTAATATGAA
ATAAGACGGGCACCAGGACGGTTGCACCAAACATGGCGAACAAATGTTGCAAACTAAGCG
GGATTGTCTGTAAAAGTGGCGGTCTTTCACTCACCCCGATAGCACGGCGCGTCATAGTAT
TATCCTCTGTATTATGTGTTATAGGCGCTTTACTCAAAAAAAAGCCGACTCTTAAAGTCG
GCTTTAATTATTTTTATTCTTTATTTCGTACCAAAGATTTTGTCACCGGCATCGCCGAGG
CCCGGAATAATGTATCCGTGCTCGTTCAGTCCCTGATCAATCGATGCGGTATACAGTTCG
ACGTCCGGGTGCGCTTTTTCCAGCGCAGCGATACCTTCTGGCGCAGCTACCAGCACCAGA
ACTTTGATGCTGCTGCAGCCCGCTTTTTTCAGCAGGTCGATGGTCGCGATAACGGAACCA
CCGGTTGCCAGCATTGGGTCAACGATCAGCGCCATACGCTCATCGATGTTAGAAACCAGT
TTCTGGAAGTACGGTACCGGCTCCAGCGTTTCTTCATTACGGTACATACCGACAACGCTG
ATGCGCGCGCTCGGAACGTTTTCCAGCACACCGTCCATCATACCAAGACCCGCACGCAGA
ATTGGCACAACGGTAATTTTCTTACCTTTGATCTGGTCGATTTCTACCGGGCCGTTCCAG
CCTTCGATAGTTACTTTTTCCGTTTCGAGGTCGGCGGTCGCTTCGTAAGTCAGCAGGCTA
CCCACTTCGGAAGCGAGTTCGCGAAAGCGCTTGGTGCTGATATCTTGCTCACGCATCAGT
CCCAGCTTGTGTTTGACGAGTGGGTGTTTGACTTCCACGATCTTCATACTCTTTCTCCTT
TGAGGGGCAGCCACAAAAAAAATCGACGGATTATACCTCCTTTCTTCAAGGCGGCAATAT
TCTTTTCGTTGACTTTAGTCAAAATGATAACGGTTTGAGATAAAGTTATTTTATATTCAG
ATGGTTATGAAAGAAGATTATTCCATCCGAAAACTAACCTTTACCCTGGCACAAGTCTTC
TTTCGCCGCGCGCCTGGGGAAAAGACGTGCAAAAAGGTTGTGTAAAGCAGTCTCGCAAAC
GTTTGCTTTCCCTGTTAGAATTGCGCCGAATTTTATTTTTCTACCGCAAGTAACGCGTGG
GGACCCAAGCAGTGACCGATAAAACCTCTCTTAGCTACAAAGATGCCGGTGTTGATATTG
ACGCGGGTAATGCTCTGGTTGGAAGAATCAAAGGCGTAGTGAAGAAAACGCGTCGTCCGG
AAGTGATGGGCGGTCTGGGCGGCTTCGGTGCGCTGTGTGCATTGCCGCAAAAATATCGTG
AACCCGTGCTGGTTTCTGGCACTGACGGCGTAGGTACCAAGCTGCGTCTGGCAATGGACT
TAAAACGTCACGACACCATTGGTATTGATCTGGTCGCCATGTGCGTTAATGACCTGGTGG
TGCAAGGTGCAGAGCCGCTGTTTTTCCTCGACTATTACGCAACCGGAAAACTGGATGTTG
ATACCGCTTCAGCGGTGATCAGCGGCATTGCGGAAGGTTGTCTGCAATCAGGCTGTTCAC
TGGTGGGTGGCGAAACGGCAGAAATGCCGGGGATGTATCACGGTGAGGATTACGATGTCG
CGGGTTTCTGCGTTGGCGTGGTAGAAAAATCAGAAATCATCGACGGCTCTAAAGTCAGCG
ACGGCGATGTGCTGATTGCACTCGGTTCCAGCGGTCCACACTCGAACGGCTATTCGCTGG
TGCGCAAAATTCTTGAAGTCAGCGGTTGTGATCCGCAAACCACCGAACTTGATGGTAAGC
CATTAGCCGATCATCTGCTGGCACCGACCCGCATTTACGTGAAGTCAGTGCTGGAGTTGA
TTGAAAAGGTCGATGTGCATGCCATTGCGCACCTGACCGGCGGCGGCTTCTGGGAAAACA
TTCCGCGCGTATTGCCAGATAATACTCAGGCAGTGATTGATGAATCTTCCTGGCAGTGGC
CGGAAGTGTTCAACTGGCTGCAAACGGCAGGTAACGTTGAGCACCATGAAATGTATCGCA
CCTTCAACTGCGGCGTCGGGATGATTATTGCCCTGCCTGCTCCGGAAGTGGACAAAGCCC
TCGCCCTGCTCAATGCCAACGGTGAAAACGCGTGGAAAATCGGTATCATCAAAGCCTCTG
ATTCCGAACAACGCGTGGTTATCGAATAATGAATATTGTGGTGCTTATTTCCGGCAACGG
AAGTAATTTACAGGCAATTATTGACGCCTGTAAAACCAACAAAATTAAAGGCACCGTACG
GGCAGTTTTCAGCAATAAGGCCGACGCGTTCGGCCTTGAACGCGCCCGCCAGGCGGGTAT
TGCAACGCATACGCTCATCGCCAGCGCGTTTGACAGTCGTGAAGCCTATGACCGGGAGTT
GATTCATGAAATCGACATGTACGCACCCGATGTGGTCGTGCTGGCTGGTTTTATGCGCAT
TCTCAGCCCGGCGTTTGTCTCCCACTATGCCGGGCGTTTGCTGAACATTCACCCTTCTCT
GCTGCCGAAATATCCCGGATTACACACCCATCGTCAGGCGCTGGAAAATGGCGATGAAGA
GCACGGTACATCGGTGCATTTCGTCACCGATGAACTGGACGGTGGCCCGGTTATTTTACA
GGCGAAAGTCCCGGTATTTGCTGGTGATTCGGAAGATGACATCACCGCCCGCGTGCAAAC
CCAGGAACACGCCATTTATCCACTGGTGATTAGCTGGTTTGCCGATGGTCGTCTGAAAAT
GCACGAAAACGCCGCGTGGCTGGATGGTCAACGTCTGCCGCCGCAGGGCTACGCTGCCGA
CGAGTAATACCCCCGTAATTAAAGCGCCAGCTCTGCCGCTGGCGTTTTTCAATTCACCTG
TAAATCGCAAGCTCCAGCAGTTTTTTTCCCCCTTTTCTGGCATAGTTGGACATCTGCCAA
TATTGCTCGCCATAATATCCAGGCAGTGTCCCGTGAATAAAACGGAGTAAAAGTGGTAAT
GGGTCAGGAAAAGCTATACATCGAAAAAGAGCTCAGTTGGTTATCGTTCAATGAACGCGT
GCTTCAGGAAGCGGCGGACAAATCTAACCCGCTGATTGAAAGGATGCGTTTCCTGGGGAT
CTATTCCAATAACCTTGATGAGTTCTATAAAGTCCGCTTCGCTGAACTGAAGCGACGCAT
CATTATTAGCGAAGAACAAGGCTCCAACTCTCATTCCCGCCATTTACTGGGCAAAATTCA
GTCCCGGGTGCTGAAAGCCGATCAGGAATTCGACGGCCTCTACAACGAGCTATTGCTGGA
GATGGCGCGCAACCAGATCTTCCTGATTAATGAACGCCAGCTCTCCGTCAATCAACAAAA
CTGGCTGCGTCATTATTTTAAGCAGTATCTGCGTCAGCACATTACGCCGATTTTAATCAA
TCCTGACACTGACTTAGTGCAGTTCCTGAAAGATGATTACACCTATCTGGCGGTGGAAAT
TATCCGTGGCGATACCATCCGTTACGCGCTGCTGGAGATCCCATCAGATAAAGTGCCGCG
CTTTGTGAATTTACCGCCAGAAGCGCCGCGTCGACGCAAGCCGATGATTCTTCTGGATAA
CATTCTGCGTTACTGCCTTGATGATATTTTCAAAGGCTTCTTTGATTATGACGCGCTGAA
TGCCTATTCAATGAAGATGACCCGCGATGCCGAATACGATTTAGTGCATGAGATGGAAGC
CAGCCTGATGGAGTTGATGTCTTCCAGTCTCAAGCAGCGTTTAACTGCTGAGCCGGTGCG
TTTTGTTTATCAGCGCGATATGCCCAATGCGCTGGTTGAAGTGTTACGCGAAAAACTGAC
TATTTCCCGCTACGACTCCATCGTCCCCGGCGGTCGTTATCATAATTTTAAAGACTTTAT
TAATTTCCCCAATGTCGGCAAAGCCAATCTGGTGAACAAACCACTGCCGCGTTTACGCCA
TATTTGGTTTGATAAAGCCCAGTTCCGCAATGGTTTTGATGCCATTCGCGAACGCGATGT
GTTGCTCTATTATCCTTATCACACCTTTGAGCATGTGCTGGAACTGCTGCGTCAGGCTTC
GTTCGACCCGAGCGTACTGGCGATTAAAATTAACATTTACCGCGTGGCGAAAGATTCACG
CATCATCGACTCGATGATCCACGCCGCACATAACGGTAAGAAAGTCACCGTGGTGGTTGA
GTTACAGGCGCGTTTCGACGAAGAAGCCAACATTCACTGGGCGAAGCGCCTGACCGAAGC
AGGCGTGCACGTTATCTTCTCTGCGCCGGGGCTGAAAATTCACGCCAAACTGTTCCTGAT
TTCACGTAAAGAAAACGGTGAAGTGGTGCGTTATGCACACATCGGGACCGGGAACTTTAA
CGAAAAAACCGCGCGTCTTTATACTGACTATTCGTTGCTGACCGCCGATGCGCGCATCAC
CAACGAAGTACGGCGGGTATTTAACTTTATTGAAAACCCATACCGTCCGGTGACATTTGA
TTATTTAATGGTATCGCCGCAAAACTCCCGCCGCCTATTGTATGAAATGGTGGACCGCGA
GATCGCCAACGCGCAGCAAGGGCTGCCCAGTGGTATCACCCTGAAGCTAAATAACCTTGT
CGATAAAGGCCTGGTTGATCGTCTGTATGCGGCCTCCAGCTCCGGCGTACCGGTTAATCT
GCTGGTTCGCGGAATGTGTTCGCTGATCCCCAATCTGGAAGGCATTAGCGACAACATTCG
TGCCATCAGTATTGTTGACCGTTACCTTGAACATGACCGGGTTTATATTTTTGAAAATGG
CGGCGATAAAAAGGTCTACCTTTCTTCCGCCGACTGGATGACGCGCAATATTGATTATCG
TATTGAAGTGGCGACGCCGCTGCTCGATCCGCGCCTGAAGCAGCGGGTACTGGACATCAT
CGACATATTGTTCAGCGATACGGTCAAAGCACGTTATATCGATAAAGAACTCAGTAATCG
CTACGTTCCCCGCGGCAATCGCCGCAAAGTACGGGCGCAGTTGGCGATTTATGACTACAT
CAAATCACTCGAACAACCTGAATAACCCTATGCCAATACACGATAAATCCCCTCGTCCGC
AGGAGTTTGCTGCGGTCGATCTTGGTTCAAACAGTTTTCACATGGTCATAGCCCGTGTGG
TAGATGGTGCCATGCAGATTATTGGCCGCCTGAAACAGCGGGTGCATCTGGCGGACGGCC
TGGGGCCAGATAATATGTTGAGTGAAGAGGCAATGACGCGCGGTTTAAACTGTCTGTCGC
TGTTTGCCGAACGGCTACAAGGGTTTTCTCCTGCCAGCGTCTGTATAGTTGGTACCCATA
CGCTGCGTCAGGCGCTGAACGCCACTGACTTTCTGAAACGCGCGGAAAAGGTCATTCCCT
ACCCGATTGAAATTATTTCCGGTAATGAAGAAGCCCGTCTGATTTTTATGGGCGTGGAAC
ATACCCAACCGGAAAAAGGTCGCAAACTGGTTATTGATATTGGCGGCGGATCTACGGAAC
TGGTGATTGGTGAAAATTTCGAACCTATTCTCGTTGAAAGCCGCCGGATGGGTTGTGTCA
GCTTTGCCCAGCTTTATTTTCCTGGCGGGGTCATCAATAAAGAGAATTTTCAGCGCGCTC
GCATGGCGGCAGCACAAAAACTGGAAACTTTAACCTGGCAATTCCGTATTCAGGGCTGGA
ACGTTGCAATGGGCGCTTCCGGTACCATAAAAGCCGCCCATGAAGTGTTAATGGAAATGG
GCGAGAAAGACGGGATAATTACCCCGGAACGTCTGGAAAAACTGGTAAAAGAAGTTTTAC
GTCACCGTAATTTCGCATCGCTGAGTTTACCGGGTCTTTCCGAAGAGCGGAAAACAGTCT
TCGTTCCGGGACTGGCGATTTTATGCGGTGTGTTTGATGCTTTAGCCATCCGTGAACTGC
GCCTTTCTGACGGGGCGTTACGCGAAGGCGTACTGTATGAAATGGAAGGACGTTTCCGTC
ATCAGGATGTGCGTAGTCGCACCGCCAGCAGCCTCGCCAACCAGTATCACATCGACAGCG
AACAGGCCCGACGGGTGCTGGATACCACTATGCAAATGTACGAACAGTGGCGGGAACAGC
AACCGAAGCTGGCGCATCCGCAACTGGAGGCGCTACTGCGATGGGCCGCCATGCTGCATG
AGGTCGGGTTGAATATCAACCACAGCGGTTTGCATCGCCACTCCGCTTATATTCTGCAAA
ACAGTGACTTGCCGGGTTTTAATCAGGAACAGCAGCTGATGATGGCGACACTGGTGCGCT
ATCACCGTAAAGCGATTAAGCTCGACGATCTACCGCGCTTTACCTTGTTTAAGAAGAAAC
AGTTCCTGCCACTGATACAGCTATTGCGCCTTGGCGTATTACTCAACAATCAACGTCAGG
CAACCACCACACCGCCAACATTGACGCTGATTACTGATGACAGTCACTGGACACTGCGTT
TCCCGCATGACTGGTTTAGTCAGAATGCGCTGGTACTGCTTGATCTGGAAAAGGAGCAAG
AATACTGGGAAGGCGTGGCTGGCTGGCGGTTGAAAATTGAAGAAGAAAGTACACCAGAAA
TCGCCGCTTAATACTTTGCGGGCCGACGAGAAATGTCGGCCCGCATTATTCAGGCACTTT
CGCGAATGGGTTCGATTTCATTCAGCGTATCAATTAACGGCTGCGGCTTACCAATAAGAT
AACCCTGCATATAATCGATCCCCAAAGAGAGCACCGCCTCGCGGATCTCTTCGTTTTCAA
CGTACTCTGCCACTACCAGCATTTTCTTCATTCGCGCCAGGTGGCAAATCGATGCCACTA
TCTGATAATCCAGACTATTTGACACAATATTGCGGATAAAACTGCCGTCAATTTTAAGCA
GATCGGCATTCACATTTTTAAGCCGCGCATAGCTGGCGTAGCCGGTGCCGAAATCATCAA
TCGCAATCTGGCAGCCTAATTCCTGAAGATGCTGCAAGGTGATTTGCGCCTGCTTAACAT
TGGTCAGAGCATTACTTTCGGTGACTTCAAAAATAAGTTGCCACGCTTCAATCTGATATT
TAGCCAGCAACTGACTGACTTCAACAGGAAAACGAGCCTGACATACCGAGGTTGGAGACA
GATTAATAGCAAAACGGTGAGCGGGCATCTTCGCTCTGTTTTCAGCCATAAATTGCAGCG
TATGCTCAATGACCCACATGTCGATACTCGACGATAAACCAAATTCGTGCGCGACCGGCA
AGAAGCTATCGGGGCTGATCAGTTCATCATTCTCACCTTTCATGCGCAGAAGAATTTCAT
GGTAAACATCACCACGCATACCGGTAATCGGCTGGGCCATCAGGAAAAAATGGTTGTGTT
CCAGCGCCTGCTGTAGTCGATTCATCATCGCGACTTTATCTTTCAATTCGCGTTGCAAAT
ACATTGCCCCGCGACGCTGCATATTTTCCGGGGCGTTGGTCACGATGGAAAGTTCGGCGA
CCGTATTTAGCTCTCCCAGCAGCAGGTAGATATGATTCACTGGCGAGCGCACATAGCAGT
AACTGACGCCAATCTGCGGTTGCATCGGCATGCCATCCCAAAAGAAACGAAATTGCTTGA
GATGGCTATCCAGTGCGGTAATGCGCTCCTGGTGCGATTCTGTATTCAGTCGCAGCGCGA
GATCGTTACCCGAAAGCTGATAAACATCTTCACCCGGTTCCAGCAAGGGTGACAGCCAGT
GAGAAAGTTTTTGCTTGTATTGAATCCGCAGCATGATGCCATAGTTCTTAACCAGCATTT
CCATGCCAGGGATGCGTAAATAACAAAGCGCAGACCAGGGGGCATCACGCAACGCGCGAT
TCAGGGCGCGAACATTTGGCAGATGAACCACCGGGTCCACATACGCAAGCCGCTGAATGC
GTCTGACTACCGCTCTCTGACGGGTTGCCAGTACAGCCATATAATTGACAATAAAAGAGA
ATACCAGATAACTGGAGGAGGTTATGGTCAGCTGCGTGGTATAGCCAGGATAAATGGGAA
TGTAATTTTGATAGCTGTGGATGCTGATCATCAACACGACCGCCCAGAGCAGCGAAATCA
GCTTATAACCATAGCGCATCGCTCCCCACATCATCAGGGGCAGCAATAATGACAAGGTAT
AATTGGTGCTAAAAATTGTGCTTTTTTCATTTAACGGCATGCATAACAGCAACAATAAAG
CACCTAATGCCAGTAGCCAGAGCGCGAACTCTTTTTTGGTGACTTTGGCATCAACCTGCT
GTTTTAATTGCGAATAATAGCTACGTAAATAAAATGGATTTCGCACTACCCGAATGATGA
AGTAGCACAGCGGGACACCGATCAGATTACCCACCAGTAAGGCCTGATAATTGATTAAAG
TCCCGAGGTTAAAAGGCATGACACCGACCAGATTTTCTCTGCTCGCCAGTAATCCTACAA
ATGCAGCAAACTGGAAAAGTATCAGAAACAGCGTTGCAGGAAACACAATCTGCCAGAATA
TACGCTGGGAAATTAAACGGGTATCACCATGTGAAACGTTGTTACGCCGGGGAGTAAAGA
CCCTGTAACCGCCCCAACAGAGAATGATAATGATAATAAAATTAGCCGTTAATGATAGCG
TTTCGTAAAAACCCAGCTCTGCATATTTGCGGACAAAAATCCCTAAGGCGATCCCTGGCA
ATGCCGCCCAGCTGAAAAACATCATCATGCTGATCATCAGTGCCAGAGGCAGATAAAAGA
GAAAAACCTCACCGGAAGAAATATGCGCGAAAGTATTAATGTGGGCGAAAATGGGCAAGA
TTAAAGAAGGCAGGAACAGCGGAAGCCCCCACCATTTATCACGTATTTTTATATAAGTTG
CATTCAGTTTCATAGATGCTCAGCAGAATCCCCCACATCCTGAAGGAGGTGTATTCAGAC
AGGCATCCCACCTGACTTCGAATGATGATTATTCATCACTATAGAGAGCATTGATTCTAA
GTGTCATATGAAAGTACCAATTGATATATATCAAACAAAATAACCCTGATTAATGAATTA
TTACGTTTATCATGTTAATTCATCATTATTACATCATCATTGTAAATAATTAAATTAACT
TCCATAACATTAAAATATGTATCCACTGACGCTTTTTTACATAACGAAGAATTGACCATT
TTGTCCTGTTGTGCCTTAATGTAAGTACCGTCCACAGCGTGGGACATACTTCAAGGAACC
TTTTGTGAGTCAGGCAACCAGTATGCGAAAACGACACCGATTTAACAGTCGCATGACCCG
TATCGTACTGCTCATCAGCTTTATCTTCTTCTTTGGCCGTTTTATCTACTCGTCCGTCGG
TGCCTGGCAGCACCATCAGAGCAAAAAAGAAGCTCAGCAATCCACACTCTCCGTCGAATC
ACCGGTACAACGTTAGCGGTTACCTTCTCCACTTTCACAGAACATAACGGCACTTCGCTG
TCGGATGCTTTTGCTGTTTGGGATTATCAAAGCGGCAGATATTCTTTCATCTTAAATTTT
ACGTCTTTATCCTGACTGATGTTTATCCTGTTTGGCTGCGAAATAAATATAAAATTAATA
TATATGTTGTAATGATATATTTTTATAAATTATTCCCTGCGTGAATTTTAATAAATTTAA
TCTATCCCTTTATACGCAATACATTTACTTTCCTCTTTTGATGATCTTAAATGTCTTATT
TTTCGTAATGTGTATAACAAGGAATAGTGATGAAATTTAAAAAATGTCTTCTGCCTGTGG
CAATGTTAGCGTCATTCACTCTGGCAGGATGCCAGTCAAATGCTGACGATCATGCTGCCG
ATGTTTATCAAACCGATCAACTGAATACCAAACAAGAAACTAAAACCGTTAATATTATTT
CCATTCTTCCCGCAAAAGTTGCCGTAGACAACTCCCAAAATAAACGGAACGCACAAGCCT
TCGGCGCGCTTATTGGCGCAGTCGCTGGCGGTGTTATCGGCCACAACGTCGGGTCTGGCA
GCAATTCCGGAACGACGGCAGGTGCAGTTGGCGGCGGAGCTGTAGGCGCGGCAGCGGGTT
CTATGGTGAATGATAAAACCTTAGTGGAAGGTGTTTCTTTAACCTATAAGGAAGGCACCA
AAGTGTATACCTCTACCCAGGTGGGTAAAGAGTGCCAGTTTACGACAGGTTTAGCCGTTG
TTATTACCACGACGTATAACGAAACGCGTATTCAGCCAAATACCAAATGTCCTGAAAAGA
GCTAATAATCAGGAGGAGTCATGAAGAAAGTTTTTCTTTGCGCCATCTTAGCCTCCTTAA
GCTATCCGGCTATCGCCTCATCATTGCAGGATCAACTCTCTGCTGTCGCAGAAGCGGAAC
AGCAAGGTAAAAATGAAGAGCAAAGGCAGCATGACGAATGGGTCGCGGAGCGCAACAGGG
AAATCCAGCAAGAGAAGCAACGTCGCGCAAATGCCCAGGCCGCCGCTAACAAAAGAGCGG
CAACGGCAGCGGCAAATAAGAAAGCTCGTCAGGATAAACTGGACGCCGAAGCCTCTGCGG
ACAAAAAACGCGATCAAAGTTATGAAGATGAGCTACGCAGCTTAGAGATTCAGAAACAAA
AACTGGCGCTGGCGAAAGAAGAAGCCCGCGTTAAGCGAGAAAACGAATTTATCGATCAGG
AACTGAAGCACAAAGCTGCGCAAACCGATGTGGTGCAATCTGAAGCTGACGCCAACAGAA
ATATGACTGAAGGCGGTCGCGATCTGATGAAAAGCGTGGGCAAAGCAGAAGAGAACAAAT
CGGACAGCTGGTTTAATTAATCGATGTTAGTAACTTCAATCCTATAATTCTTGAAGATAA
AAAACCCTCTGTAGTAACAGAGGGTTTTGTTCATTCATAGTGCAGGGTCAAATCATTCCC
ACTCAATGGTAGCTGGCGGCTTGCCGCTGATGTCATACACCACGCGGGAAATACCGTTCA
CTTCATTGATAATGCGGTTGGAAACGCGACCGAGGAAATCGTACGGCAGATGCGCCCAGT
GTGCGGTCATAAAGTCGATGGTTTCGACAGCACGCAGAGAGACAACCCAGTCATACTTAC
GACCATCGCCCATTACGCCAACGGAACGTACCGGCAGGAACACAGTGAACGCCTGGCTGA
CTTTGTCGTACAGGTCCGCTTTACGCAGTTCTTCAATGAAGATGGCGTCAGCACGGCGCA
GCAGGTCACAGTACTCTTTCTTCACTTCACCCAGAACACGAACGCCAAGGCCTGGTCCCG
GGAACGGGTGACGGTACAGCATGTCGTACGGCAGGCCCAGCTCCAGACCAATCTTACGCA
CTTCGTCTTTGAACAGCTCTTTCAGCGGTTCAACCAGGCCCATCTTCATCTCTTTCGGCA
GGCCGCCCACGTTGTGGTGAGATTTGATGACGTGTGCTTTACCGGTTGCAGACGCCGCAG
ATTCGATAACGTCAGGGTAGATGGTGCCCTGCGCCAGCCACTTCACGTCTTCCAGTTTCA
GCGCTTCTTCATCGAATACTTCAACGAAAACGCGACCGATGATTTTACGTTTTGCTTCCG
GATCGTTTTCGCCAGCCAGCGCTGACAGGAAGCGATCTTCTGCCGGTACGTGAACAATGT
TAAGACCAAAGTGATCGCCAAACATATCCAGAACCTGCTCTGCTTCGTTGAGGCGCAGCA
GGCCGTTGTCGACGAATACGCAAGTCAGGTTTTTACCGATAGCGCGGTGCAGCAGCATTG
CGGTTACGGAGGAATCCACACCACCAGAGAGGCCGAGGATGACTTTATCGTCGCCTACCT
GCTCGCGGATGCGAGCTACAGCATCGTCGATAATTTTCGCTGGCGTCCACAGGGCTTCAC
ACTGGCAGATATCACGCACAAAACGCTCCAGCATGCGCATACCCTGGCGGGTATGAGTCA
CTTCCGGGTGGAACTGTACGCCATAGAAGCGTTTTTCTTCGTTAGCCATAATGGCAAACG
GGCAGCTTTCGGTGCTGGCTACGGTGATGAAGTCGGACGGAATAGCGGTAACTTTATCGC
CGTGGCTCATCCAGACATCGAGCAGCGGTTTACCGTCTGCGGTCAGCGCATCTTCGATAC
CGCGAACCAGTGCGCTGTCGTTTACGACTTCAACCTGCGCGTAGCCAAATTCACGTTCGT
TAGAGGCTTCAACGTGACCGCCCAACTGCATTGCCATGGTCTGCATGCCATAGCAAACGC
CGAATACCGGTACGCCTGCTTCAAAGACATACTGCGGCGCACGCGGACTGTTTTCTTCAG
TAGTACTTTCCGGGCCGCCGGAAAGAATAATGCCGCTTGGATTGAAGTCACGAATTTGTG
CTTCTGTCACATCCCACGCCCACAGTTCGCAGTAAACACCCAGCTCACGCACGCGGCGCG
CAACCAGTTGAGTGTACTGAGAACCGAAGTCCAGAATGAGGATGCGATGCTTATGAATGT
TTTCCGTCATTGACGCTTATTCCGAGGCAAGTGAAACAGATAATATAAATCGCCCGACAT
GAAGTCGGGCGAAGAGAATCAGGAGCCCAGACGGTAGTTCGGGGACTCTTTAGTAATGGT
CACGTCGTGAACGTGGCTTTCCTGAATGCCCGCACCGCTGATACGTACAAACTCCGCTTT
AGTACGCAGTTCGTCGATAGTACCACAGCCGGTCAGACCCATACAGGAGCGCAGGCCGCC
CATCTGCTGGTGAATGATCTCTTTCAGGCGACCTTTATAGGCTACGCGACCTTCGATACC
TTCCGGCACCAGTTTGTCGGCAGCGTTATCGCTCTGGAAATAACGGTCAGAGGAACCTTT
GGACATCGCGCCCAGGGAACCCATACCACGGTAAGATTTGTAAGAACGGCCCTGGTAGAG
TTCGATTTCACCCGGAGATTCTTCAGTACCCGCCAGCATGGAACCTACCATCACCGCGCT
TGCGCCAGCGGCGATAGCTTTGGCGATGTCGCCGGAGAAGCGAATACCGCCATCAGCGAT
AACCGGAATACCGGTGCCTTCCAGGGCTTCTACTGCGTCAGCAACAGCGGTAATCTGCGG
AACACCGACGCCAGTCACGATACGAGTTGTACAGATAGAGCCAGGGCCAATGCCGACTTT
AACCGCACTGCAACCAGCTTCTGCCAGAGCGCGTGCACCTGCAGCTGTTGCCACGTTGCC
GCCGATAATTTGCAGATCCGGATATTTAGCACGGGTTTCACGGATACGTTGCAGTACACC
TTCTGAGTGACCGTGGGAGGAGTCGATCAGCAGAACGTCAACGCCTGCGGCAACCAGCGC
GTCAACACGCTCTTCGTTACCCGCACCTGCGCCAACCGCTGCACCAACACGCAGACGGCC
TTGCTCGTCTTTACAGGCGTTCGGTTTACGTTCCGCTTTCTGGAAGTCTTTCACGGTGAT
CATGCCGATCAGGTGGAATTCGTCATCAACCACCAGCGCTTTTTCAACGCGTTTTTCGTG
CATTTTTGCCAGCACCACTTCACGGGCTTCACCTTCACGCACGGTGACCAGACGCTCTTT
CGGCGTCATGTAAACGCTAACCGGCTGGTTCAGGTCGGTAACAAAACGCACGTCACGACC
GGTGATAATACCCACCAGTTCGTTTTCTTCGGTAACGACCGGATAGCCCGCAAAACCGTT
ACGCTCGGTCAGTTCTTTCACTTCGCGCAGCGTCGTGGTTGGCAGAACAGTCTGCGGATC
AGTCACCACACCAGATTCGTGTTTTTTCACACGGCGAACTTCTTCTGCCTGGCGTTCAAT
GGACATGTTTTTGTGGATAAAGCCGATACCGCCTTCCTGAGCCAGAGCAATAGCCAGGCG
CGCTTCCGTTACGGTATCCATTGCTGCGGAAAGCATAGGGATATTCAGACGAATAGTTTT
CGTCAGCTGGGTGCTGAGGTCAGCAGTATTCGGCAGAACGGTAGAGTGAGCAGGAACGAG
GAGAACGTCGTCAAACGTCAGAGCTTCTTTAGCGATACGTAGCATGGGCAATATCTCGAC
CAGAGTGGTTAATAAATATTGCCGCGGCATTATACAGAGCGTAACCGATTGCATCTACCC
CTTTTTGCAAAAAATGCTTGCTATCCCCGAAGGGCGGGTTACTATCGACTGAATAACCTG
CTGATTTAGAATTTGATCTCGCTCACATGTTACCTTCTCAATCCCCTGCAATTTTTACCG
TTAGTCGCCTGAATCAAACGGTTCGTCTGCTGCTTGAGCATGAGATGGGACAGGTTTGGA
TCAGCGGCGAAATTTCTAATTTCACGCAACCAGCTTCCGGTCACTGGTACTTTACACTCA
AAGACGACACCGCCCAGGTACGCTGCGCGATGTTCCGCAACAGCAACCGCCGGGTGACCT
TCCGCCCACAGCATGGGCAACAAGTTTTAGTTCGCGCCAATATTACGCTCTACGAGCCGC
GCGGCGACTACCAGATAATCGTTGAGAGTATGCAGCCGGCCGGTGAAGGGCTGCTGCAAC
AGAAGTACGAACAGCTCAAAGCGAAGTTGCAGGCTGAAGGTTTGTTCGATCAGCAATACA
AAAAACCACTTCCCTCCCCTGCGCATTGCGTTGGTGTGATCACCTCAAAAACCGGTGCTG
CGCTACATGATATTTTGCATGTGTTAAAACGTCGCGATCCTTCTCTGCCGGTGATCATCT
ACCCTGCCGCCGTTCAGGGCGATGACGCGCCGGGGCAAATTGTTCGCGCCATTGAACTGG
CGAATCAGCGCAATGAGTGCGACGTATTGATCGTCGGGCGCGGCGGCGGTTCGCTGGAAG
ATTTATGGAGTTTTAACGACGAACGCGTAGCGCGGGCGATTTTTACCAGCCGCATTCCGG
TTGTCAGCGCCGTCGGGCATGAGACGGATGTGACCATTGCCGATTTTGTTGCCGATCTGC
GTGCGCCAACGCCGTCTGCCGCCGCTGAAGTAGTGAGCCGTAATCAGCAAGAGTTACTGC
GCCAGGTGCAATCGACCCGTCAACGGCTGGAGATGGCGATGGATTATTATCTCGCCAACC
GCACACGTCGCTTTACGCAAATTCATCACCGATTACAGCAACAGCATCCGCAGCTCCGGC
TGGCACGCCAGCAAACCATGCTTGAGCGCCTGCAAAAGCGAATGAGCTTTGCGCTGGAAA
ATCAACTTAAGCGTACCGGGCAACAGCAGCAGCGGTTAACACAGCGGCTGAATCAGCAAA
ATCCACAGCCGAAGATTCATCGCGCGCAAACGCGCATTCAGCAACTGGAATATCGTTTAG
CAGAAACCCTGCGCGCACAGCTTAGCGCCACGCGTGAACGTTTCGGTAATGCAGTAACGC
ACCTCGAAGCCGTAAGCCCACTGTCAACGCTGGCGCGTGGATACAGCGTTACTACTGCTA
CTGACGGCAATGTACTGAAAAAAGTGAAGCAAGTTAAAGCGGGTGAAATGCTAACCACAC
GTCTGGAAGACGGCTGGATAGAAAGTGAAGTAAAAAACATCCAGCCAGTAAAAAAATCGC
GTAAAAAGGTGCATTAAGCCAGCACGAATTCAACGCGTTTTTTCGATATCAAGCCATGCC
CGTGCTGACAGAAGTAATCTACTGCACCACAGGCTTTTAACACCTGCAACGGTTGATGGC
AGTCTGGACAAAGAGCTTTCATTTCAATAAATTCCCCGCAGGATCGGCAACGCGCATGGC
CGTTATCCTGATCAAGCACATGCTGACATTGTGGACAATGCAGTTCCATATGAATTCCTC
CGGTAGCCATTCCCTCTACATTCATAGAGGGAATGGCAGATAAAATACTTACGGATAATT
ATTTATTTTTCTTGATGTGCTTCATCAGACGCTTACGTTTACGCATCTGGGTTGGCGTCA
GGGTGTTACGCTTATTCGCATACGGGTTTTCCCCTTCTTTGAACTGAATACGAATCGGCG
ATCCCATTACGTCCAGCGATTTGCGGAAGTAGTTCATCAAGTAGCGCTTGTAGGAATCAG
GCAGGTCTTTCACCTGATTACCGTGAATCACCACAATCGGCGGGTTATAACCACCGGCGT
GGGCATATTTCAGCTTCACACGACGACCGCGTACCAGCGGCGGTTGGTGATCTTCAACAG
CCATCGTCATGATGCGCGTCAGCATAGAGGTCCCCACACGACGGGTGGAGCTGTCATACG
CTTCACGTACTGATTCAAACAAGTTACCAACACCACTGCCGTGCAAGGCAGAGATAAAGT
GCACACGAGCAAAATCGATAAAGCCCAGACGGAAGTCCAGCGTTTCTTTCACCTGCTCTT
TCACTTCCTGACTCAGGCCATCCCACTTATTCACCACAATGACAAGTGAGCGCCCACTAT
TGAGAATAAAGCCCAGCAGCGAGAGATCCTGATCGGAAATACCTTCGCGCGCATCAATCA
CTAACATCACCACGTTGGCGTCTTCAATGGCCTGCAACGTTTTGATTACGGAGAATTTCT
CTACAGCATCGGTGATTTTGCCGCGTTTACGTACGCCAGCGGTGTCAATGAGCACATACT
CACGTCCATCGCGTTCCATTGGGATGTAGATGCTGTCACGCGTCGTGCCAGGCATGTCGT
AAACAACAACGCGCTCTTCACCAAGAATACGGTTAGTGAGTGTAGACTTACCTACGTTCG
GACGACCCACAATCGCCAGTTTGATCGGCAGACTTTGCGGGTCGAAGTCGTCTTCCTCTT
CTTCTTCGCCGTTCTCTTCCGCTTCAAATTGCGCCCAGTATTCAGCGTCTTCGTCGACTT
CCTCTTGCGGTGCGAGATCTTCCATCCACGGCAGCAGCACATGCTCCAGCAGACTTAATA
CGCCACGACCGTGAGACGCGGCGATCGGGTAGATTTCACCTAAACCAAGCGAGTAGAAAT
CAACCACTGCCTGATCGGGATCCAGACCGTCAGTTTTGTTTGCCACCAGGAAGGTCGGTT
TTTCACGGGAGCGCAGATGTTTGGCAATCGCTTCATCTGCCGGCATCAGGCCCGCGCGCG
CATCCACCATAAACAGTACGACGTCCGCTTCTTCAATCGCCAGCAGCGACTGTTCCGCCA
TGCGGGTTTCTACACCGTCTTCTGTGCCATCAATCCCGCCGGTATCAATACAGATAAACT
CACGGCCTTCAATTTCCGCACGACCGTACTTACGGTCACGAGTCAGACCCGGGAAATCCG
CAACCAGCGCATCTCGGGTGCGAGTTAGACGGTTAAATAACGTGGATTTTCCTACGTTAG
GGCGCCCGACAAGCGCGACCACAGGTACCATGTTTAAAGCCTCATTTTTATAAATCATCA
GACAACGCACGCTATATTCGCGTCGTTGTTAAAAACAGGAAAACGGCCCCTGTCCAGGAG
CCGTTTTCAAAGTGAACGACAGAGACGATTAACGTGTAATAGAGTACACGGTTCCGTCTT
TTGCCTGGATCAGCAGTTTGCCGTCAGCGGCAACCGGTTCAGTCTGGAAACCGGAACTAT
CAACTTTTTGCTGGGCAACGAAACGACCATCTTCGACGTTAATCCAGTGCAGATAACCTT
CACTGTCACCGACCACCAGGTTGCCATTATACAGCACCGGAGAAGTCAGCAGGCGATGCA
GCAGATCGCTTTGTGTCCACAGCGTAACGCCGCCATCAATGGTCAACGCCATCACCCGGT
CATTTTGATCGACCAGATAGATGCGATTGCCGTCGACGATGAAATCATTCACCGAACCCA
GTTCGCGTTTCCACATAATCTGACCACTGCGCAGATCAAGCGCCGTCAGGTTACCATTAT
AGGCCAGCGCGAAAACAACGCCGTTAACAACGACGGGAGTCGTGTCAACATCGCTCAGAC
GGTCAATTTCGGTAGAACCGGTCGCCTGGGAAATACGCTGCTGCCAAATCATCTGGCCCT
GTTCCATCAGCACTGCGCTGACGCGACCATTATCGCCCCCCACGACGGCCGCACCAAAAG
CCGTTGTCGGCGCAGACTCGCCACGCAAAGAGAGCGAAGGCATATCGAGGTTAACTGTCC
ATTTGACAGCGCCGTCAGCTTCGTTCAGCGCTTGTAACTGACCGTTACTGGTGTGGATTA
ACACCAGACCGTCGCTGACCACCGGGCGCGAAAGTGCTTCACCCGCGACTTTAGTTTGCC
ATGCCACAGTACCATCGCTGGTATTCAGCGCGTAAACCTGCGCCTTTTCGCTGCCAATGT
AGACATGCCCACCAGACACGGTCACACCGCCAGAAAGTAATGCAGGCTCTTTAGAGAACC
AGCCATCTTTCTCGGCCAGGCTGACAGACCAGATTTCTTTGCCATCATCCGCATTCAGCG
CTTTTACTAAACCAGCGCGGTCCGCTGCATAGACAACGTTGTCCGCCAGTGCCGGATGAA
GATTGGAATAGAAGTTGCCAATGCCGCTACCAACGGAAGTGCTCCACGCCGTGGTCGGCG
TAAACTGGTTTTCAACGGTTGGCAATGGGGACATCTTTACCACATCTTCTTCGCTGTTAA
ACAGCGAACAGCCGCTTAAAAGGGTAACGGAAAGCAGTCCTGGCAGCAGTAATTTACGCA
ATTGCATCGGGTCCCTCTCAGATGGACAAATTATTAATTTTCATCTGCATCATTTCGCTC
AGTGCCGGAGTAACATCGCTTTTCACGCCTGCTTCCCATGCACTACGCGCACCTTGCTTA
TCACCTTTGCTCAGCAATGCTTCACCACGCAGGTCGGCAACAATGGCAGCCCACCCTTCA
CCTTTGATGGTATCAAGGGTTTTCAGCGCGGCATCAGCCTGCTTGAGCTGTACCTGAACG
CGAGCAAGACGCAGATTTATCACGGCTTTGAGATTTTCATCGCTCGTGTCTGCCAGCCCC
TGTTGTAACTGGGCGGCAGCTTTCTCTAGTTCATTTTTGTCAACAAATTGCTGCGCAAGT
TCCAAAGAAGCCAGCGCACCATAAGTATTTTTATTTTCAGCAGCAAATTTTTCCGCCGCC
GGGATGCTATCCGGTTTGCCTTCGCTCACTGCGGTAACCGCATTTTGATAGGCAAGAGAA
GCGGAGCGTGCAGAATCAACCTGATGGCTGTTCCAGTAGCGCCAGCCAATCAGTGCGCCA
ACGCCCAAAATCACCCCAACAGCCAGTGCTTTGCCATTTTCAGCAAAAAAGCGTTTAACC
GCTTCTACCTGGTCGTTTTCGTTCTCGTAAATTTCCACGCTGTCCTTCTCCTTCCTTAAC
CCAGTAACGTGCGCAAATGCGCGGCTACGCTATCCTGCGCAACTGCCGTTTGCTCACCAG
AGCGCAAATCCTTCACTACTGCTGTGCCGTTAGCCACTTCAGACTCACCCAGCACCACAG
CAACGCGGGCACCCCATTTATCAGCACGGGCAAACTGTTTCTTAAAGTTGCCGCCGCCGT
GGTTGGTCATCAATTTCACGCCCGGTAATTCATCACGCAGACGCTCAGCTAATGCCATAG
CCGCAGATTGTGTATCAGCACCTGAAGCCACCAGGTATATATCGACAACAGGATCGGCTT
TAAATTCCGGATTAACGGCCTGTACTAACAATACAAGACGTTCGAGGCCCATAGCAAAAC
CGACAGCCGGTGTTGCACGACCGCCCAGTTGTTCCACAAGACCGTCATAACGACCGCCTG
CACACACGGTGCCCTGGGAGCCGAGACTGTTAGTCACCCACTCGAAAACGGTACGGTTGT
AGTAATCCAGACCACGCACCAGACGCTGGTTTACGGTGTAAGCGATCCCCGCGCTCTCCA
GCAGTTTGCACAGACCGGCAAAATGCTCACGAGATTCCTCGTCCAGATAGTCACCTAATG
CCGGAGCGTCGTTGAGAAGCGCCTGCACTTCCGGATTTTTTGAATCCAGCACGCGCAGCG
GGTTAGTGTACATGCGGCGTTTGCAGTCTTCGTCCAGCTTTTCTTTATGCTGCTCAAGGA
ATGCCACCAGCGCATCGCGGTAATTGGCGCGTGCTTCCAGCGAACCGATAGAGTTCAGCT
CAAGAGTTACGTGCTCGGAAATACCCAGCGCGCGCCACCAGCGGGCAGTGAGCATAATCA
GTTCAGCGTCGATATCCGGACCTTGCAGACCGAAAACTTCGCAGCCCAACTGATGGAACT
GACGATAACGCCCTTTCTGCGGACGCTCGTGACGGAACATCGGCCCGATATACCACAGAC
GCTGTTCCTGATTGTACAGAAGACCATGCTCGATGCCGGCGCGTACACAGCCCGCCGTCC
CTTCAGGGCGCAGAGTCAGGCTGTCGCCATTGCGATCCTCAAAGGTGTACATCTCTTTTT
CAACCACGTCGGTGACTTCACCAATCGCACGTTTGAATAGCGGGGTCTGCTCTACAATCG
GCAAGCGGATTTCACTGTAACCGTAGCTGCCGAGCACGTTTTTCAGTGTGCCTTCAATGC
GCTGCCAGATGGCCGTTTCGCCAGGCAGGTAATCGTTCATGCCGCGAATGGCTTGAATGT
TTTTTGCCACGTTTATTCTCTTTCTGAATATAAAAATGAACCCTCAACGCTTCCCTCAAT
GTTTCGGGAGCCATGCGGGTTCAATCATACACGGGAAGCGAGGCGCTTCCCATCACGTTA
TTATTTTTCAACCTGCTGAACGTCAATTCGACGCGCTTCGTCCAGCTGACTGGCTTTCGC
ACGAATGCGTGCTTCCAGCTGGTCGATCATATCGTTGTTGTCCAGACGGTCTTTGCGCAC
GCCATCTTCATAGAGGCCGCTTTTCTTGTTGCCGCCGGTGACGCCGAGTGTAGAAACCAG
CGCCTCACCTGGGCCATTCACCACGCAGCCGATAATCGAAACGTCCATCGGAGTGATGAT
ATCTTCCAGGCGTTGCTCCAGCGCGTTAACCGTACCGATAACATCAAATTCCTGACGCGA
ACAGGTCGGGCAGGCGATGAAGTTGATCCCTCGCGAACGGATACGCAGCGATTTCAAAAT
ATCGAAACCGACTTTGATCTCTTCGACCGGATCGGCCGCCAGCGATACGCGCAGCGTGTC
GCCGATGCCTTCAGACAGCAGCAGACCTAAACCAATGGCGGATTTTACTGCCCCGCTGCG
CGCACCACCGGCTTCGGTGATCCCCAGATGCAACGGCTGATCGATCTGTTTTGCCAGCAA
ACGATAAGACTCAACAGCGAGGAAGACGTCAGACGCTTTCACGCTGACTTTGAACTGATC
GAAGTTCAGGCGATCGAGATGATCAACATGACGCATGGCAGATTCCAGCAACGCCTGCGG
CGTCGGTTCGCCATACTTTTCTTGCAGATCTTTTTCCAGCGATCCGGCGTTAACGCCAAT
ACGGATCGGAATGTTTTTATCGCGCGCACAGTCAACCACCATGCGAATACGCTCTTCATT
ACCGATATTGCCAGGGTTAATACGCAGACAATCGACGCCGTATTCCGCTACTTTCAGCGC
AATGCGATAGTCGAAGTGGATGTCAGCCACCAGCGGCACGTTAACCTGCTGTTTGATGAG
TTTGAACGCTTCTGCCGCGTCCATCGTCGGTACGGATACACGGACGATATCAGCGCCAAC
GCGTTCCAGCGCCTTGATTTGATTGACCGTTGCTTCGACGTCTGTCGTACGCGTATTGGT
CATGGACTGTACGGCGATGGGAGCACCATCGCCAATCGGCACATTCCCAACGTAAATACG
TGTTGATTTTCTACGTTGAATTGGAGCCTGGTTATGCATGAAAAATCTCCCGCGTTACCC
GTCTGTTACTGCGCCGGTGATTGTTCGGCATTGAGGGTCAGACGCGCAACCTGGTTAGTT
CTGATAAAACGACTCAGATCGACAGGTTTCCCTTGATACTGGATCTGTACTGCGGCTGGC
GCACCAATTTTCAGTTTGTACGGTGCCTGGCCGGTTAAGTTCAAATTACCGTCTTTACGC
TGCATACCGCTAAACAATTTTTTACCGGTAGCATCAGTGACCTCCAGCCAGCAATCGGCA
GTAAAGTTCATCACCAGCGCATTCGGATCAGCCACCGGCGTGGTCACGCCAGCCTGATCG
GTTGGCAACGGCGCAGCACCATCTGGCGTTGTTGCTGCCGTTGGTGCCGGGGTCGCGGCG
GTATCAACATTTGCCTGCGAAGGCGAAACAACCGCATTCTGTTGCGGATCAACAGCTGGT
GCTGGCGCAGTTACGGCAGGTGTTTGCGTGTTGGTTGCGGTAGTATCCACAGACGCTGGC
GGCGTGGACGTTGTAGCCGGGTCTGTAGTTGTCGACGTATTTAATGGAACACTCTGCCCC
TGCTCGCTATTACTGCTCAGTTCCGCCGAAGATTGATCGGCCATAGTGGTGATCTCTTCC
TGCTGAGCTTTGCGGTCTTGCCACCACCAGGCACCGCTCAGGCCGATAACCACAAACAAC
ACCAGCCAAGTGAAGGTCATCAGCCAGCCGTCGCGTTTTTTGCGGCGTTTACCGAGGGAA
AAACTCTGCATCGGCGCAACTTTTGCAGCCCGAAGTGGAGCCTGCTTTTCCAGCCCTGGC
AGCAGTTCTTCTTCTGGAATATGTACCAGACGCGCATAAGAGCGGATATATCCGCGCAGG
AATGTTGAAGCAAGATCGGCGGGTGCCTTATCTTCTTCAATGTCGCGTACCGTGGAAACC
TTCAGGCAAAGTCGCTCGGCAACGGCCTGCTGACTAAGTCCTAGTTGTTCGCGAGCATTA
CGCAGGCGAGCGCCGGTAGTAAGTGCTTCATTTTGGTCGTGCGTGGCTTCAGTATTCATT
CGCTGCAGGTACGTTTAAATGAGAATTGAGATGCCGGTGAACCATCATGCTCACCCACAC
CGCGAAACATCCGTTAAGTTAACCGTTATCATACAGTATAAGACCGTCTGTGTGCTCGTG
ACAAAGCCCACATTCACTAAGGCTAACTTACTGTTGCATCGTTACATACTGCCTTAAAGT
CAGCAAAAACGCACCGTTAATATTGACCAGACAATTGCAACTTAATACTTCATTCATAAA
ACATTACGCCACGGTACATAAAGTAACCGTGGCGTAATGGCTATCAGACCGCTTTAATGT
CGATGGCTTCACCCTGCATCCGTTTACGCAGGGTACGTTTCGTACGGTCGATAACATCGC
CCGCCAACTGACCACAGGCAGCATCGATATCATCACCACGAGTTTTACGCACAATAGTGG
TGAAACCGTAGCTCATCAGCACTTTTGAGAAACGGTCGATACGGCTGTTCGAGCTGCGTC
CATACGGCGCACCCGGGAACGGGTTCCACGGGATCAGGTTGATCTTACACGGCGTATCTT
TCAGCAGTTCCGCCAGTTGGTGCGCGTGTTCAGTGCCGTCGTTAACGTGGTCAAGCATCA
CGTATTCAATAGTGACTCGGCCCTGATTGGCGTTGGATTTCTCCAGATAACGGCGCACCG
CAGCAAGGAACGTTTCGATATTGTACTTTTTGTTGATCGGCACAATTTCGTCACGAATTT
CGTCGTTCGGCGCGTGCAGGGAAATTGCCAGTGCAACGTCGATCATATCGCCCAGTTTAT
CCAGCGCCGGAACTACACCGGAAGTGGAAAGCGTGACGCGACGTTTAGACAGGCCAAAAC
CGAAATCATCAAGCATGATTTCCATCGCCGGAACGACGTTGTTCAGGTTGAGCAGCGGCT
CGCCCATGCCCATCATCACTACGTTAGTGATCGGACGCTGACCGGTGACTTTTGCTGCGC
CGACGATTTTCGCCGCACGCCACACCTGGCCGATAATTTCCGACACCCGCAGGTTGCGGT
TAAAGCCCTGCTGGGCGGTGGAACAGAATTTACACTCCAGCGCACACCCCACCTGCGAAG
AGACGCAGAGCGTGGCACGGTCGTCTTCCGGGATATACACCGTTTCGACGCGCTGATCGC
CAACGGCGATCGCCCATTTAATGGTGCCGTCAGATGAACGCTGTTCTTCAACCACTTCCG
GTGCGCGGATTTCCGCCACCTCTTTCAGTTTGCCGCGCAACACTTTGTTGATGTCGGTCA
TCTCATCAAAGTTGTCGCAGCAATAGTGATACATCCACTTCATCACCTGATCGGCGCGGA
AGGGTTTTTCACCTAAATCTTTAAAAAACTCCCGCATCTGCTGACGGTTGAGATCCAGCA
GGTTGATTTTTCCATCTTTCGTGGTGACGTTTTCAGGTGTGACTAATTGTTCAGACATAT
GCTATTCCGGCCTCGTTATTACACGTTATGGCCCCTGGAGGGTTGAAAAAAGAAACGCCC
CGGTGAGCGGCTGCTCGTCCGGGGGCGCTGCATTGTACAAATTCTGGCGCACGGATGCCA
CGTTTGCACGCGGCATTTACGAAATTATTAACGGGTGCGCGGGCACACTTCGCCTTCGCC
AAAGAAATAAGCGATTTCGCGAGCGGCAGATTCGACGGAATCAGAACCGTGGGTACCGTT
TTCGGTCAGGCTGTCAGCGTAATCAGCGCGCAGAGTACCAGCCAGTGCGTTTGCCGGATT
GGTCGCGCCCAGCAGATCGCGGTGACGCTGAACGGCGTTTTCACCTTCCAGCACGGAAAC
CACGATCGGGCCAGAGGTCATGAATTCAACCAGACCATCAAAGAACGGTTTTCCATCGTG
TTCAGCATAAAAGCCACGTGCCTGTTCAACGGTCAGGTGCAGCATTTTGGTGCCAACAAT
TTTGAACCCTGCAGCTTCAAAGCGCGCAAAGATATTACCAATGACGTTTTTTGCTACCGC
GTTCGGTTTGATGATGGAAAAAGTACGTTCAATAGCCATTTTTACCTCTGTAAATTGTTC
TGTTGTTGTCTGTACCAGCGTACGAGATGGCGCGGATTATAATGAGCAACAGGGCCGTTG
ACTATTGATGAAGGTAACATTTTTTTAAAATAAAATGAGTTTTAGCAACAATCAGGGACA
AAACAGACTATTGCATGACAAATTTCACTGTCGCGATTTGCCCCACGTCATCCATCACCA
GCAATTGATAATCACCTTTATCCGTCAAATGCAGGGTCACGTTGCGCCCGCGTTCAGTTA
ACGGTTCGCCATTCAGAAACCACCAGCGTTCACCTGCCCCTCCACTTGATTGCAACGGCA
AAGTCGCTTCCGCTGCGCCCGGTAAACGTTTAATAATCGCGCCATCGCGAACGCCTGTCA
GCTGCAGCGGGAGCTGGGCATCGTGACCGTATGGCGGGCAACTTGTCGAGGCCGGTGGTA
AGCGCACAGCGCGACGTTCTGATGCGGGCAGCCAGGGTTCCAGCGGTAGCGGCCAGACAT
TTATCATTTCTTGTCGCGCTTGCGGGCAATCAGCGGCAACACGTTTGCCATTTTCATCCA
GCCAGATGGGGAAACGAATGCCATTAATGCCTTCCTGCTCCGGCAGTAATAGAGTTGGCG
GCTGACTCCCGTCCAGCAGCCAGGTTGCCAGGCGGCGGCGACAGTTACCGTCACCTTCCG
GCAAAGACTGTCCGCCCGGCCAGCAGATAACGCCACGAGTGACTGAGTTCGGGCGCGGGT
CTTCCGGCAGATTCGCACTGCGCGACAGTAAGATATTATTGACCTGATTCAACAATGGTA
CGGCACTGGCAAAGCCAAACTGACCAACAACGGGCGTGCCGTCCGGTCTGCCAGTCCAGA
TCCCAATGACATAGCGAGCGTTAACCCCAATCGCCCAGGCGTCACGATAGCCATAGCTGG
TGCCCGTTTTCCATGCCAGTGGGGCGACGCGCGGCAAGGCACTATCCGGCAAGGGTTGCG
CTTCATCAGCCATAATCCGGCGAATGATCCACGCCGCCCCCGACGACATTAAAGGCCGTT
CAAGCAGCGGATCGTCAGGCTGTAAGCGCAATTTGCCTGCCTTGCCGTGGCGAGCAAACG
CGGTATACGCTGCCGCCATATCTTCCAGTTTTGCACCAGCGCCGCCGAGAATGAGTGAAA
GATTCGGCGCAGCACCGTTGGGCAAATATAACGGCAATCCAACATTGCGTAACTTTGCCG
CAAACCGTTTCGGTCCATAGGCTTCCAGCACCTGCACAGCAGGTAAGTTCAGCGAGCGCA
CCAGCGCCTCGCTCATGCTGATCGGGCCATGAAAACCGCTATCAAAGTTACCTGGTCGAT
AATCACCGGTGCGCCGGGGGACGTCTTGCAGCAGTGATGCCGGGTGGATCAAGCCTTCAT
CCAGCGCCAGACCATAAACAAACGGTTTGAGCACTGATCCTGGCGATCGGATCGAATTGA
CCATATCAACATGACCAAAGCGTGAATCATCGTTGAGATCAACCGATCCCACCCAGCCGC
GAACACGCATATCGGTATGATCAACCACGATCATCGCCAGTGAGCTGCGCGGTGGCAACC
GCCCTTTCCAGTTTTGCGCCAGTTCTTCCAGACGTCGTTGAAGACCGGCATCCAACGTAG
TAGTGATTTTGTCGCTTTTGCTTTTACCGAGCATCATGCGCGAAAACAGCGGTGCCAGTT
GCGGCATTTGTCGGGGGGCCAGCCAGATGGGTTCTTCCCTTGACTCTTTTACCTGCTCAC
GGGACCACACACCTTGCACGGCCATCCGTTCGAGCACTTTATTACGCGCGGCTTCGGCAC
GCTCCGGCCAACGATCCGGGCGAAGACGGCTGGGCGCTTGCGGCAAAACCGCCAGCATTG
CCGCCTCGGAATAGCTTAAATTCGCAGGCGATTTTCCGAGATAAGCCCAACTTGCCGCAC
CGATCCCCTGCAACGTACCGCCAAACGGAGCGCGGTTAAGATACAAGGTCAGAATTTCAC
GCTTAGACAGATGCCATTCCAGTTGCAACGCGCGCCAGAGCTGGCGAATTTTGCCGCCAA
ATGTTTTGGGGTGAGGATCAAGCAGACGAGCAACCTGCATAGTGAGCGTGCTGCCACCGG
AAATAACCCGTCCCGAAGTGAGATCTTGCCATGCTGCGCGCGCCACCGAGAATGGATTCA
CCCCCGGATGCTTCCAGAACCAGCGATCTTCATAATTGATCAGCGCTTCAAGGTAACGTG
GAGAAACATCTTCGATTGTTACCGGATAACGCCAGATGCCGTCAGCATCGGCGAAGCGCC
AGAGCGGCGTACCATCCTGCGCCACGACCACTCGTGCGGGATTGACTTCATGCAGCGGTA
GAGGCCAGAGTTTATCTGCTCCCCACGCTGCAAGAAAAAGGAGAAAGGGCGCGGCTGCCA
ACGTTATCCAGCAGCCGCGTTTGGTTAACAAGCGAGGCATTTACGGTCTGACAATCAGCA
GATCTTCAGCCGCGCCGGTCGCCCGCCATTGGGGAACATACATTGATTCCACCATCGGTT
GCGGTACCTGATACGTTCCCGGCGTCACCGCCCGCGCCAGATACACCAGCGTTACCGGTT
GGTATTCATCAACGGCAACCGCCGCCACAAAGCGATCGTCACGGAACTCAATGTGCTTAA
TGCTCGCCTGCTGCATCTGGTTCAGTAAGTTCTGCACTTCGCCACCACTTTGCTCCAGGC
TGGCGCTACCGTTCGCCAGATTCTGGTTTTCCAGTTCCAGACCCGCAGGCAGCAGATCCA
CGACTAACGCATCCGGCACGCTGTTACTGGCTTTTACCTGCAACCACACCAGCACCAGAT
CGCCGCTACGTAACGAGTCCAGCGATTTGCTCTTACCATCAGTACCAAGAATATGACGCT
CGATTTGCAGCACATTGTTCGCCGGTAAAGGTGCGGATTGCGGATAACCGCTGGCATCCA
TACGCAACCATAACGGCTGATCGCCACTGTTGCTCACCTGCAAGGTGACAAGTTGATCGC
TATTCAGATTGCTGTTTTGCGCTTTCTCGCCTGTCAGCTGCTCAGCTGAGAAAGAGGTTT
GCGCCTGCCATTTACCGGGTAAATCCTGAATCGTACGGGCAGCCAGGAACAACGCGTTAC
TTTCCTGCGTCGATAGCCAGCGTTCACCAAACGCCTGCTGCGAAAGTGTGTTCAGCAAAG
TGTACTGCTCATCGGGTAGCAGTTTATTTTCTTCCAGCAAGGAGAGCATTAACGCGTTGT
CGCGCAGTGAACTACCGTAATCACCCAGCCATATCCGCTCATCACTATTACGCGGCGTTT
TCAGCGCCAGCGCAATCGCTTCTTCACCACGCGTCGCATCACCCATGGTTTTCAGCGCAA
CGCCAAGTTGCAGCAGCGGTAAACCAGAAGCGGCATCTGCACGATGCTCCCAGATTTCAC
GCAGCGCACCCAGCGGAGCCTTTTGCTGACGGGCCAACACCAGCGCAGCGTAAGACTGTA
CGGCGAATTTACTGGCTTTGAGATTATCCGCGTACGGGATCGACATCATGCCCGGATCTT
GTAAATAGCGCAGCAGACGCTCATTACCCCGGTTAATGGCGTCTGTCGGCACGCTGTAAC
CCTGTTCGCCTGCGCGGACCAGGAAATCCATCACGTAAGCCGTCAGCCAGTACTCTTCGT
CACCGTTTTTATCCCACAGCGCAAAGCCGCCGTTATCACGTTGCATTTGCAGCAAACGGG
AAATGCCGATATCGACCGATGCACGGCGTTTCTCATCACTGTCGCCTTTGATGCCCAACG
CCTGCAGTTGGGCTGCGTTGGTATAAAGTGACGGAAACAGGCCGCTGGCGGTTTGCTCAA
GACAGCCGTACGGATACGCTTTTAACTCTTTGATATAACGTGCGATGTTCAGCGGTGGTT
TGCCGCTCAACAACAATTGCCCTTCCAGCGTAACAGGCGAGAAGTTTTGCAATCCATCCG
CCGGAATCGCCCATGTCTCACCAGGCTGTAACGCCGTACCGTAATTAACCGTTTGTGCCG
GGAACGCCGGACGGACGCCGATTTTCCACTGCTTATGCTGATCGGCAACGGTTTCACCCG
GTAACGCTAACCCGCTAATGGTGGCCTGAATTTCTCCATCGCCATAACCCGGCAATGCTC
GCACCGGGATAAACAGCGTAGTACGCACACCTGGCGCTAATTCAACGGCTGCGGGTGAAT
CGCTGACCAGTTCAAGCAAACCACTGGCGGTCAGGGCAACGTTCAGTTTTTGCGGTTTAT
CGGTAAGATTAGTGATATCCAGCGTCAGACGCGAGGTATCGCCACTCGCCATAAAGCGCG
GCATGTTCAGTTCAGCAATCACCGGTGCGGCAACTATCACTTTACTTTCGTTGCTACCGA
AGTCATCTGCCGTCCAGGCTTGCGCCATGACGCGCAATTCACCGTTAAAATCGCCAATCG
GCAGTGTAACCGAGCCTTCGCCCTGTTCGTTGAGCGTTACCGGCAGCGCCTGCTGCACGA
CAATATTGACGTGATTGACCGGCGGTTTACCACCACGTTTCAGCTCATCACCATCGCCAC
CGAAACGCAGAGCTGCCAGACGCCCCTGACCTTCAATAACCTGACCGTAAATATCGTAAA
TGTCTGCGCCATAGCGTTTCTGACCAAAGAACGCCTGCCACGGATCTGGCGTGACGTAGT
CAGTAATATTCAGCACACCACTATCAACGGCAGACACCAGCACATTCACCTGTTTAGGCT
TCTCGCCATTTTTAGTGCTGGCTTTAATTTTCACGGTTAATGGTTGATTGGGACGCATTT
TTGCTGGTGTTTCCAGCGCCAGATCGAGGCGACGGTTTTCATCGCCAAGCGGCAGATGCA
ACACACCAACCGCGCGTTTTGGCGTCGCGGAGCGAGATTTATCGCCAGGACGTACCACCA
GCGTACTTAAATACAGATCATGACGATTCCAGGTTTTATCGACCGGAATCGTCAGATCCA
GCCCTTGAGCCCGAACATCAATCTCTTGCCACCACAGCGGCCCTTCACTGGACTCGACCA
TCGCATAACCTTTACCCGCCGTTGGCGCGGCGATATGCAACTTAATGGTGTCGCCAGGGC
GATAACTGGCTTTATCCAGTTTCAGCGTGACACGGTCGGGTCGCACTGCGCCGCTACCGT
CGCTGTTGTCCTGCCAGCTATAGCCAGCCCAGAAACGAACACTACTGACCGCTTCATTCG
GCGCTTTGACTTCCAGACGATAAGCGCCCCACTCTACCGGAAAACTGACCTTGCCGGTTT
CGTCCGCTTTCAGATCCAGAGTTTGTTCATTTTCGATCAGATCTTTTTGATCAAACTGTG
ACTGCCAGCCTTCATCTTCTGACCAGTTCCAGTAGTAATCGCGGCGTTCGCGAATCAGGC
GCACCTGCAAGCCCGACACGGCTTTTTTCACGCCTTGCGCATCGCTATAAACGATGTCAA
AAGCGGCGTTACTGCCTTCATCAACAATGGGCTGTTTCACCGTGCTGTCAGTACGATAAT
CGTAAACCGATTTCGAGGCGAACTGCGGACGGATCCCCGGCAATGCATCGGCAGGCCAGA
TAGCCTGCTCAGCGCGGCGCGTCACCGGGCGACCGCCCGATTCCAGCAAACTACCCTGGA
AAATAACCTGTAATGGGGAATGCGTTTCCTTCCACTGGCTTTCTGTAGAAACTTCGCCGC
GCCCTTTATCATCCAGCGTCAACTGAACTTCATCCAGCGTGCGGGAAAGATTTTCGGCAG
CTATATCGCCGAATTCAAAACCAGGTAAGGCTGACACAGCTTCACGCAGTGGGCGCAGGA
AAAGTTGCCCTTGCAAAGTATTACCATTAGCAGGTGCACCATACAGGTAGTACCCCACCA
CGGAGAATTTCACTTCATCTTTCGGCGTTAGCGGGGTTTTCTCACCGGTCAGATTCAGCG
CCATGCGCTCTGGCATAAAATCTTCGACGTGGAAATCCCACATCCGATACTGATTATCGC
CCGTGTTAGCGCGAATATGCCACATACCGGTTGCCGCATTGCTATCGAGTGGCCAGGTAA
AGTGGTAGAGGCCATTCTCCGGCTGACTAACGACGCTCCTGAGTACCTGCCCATCGGGTT
TAATCACGTCTAACTTGATGGGTTGATTGGGCAACGCTTTACCGTCTGCATCACGCAGCA
AACCATTGAGGATTACCGTTTCACCTGGGCGATAAAGATCGCGTGGGCCAAACATGAAAA
ACTGTTTGCTATAGCCTGGCGCGCCAGCAATGTTAAATTCTGCTAAGTCCAGCGCCGGAA
GTTTTAAATCGAGTAGCGTTGTCTGACCGTCTTTACGCGCCAACAGTAATGCCGCGTTTT
TATCATTTTCCAGCTGCACATGCCCCTGAGCGTCACTGGTTGCCTGAGTCAGAGTCTGCC
CTTTCTCATTTAATAAAGAGACTTCAATTCCTTGCTGGGCCGCGCCGTTTTCCAGACTTT
GGGTAAAGATATCCAGACGATTGTGATAACGGTGAGCTGAAACGCCGATATCACTTAACG
TAAACAGCGTCGCGGGATTACTGTAATCGTAACGTCCAGCCTGATTCATCACAGCCAGAT
ACACGCCCGCCTGCTGAAGCGGTTTGATATCGCCCAGCGGCAGCAATAATTTTTCACGGG
TGTTACGCGCAGGATTGAGATCAAACCGTCCGGTGTAGACCAGATCCGCCATCTGCAGCA
GTTTGTCTGACTGCCAGTTCGCCAGCGAATTGCGGTATTCCCATTGGCTAATGAATGCTG
GCAGAGATTCTGGCTTAACGCGGAAGAAGTTAACATCGACATTATTAACGTTGAGCGCCA
TTACCGGCAGCCCTTCAACGACTTTGCCAGGCAGCAGCGAACCACGGCTGGCAAAACCGA
CGCTGGGTTGGATGTCGCGGGTAGTTATAGTTTTTTCGTAATCTTTACTGAAGGTTGCGT
TGTTGAGTGCTTTGACCTCCTTGCCAATAGTAACGATCAAATCACGTTTCGGTTCGAGGT
GGCGTAAACGTAACTCTTTAAGATTATCTGACAGCTCCCAGGCACCATCCACTTTGCCGC
TTTTTTTATCGACGACATGAATAACGCGTGAGAAATCCTGATCCGGGTCGAGAGGGATGG
AGAACGTCAGCACCAGCGTGGCTGCACCATCAAGTTGGACTTCAGAGAGATCCAGCAATG
TCAGCACCTTACCGGCACTCTGTTGGGCCAGTTTTTGTCTCTCCGGCACGGAGAGTTTTG
CTGAACTCGCGTTTTCTGAAGAGGCCGCTTTAGTAACTTCAGAAGGCGCATCTTTTTTCA
CCGCTGTTGGCGCGTTATCGTTGTTGTCGCACCCTGCCAGCGCCAGCATTAGCATGCAGG
CGGCTACGCGTAACTTTTTCATTTTTCATCCCTGCCACAATGGCCCGTTAGCAACGTCGA
ATAATTATTATGCGTGAGAATTTACGTTATGTAATTCAGTATCACGCCCATACAATCCGA
ATTTTAGTGAGAATTGTGGCTCAGACAGCCAAATCAGCCTCTTTTGCTTGTCGCTTTTCA
CTAAACATCCGACAATTTAGCCTAACCCCGGCAAAAATGGAGATGCCTATGTCCACGACA
TGGTTTGTAGGAGCCGACTGGCTCGCCGAACATATTGATGACCCGGAAATTCAGATTATC
GATGCCCGCATGGCGTCGCCTGGACAGGAGGATCGTAACGTTGCTCAGGAGTATCTGAAT
GGACATATTCCCGGCGCAGTGTTTTTTGATATCGAAGCGCTTTCTGATCACACTTCCCCG
CTTCCGCACATGCTGCCGCGCCCGGAAACGTTCGCCGTGGCGATGCGTGAATTAGGCGTT
AACCAGGATAAGCACCTGATTGTCTATGACGAAGGTAATCTTTTCTCAGCCCCACGAGCA
TGGTGGATGCTGCGCACCTTTGGTGTAGAGAAAGTGTCGATTCTGGGGGGTGGACTTGCA
GGCTGGCAGCGCGATGATCTGCTGTTAGAAGAAGGTGCAGTAGAGCTGCCGGAAGGAGAG
TTTAACGCCGCGTTTAATCCTGAAGCCGTGGTGAAAGTAACCGATGTATTATTGGCAAGC
CATGAAAATACGGCGCAAATTATTGATGCCCGCCCGGCTGCACGTTTTAACGCAGAAGTT
GATGAACCTCGCCCAGGTTTACGTCGCGGACATATTCCCGGAGCACTGAATGTTCCGTGG
ACGGAACTGGTGCGCGAAGGCGAACTAAAAACGACCGATGAACTGGATGCGATATTTTTT
GGTCGCGGCGTCAGCTACGACAAACCAATTATCGTCAGCTGCGGCTCTGGTGTAACGGCA
GCCGTGGTTTTGTTAGCACTCGCGACGCTGGATGTGCCAAACGTGAAACTGTACGACGGC
GCATGGAGTGAATGGGGCGCGCGGGCAGATTTACCGGTTGAGCCAGTGAAATAAGTATTT
TACAGGCAATAAAAAACCGCCGAATTTGGCGGTTTTTTATTGCTAGTCTGGTTCGCGGCC
TTTCCAGCAGGTTGACTTGTGTTACATGAGCAACGCAGGTGCTTCACAGCAAAACAATAC
TCACCAGTAACTCTCTTTTTGTCAAGCAAAAGAGAGTAATTATTGTTTATTTAGCGTATT
ATCGACACCGGCCCTTTCCGCCGTGTTCGGTAATAAAATAACCTGGCTTATTAGTCCGAA
TTCAGACAAATATAAATAAATCCTGCTCAAAATTAAAAATTCTAACCGGTAAAAGATATT
ACTTAAACATGTAAATTCACTTTCCTTTAAAAAACAAAAAACCGCCAAAATCAGGCGGTT
TTTTGTTGCTGGTCCGGTTCGCGGCCTTTCCAGCAGGTTGTATTACCGTAGTAATGCAAG
CGCGTCTCAGCGGAGACAATACTCGCCAGTAACTCTCTTTTTGTCAAGCAAAAGAGAGTT
ATTATTGTTCTGTTAGTGTATTATCCACTGCGGCCCTTTCCGCCGTCTCGCAAACGGGCG
CTGGCTTTAGGAAAGGATGTTCCGTGGCCGTAAATGCAGGTGTTTCACAGCGCTTGCTAT
CGCGGCAATATCGCCAGTGGTGCTGTCGTGATGCGGTCTTCGCATGGACCGCACAATGAA
GATACGGTGCTTTTGTATCGTACTTATTGTTTCTGGTGCGCTGTTAACCGAGGTAAATAA
TAACCGGAGTCTCTCCGGCGACAATTTACTGGTGGTTAACAACCTTCAGAGCAGCAAGTA
AGCCCGAATGCCGCCCTTTGGGCGGCATATTTTAGATTATCCGATTCTGTTTAAAGTCAC
GCAAAAAACCACCCCAGCGACGTTCATAGAATGGCGCAATATGTTCGGTAATAAAGTGGC
TAATTCCTTTTTCCCCTTTTTTCACCTGACAAATATCGATTGGTTCATCGCCAGGTAATG
TATCGGTCGCTACACTTCCCGTCGCCTGAATAATTTCTTCGATATCACCATCGGCTTCAA
TGCCAATAAGTAAATTAGGCTGTGCCTCTTCGTTCTCTTTAATTGAACAAATAAAAGCAC
GCTTCACCGGCTTAATGGTTTTAAATAAGGTGGTGAGTGAATCAATCATTTGTGCTGGCG
GCTCTGCGACTTCCGATAATATCAGCGATTCACCGCCTTCCAGGATTTCCTGGCTGCTCA
GCGGATTTCCCTCTTCACCAATCAACAAACTGATTTCACGCGGCATAAATTCTTTACCGG
TTGGCAGTTTGGCATTAAGGAAGAGCGTTTCGCCAAGTGTCATCTCAAACAGCGTGCGAA
CGGGCATTACGACAAATGCCTGTTCGTCTTCAACCGCCTGTTGAAGTGCTTCTAACGAGG
TGAAAAAAGGAATGACGCTGGTGCCGTCTTCTTTTTCCCAGTGCTGTAAATCAAGCGCGC
TATCTTCAACCACAGCCTCGCCCTGCGCCGCCGTACCAGGCACCCAGACGGTGGATTCCA
GTAGAGTACGGAAAAAGGCCGGGCGGTGCGCCGGTTCAGTTGCTGCTTTTTCCAGCAGGT
CTTCAAGTTCGTTTTTTGTTTCGGACATAAGAACCACAATTCATTCAACGTTCGGGGCGC
AAATGCCTGATGCGCTACGCTTATCAGGCCTACAAGGGATTCGCAATTTGTTGAATTTGC
AGAATTTGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCATATTAGTTTACGCCGTTA
ACAGATTAGCTATCGTGCGCACACCAAGTCCCGTAGCGCCCGCAGACCACTGTTCAACCG
GCGCTTTACGGTAAGTCGCCGAGCAGTCGATATGCAGCCAGCCTTGCTGATAGTTCTCAA
CAAAGTGCGACAGGAAGCCCGCCGCCGTGCTCGCGCCTGCCGGATACGCCGCGCTTCCGG
TATTGTTCAGTTCGGCAAAGTTAGACGGCAGCTGGCTGCGGTGGAACTCCGCCAGCGGCA
GACGCCAGAACGGTTCGTTCTCCTGCGCGGCACTCGCCAGCAAGCGACCGGCCAGCGCAT
CGTCAAAACTGAACAGCGCGTGATAATCATTACCCAGCGCAGTTTTCGCCGCCCCGGTGA
GGGTCGCCGCATCAATGATCATTTCCGGTTTCTGCGCACTGGCATCAATCAGACCATCGG
CAAGCACCAGACGCCCTTCGGCATCAGTGTTCATCACTTCAACTTTTTTACCGTTGCGAT
AGGTGATGATATCGCCCAGCTTGAACGCATTGCCGCTAATCAGGTTATCCGCACAGCAGA
GGAACAGCTTCACGCGCTTGTTCAGTCCGCGCGTAATGGCAAATGCCAGCGCCCCGGTAA
CCGTTGCCGCGCCGCCCATGTCCGACTTCATCGAGTCCATAAACGCAGTCTGTTTGATGC
TGTAGCCGCCGGAGTCAAAAGTGATACCTTTACCTACCAGGCACGCGTACACTGGCGCTT
CTTTATCGCCAGTTGGGTTGTAATCCAGCGCCAGCAATACCGGAGAACGTTCTGAACCGC
GTCCGACTGTGTGCAGCCCCATATAACCTTGCTCACGCAGATCTTCGCCTTTGGTGATCC
GATAAGTCACACGATCGCCCGCGACGTTGCTGATCAGATCAACAGCACGCTGTGCCAGTT
GCGATGGTCCCAATTCTTCTGCCGGTGCGTTGATGGTGTCACGCACCCAGTCGATGATCA
TCAGGCGGTTATCCAGTTCCTGGCGCTGGGCATCGTCCAGATCCGGCCACACCACTTTAC
GCGTGCCTTTCGGGGCTTTGTAACCTTGCCAGAATGCCCAGCAGCGATCCGCATCCCAGC
CTTCACCGCTTAACTGAACATGCTTGATGCCCAGACCGTCAATCTTGCGCGCCGCACGCT
GGATCAGCCCCAGATCGTCTGCCCCGTTCAAATGCAGGGTAATGCCGTCATTATTAATGC
TGTAAGTTGCTTTTTCTCCCCAGCGCGCGTCGGCAGGTTGGGTAGAGAGGGTAATCTTCA
TCGCTTCTGTCATTTTAGTTATCCTTCTTTGTAAAAGGGCCGCCAGTTGGCAGCCCCAGG
ATTTTTCCGCTAAATGATTCGCGTTGCAGGAAGGCGGCAAGTGAGTGAAGCCCCAGGAGC
ATAGATAACTATGTGACTGGGGTGAACGAGCGCAGCCAACGCATCTGCGGCGTGAAGCAT
GACGCGGAAATTATTCGGCCTCGTCCAGCCAGACTAACAAAATCGCTTCGAGGATTTTCT
CGTTGGATGCCTGCGGGTCGTCGTCGAAATCTTCCAGATCGCAAATCCACTGATGCATAT
CGGTGAATCGAACCGTTTTCGGATCAAGATCGGGATACGCATCGTACAGTGCTTCGCCAA
TTTCGCGGCTATCGGTCCACTTAAGTCCCATACTAACCTCTGTTAATGCTCACGCGCATG
GTTGATAGTGTAACGCGGGATTTCGACTACTAAATCTTCGTCGGTAACGCGCGCCTGGCA
GCTTAAACGGCTTTCCGGCTCCAGTCCCCAGGCTTTGTCCAGCATGTCGTCTTCCTGCTC
TGAGCTTTCCGGCAGTGAGTCAAAACCTTCACGAACGATGCAGTGGCAGGTGGTGCAAGC
ACAGGATTTTTCACAGGCGTGTTCAATCTCGATACCGTTACGCAGAGCTGCGTCGAGAAT
GGTTTCACCGCTATTAGCTTCCAGAACAGCGCCATCAGGGCAGAGATCCTGATGAGGCAA
AATAACAATCTTTGGCATATTAAACCTCGTCCACGGAATGGCCTTTCAGCGCACGACGAA
CCGACTGGTCCATGCGGCGAGCGGCGAAATCCTGGGTTTGTTTGTCTACGTTTTTAATCG
CTTGTTCGATGGCGTCAACATCATCGCCCTGCGCCACTTCACTCAGGTGAGCGGCAGCAT
CGTCAATGACCTGACGTTCTGCGGCGCTTAACAGCGCGGCATCAGCAGCCAGCGCGCCGT
GCAGACTTTCCAGCACACGCGCCGCTTCTACTTTTTGTTCTGCCAGCATTCGGGCTTTTA
CGTCCTGCTCGGCATAGCTCATTGAGTCTTTGATCATCGAAGCGATTTCGCTATCGGTCA
GACCGTAAGACGGTTTGACCTGAATAGACGCCTCAACGCCGGTGGATTTCTCCATCGCCG
TCACGCTCAAAAGACCGTCGGCATCGACCTGGAACGTCACGCGAATATGCGCACCGCCAG
CCGGTAGCGCCGGAATACCACGCAGCGCAAAACGCGCCAGTGAGCGGCAGTCCTGCACCA
GTTCGCGCTCACCCTGCATTACATGGATAGACATCGCCGTCTGACCATCTTTAAAGGTGG
TGAAATCCTGAGCGCGGGCCACCGGAATAGTGGTATTACGCGGAATCACTTTCTCCACCA
GGCCGCCCATCGTTTCGAGGCCCAGCGACAGTGGGATCACATCAAGCAACAGCATTTCGC
TGTCTGGCTTGTTACCCACCAGAATATCCGCCTGAATCGCCGCGCCAATAGCGACGACTT
TATCCGGGTCGATGGAAGTCAGCGGTGGACGACCGAAAAATTCGCCTACCCGTTCACGCA
CCAGCGGCACGCGAGTAGAACCGCCCACCATCACCACTTCCAGCACTTCATCAGCTTCTA
CACCCGCGTCTTTCAGCGCGCGACGACAAGCCAGTAAGGTTCGTTTTACCAGTGGCGCGA
TCAGTTCATTGAATTGTTCACGGCTGATTTCGCCCTGCCAGCCCGCAACGTTAACGGTCA
CGGAGTCCGCATCGCTCAGCGCGATTTTGGCTGCAATGGCGGCATCCAGCAGTTCACGCT
GAACGCGGTTATCGCTACGATCAGGAATGCCCGCCTGCTCGCGAATGTAATCCGCCAGCA
GATGGTCGAAATCATCGCCGCCGAGCGCGGAATCACCGCCGGTTGCCAGCACTTCAAACA
CGCCGCGACTTAAGCGCAGAATGGAAATATCAAACGTCCCGCCACCGAGGTCATAAACGG
CGATCACGCCTTCCTGACCGGAATCCAGCCCGTAGGCGATAGCCGCAGCGGTCGGTTCGT
TAAGTAAGCGCAGGACGTGAAGGCCCGCCAGACGCGCCGCGTCTTTGGTGCCCTGACGCT
GGGCATCGTCAAAGTACGCCGGAACGGTGATAACTACACCATCCAGCTCGCCTGCCAGGG
CTTCAGTTGCCCGCGCCGCCAGTGCTTTGAGGATGTCCGCAGAAACGCGCACCGGGTTCA
GCAGCCCCGCCGCCGTTTCAATCATCGGCAGGCCGTTTTCGCTGGCCTGGAATTGATAAG
GCAGATGCGGATAGCGTTGCTGGATATCAGCCAGCGAGCGTCCCATCAGGCGTTTAACAG
AACTAATTGTGTTGGCGGTATCGAGCGCTGCATTAGTACGCGCGTCATAACCCACCGAAT
GCCCTTGCTGTTGATAGTGAACAACAGATGGCAGCAGGTGACGGCCTTCATGATCGGCTA
ACGTTTCGGCCTGACCGCTGCGCACTGTCGCCACCAGCGAGTTGGTTGTGCCCAGGTCAA
TACCGGCCGCCAGACGACGCTGATGCGGCGCAGCACTCAAACCAGGTTCACTAATTTGTA
ATAAGGCCATGTTTAGCTTCCAGAAATTAAAAATCGAGCAGTTTTTCTTCGAGTTGTTCG
GCACTGCTTCGCAGTTTATCGAGAAAACGCAGCTTACGCACGGTATCCGCCGCCGCGTCC
CACGTCTCGTTGTCTAACTGTTCAACCATCAACTGATGGCGGGTATCAAACATCTTTTTC
ACACGTTTGATAAAGCTTTCCAGCCGCGCTTCATCTTTCGCCTGTTCGATCTCGTCCAGC
TCTTCGCGCAGCTCCAACTGTTCCATCAGGAACGCGGTGTCGCGCACAGTATGCTGCTCG
CTGGCGAGATCAAAGCCGTGCAAAGAAAGCAAATATTCCGCGCGCATTAACGGATGACGC
AGCGTTTGCCAGGCCTGGTTAATGGTTGCAGATTGCTGTACGGCGGCGAGTTGTTCCGCC
TGGCTTCCGCTGGCGAATTTATCAGGATGATACTGACGTTGTAGATCCTGAAAACGCAGG
CTCAGCGCCTGGGTATCGAGTTGATAGCGGGCAGGCAAGCCAAAGAGGGTGAAGTAATCC
ATAACATTCTCAGGGCTGCGATCCGCCGCGATAACGGCGAATCAGGTAAAACAAACCCCA
CGCGCAGGCGACCACGGTGGGGTTATCGGTATGCGCATCAAACGTGGAAGCTTTCGCCGC
AACCACACTCATCTTTGACGTTCGGGTTGGTGAATTTAAACCCTTCGTTCAGGCCTTCTT
TTACGAAGTCCAGCTGCGTACCGTCCAGAAATTGCAGGCTCTTGCCATCGACCACGACTT
TCACGCCTTTGTCTTCAAACACGATGTCTTCCGGCGTCGGTTCGTCAACAAATTCCAGTA
CATAAGCCATACCTGAACACCCGGAGGTTCTCACGCCCAGACGCAGGCCAAACCCTTTAC
CGCGGTTAGCCAGAAAGGTATTTACTCGCGCTGCTGCACTGTCGCTCAGTGTAATCGACA
TAACCAAACCTCAACTCTTATTTTGCTTCACGTTTGCTTTTATAGTCCGCAATGGCGGCT
TTGATCGCGTCTTCTGCCAGAATAGAACAGTGAATTTTCACCGGCGGCAGTTCAAGTTCT
TCAGCAATATCGGTGTTTTTGATCGCCTGCGCTTCGTCGAGAGACTTCCCTTTCACCCAT
TCGGTGACCAGGGAGCTGGAAGCGATAGCGGAACCGCAGCCGTAAGTTTTAAAACGCGCG
TCTTCAATGATACCTTCATCGTTGACTTTAATCTGCAACTTCATCACGTCGCCACAGGCC
GGTGCCCCCACCATGCCGCTGCCGACGTTCTCGTCGTTGTTGTCAAAGGAACCCACGTTA
CGCGGATTCTCGTAATGGTCGATAACTTTTTCGCTGTAAGCCATTATAAATTCTCCTGAT
TCCGATACCGATTAATGATGAGCCCATTCGATGCTGTTCAGATCCACGCCCTGCTTGTAC
ATTTCCCACAGCGGAGAAAGGTCACGCAGACGACCGATGGATTTACGAACTAACTCGATG
GTGTAGTCGATCTCTTCTTCAGTAGTAAAACGACCTAAAGAGAAACGGATAGAGCTATGT
GCCAGCTCGTCGTTCAGCCCCAGCGCGCGCAGCACGTAGGACGGTTCGAGGCTTGCTGAC
GTACAGGCGGAACCTGAAGAAACTGCGAGGTCTTTCAGCGCCATAATCAGCGACTCACCT
TCAACGTAGTTGAAGCTGACGTTGAGAATGTTCGGCGCACCGTGTTCCAGGTCACCGTTC
AGGTAAACTTCTTCGATATCTTTGATGCCGTTCCACAGACGGTTACGCAGGCCGCGCAGA
CGTTCCATCTCGGTCGCCATCTCTTCTTTTGCGATGCGATAGGCCTCGCCCATTCCGACG
ATCTGGTGAACAGGCAGAGTGCCGGAACGCATACCGCGCTCGTGACCGCCGCCGTGCATT
TGCGCTTCGATGCGTACGCGCGGTTTACGACGTACATACAGCGCACCGATACCTTTCGGG
CCATAGATTTTGTGACCGGAGAAAGACATCAGGTCAACTTTCAACTGGCTCAGGTCGATA
GGCAGTTTACCCACGCTCTGGGTTGCATCAACGTGATAGATAATGCCACGAGCACGGCAC
ATTTCGCCGATAGCCGCGATATCCTGCACCACGCCGATTTCGTTATTTACGTGCATGATG
GACACGAGGATGGTGTCGTCACGCATCGCTGCTTCAAGTTCTTTCAGGTCGATAATGCCG
TTACGCTGCGGTGCCAGGTAGGTGACTTCAAAACCTTCGCGCTCCAGCTGACGGCAGGTA
TCCAGTACCGCTTTGTGTTCGGTTTTGCTGGTGATGATGTGCTTGCCTTTTTTCTGATAA
AAGTTGGCTGCACCTTTGATCGCCAGGTTGTCAGATTCGGTTGCACCAGAGGTAAAGACG
ATTTCACGCGGATCAGCGCCGACCAGATCGGCAATCTGATTACGGGCGATATCTACCGCT
TCTTCAGCCTGCCAGCCGAAACGGTGAGAACGGGAGGCCGGGTTACCAAAGGTTCCGTCC
ATCGTCATAAACTGCATCATTTTCTCGGCAACACGCGGGTCCACCGGCGTGGTTGCGGAG
TAGTCGAGATAAATCGGTAATTTCATTGCTCTATAAACTCCGTACATCACTCAATGCAAG
GAATCAGGCTACCGGCTGGATGTACGACCGTGTTTACGGAGTATTTAGCACTCCGGCCTG
ATTCTGAATTCTTTTTATTAAGCGCGTAACTTAACGTCGATCGCGTCTTGTGTGCGGGTG
CGTGGCGCGTCGTGAGTATGCTGACGACCAGACACATCCAGCACTTCCTGGTTATTAACC
AGTTCGCCTAAAGTAATGTTGTTGAGAAAACCGGTGAGACGGTCGCTCAAATCACGCCAC
AGCGCGTGGGTCAGGCATTTATCGCCGCCCTGGCAGCCGCCTTTACCCTGACAACGGGTG
GCATCTACAGATTCGTCAACGGCGCTAATTACTTCGCCAACGGCGATGCTGCTGGCATCT
TTGCCTAACAGATAACCACCGCCTGGTCCACGTACGCTGGAAACCAGACCATTTTTACGC
AGACGGGAAAACAGTTGTTCCAGATAAGAAAGGGAAATTCCCTGACGTTCGGAAATATCA
GCCAACGGTACCGGGCCCGCTTCAGAGTTGAGCGCAACGTCAAGCATTGCGGTCACGGCA
TAGCGCCCTTTAGATGTCAGTCTCATGTCTTACTTCACCTCAAACTCGCCCCTGCCCGGG
GTTTTTTATTGTAAAAGTGGGGGTATTGCATAGCAGGGTCAAGTCTGACATTCCCGAGTA
AATTGGTCAACTATTTACTTGACTGATTTAGTCGGGTATTTAACCTTCAGTGCCATTTTT
TTATCGTGGCGTTTGTACCTGTTGTCGGATGCGGCGTGAACGCCATATCCGCCCTGGGGT
TCTGTACACTGTAGGCCTGATAAGACGCATTACGCGTCGCATCAGGCAACGGCTGTCGGA
TGCGGCGTGAACGCCTTATCCGACCTACGGTTCTGTTCACTGTAGGCCTGATAAGACGCA
TTACGCGTCGCATCAGGCAACGGCTGTTATTCGGCCTTGTTACCTTTATTCTGCTGCTCA
ATAGAAGCCAGAATCCCGCGCAGGATATTCAACTCCTGGCTTTCCGGGCGCGCACGGGTA
AACAGACGGCGCAATTTATTCATCACCTGCCCCGGATGGTTTTCACGGATAAAACCGGTT
GCCAGCAGCGTTTGTTCCAGATGACCATAAAAACGCTCCAGATCATCGACCAGCGGATAC
GGCGTCTCTTCATGCTCGACCTGCTCGCCGTTTTCCTGAGTTGCCAGCCAGGCCATGCGC
ACTTCATAGGCAATAACCTGAACCGCCATCGCCAGGTTCAGCGAGCTGTATTCCGGGTTA
GCCGCAATCGCGACATGATAATGGCATTTCTGCAACTCTTCATTGGTCAAGCCGACGCGC
TCGCGACCAAACACCAGCGCCACCGGGGTATTTGCCGCTTCAGCGACGCTTTTCAGGCCG
CATTCGCGCGGGTCGAGCATCGGCCATGGCAGCGTGCGGGAACGTGCGCTGGTGCCCACC
ACCAGGCTACAACCGGCTAACGCTTCGTCGAGCGTATCGACGATGTGAGCATTACCAATC
ACATCGCTGGCCCCTGCTGCCAGGGCAATCGCCTGGGAGTCGGGTTTCACCAGTGGATTA
ACCAGCCACAGATTGGTTAATCCCATTGTTTTCATGGCACGGGCAACAGAACCCATATTG
CCGGTGTGTGACGTCTCCACCAGCACAATTCGAATATTTTGCAGCATTGTCTTTCTTCAT
CTAAAGATTATTCACGCATCTTATCATAAAACGAAGACAGATGCCGATCTCGCTGCTATA
CTCTGCGCCGTTTTCCCGTTCTTTAACATCCAGTGAGAGAGACCGATGCATCCGATGCTG
AACATCGCCGTGCGCGCAGCGCGCAAGGCGGGTAATTTAATTGCCAAAAACTATGAAACC
CCGGACGCTGTAGAAGCGAGCCAGAAAGGCAGTAACGATTTCGTGACCAACGTAGATAAA
GCTGCCGAAGCGGTGATTATCGACACGATTCGTAAATCTTACCCACAGCACACCATCATC
ACCGAAGAAAGCGGTGAACTTGAAGGTACTGATCAGGATGTTCAATGGGTTATCGATCCA
CTGGATGGCACTACCAACTTTATCAAACGTCTGCCGCACTTCGCGGTATCTATCGCTGTT
CGTATCAAAGGCCGCACCGAAGTTGCTGTGGTATACGATCCTATGCGTAACGAACTGTTC
ACCGCCACTCGCGGTCAGGGCGCACAGCTGAACGGCTACCGACTGCGCGGCAGCACCGCT
CGCGATCTCGACGGTACTATTCTGGCGACCGGCTTCCCGTTCAAAGCAAAACAGTACGCC
ACTACCTACATCAACATCGTCGGCAAACTGTTCAACGAATGTGCAGACTTCCGTCGTACC
GGTTCTGCGGCGCTGGATCTGGCTTACGTCGCTGCGGGTCGTGTTGACGGTTTCTTTGAA
ATCGGTCTGCGCCCGTGGGACTTCGCCGCAGGCGAGCTGCTGGTTCGTGAAGCGGGCGGC
ATCGTCAGCGACTTCACCGGTGGTCATAACTACATGCTGACCGGTAACATCGTTGCTGGT
AACCCGCGCGTTGTTAAAGCCATGCTGGCGAACATGCGTGACGAGTTAAGCGACGCTCTG
AAGCGTTAATGACTCAGGCGGGTGATATCACTCACCCGCCCTCGCCTTTCAGGCGCTATT
CCGAAATACTTCCTCACTGCTTTACTTTCTTTCGTCACTCTCCCACCATCTTTCCCCGAT
TAATGGATGATAAAGAAGTCGCAAGGAAAGGTTATGGCACTGCCAGTGAACAAACGCGTT
CCCAAAATTCTGTTTATTCTCTTTGTTGTTGCCTTCTGCGTTTATTTAGTGCCGCGCGTT
GCCATCAACTTCTTCTATTATCCCGACGATAAAATTTACGGTCCCGATCCCTGGTCGGCG
GAATCCGTCGAATTTACGGCTAAGGACGGTACTCGTCTGCAAGGCTGGTTTATCCCTTCT
TCGACGGGCCCTGCTGACAACGCCATCGCAACCATCATTCATGCTCACGGCAATGCCGGA
AATATGTCCGCCCACTGGCCGCTGGTCAGTTGGTTACCCGAGCGTAATTTCAACGTTTTT
ATGTTTGATTATCGCGGGTTTGGTAAATCAAAAGGCACGCCGTCCCAGGCCGGATTGCTG
GACGATACGCAAAGTGCCATCAATGTGGTGCGCCATCGCAGTGATGTAAACCCACAACGT
CTGGTGCTGTTCGGGCAGAGTATTGGCGGGGCGAATATTCTGGATGTTATTGGTCGGGGT
GATCGTGAAGGCATACGTGCGGTGATCCTCGACTCCACATTTGCCTCTTATGCAACCATC
GCCAACCAAATGATCCCCGGCAGTGGCTACTTACTTGATGAGAGTTACAGCGGCGAAAAT
TATATCGCCAGCGTCAGCCCGATCCCGCTTTTACTCATTCACGGTAAAGCTGATCACGTT
ATCCCATGGCAGCACAGCGAAAAGTTGTATAGCCTGGCAAAAGAGCCAAAACGGTTGATC
CTAATCCCGGATGGCGAACACATTGATGCTTTTTCCGATCGTCACGGCGATGTTTATCGC
GAACAGATGGTGGACTTTATCCTTAGCGCGTTGAATCCGCAGAACTAACCCATGATCGCT
AGCACGATAATCATTCACAAAACCACCTTAAGACATGCTAATCCACTGGTCAGAACAGTT
TAAGATGAGAAAAATTCTGTGACGCTTGCCAACATTTCTGATGATTAGCATTCCCTTCGC
CATTTCCTTGAGCAAACTTTAGCTATTCTTATCAATTATGCTTATGGGAGATCTACAGAT
GATGCCTACGCTTGCTCCACCATCTGTCCTTTCGGCTCCCCAGCGCCGCTGCCAGATCTT
GCTGACGCTCTTTCAGCCGGGGTTGACCGCCACCATGGCAACCTTCAGCGAGCTTAATGG
TGTGGATGATGATATTGCCAGTCTTGATATCAGCGAAACAGGACGGGAGATCCTGCGCTA
TCATCAACTCACACTGACGACTGGTTATGACGGTAGCTACCGGGTTGAAGGTACAGTGCT
TAACCAACGTTTGTGTTTATTTCACTGGCTACGACGTGGTTTCCGTCTGTGTCCGTCATT
TATTACCAGCCAATTCACCCCCGCCCTGAAGAGTGAACTGAAGCGGCGCGGAATTGCGCG
TAACTTTTACGACGATACCAATCTACAAGCGTTAGTGAATCTCTGCTCCCGACGGCTGCA
AAAACGCTTTGAATCGCGCGATATTCATTTCCTGTGTCTGTATCTGCAATATTGTTTGCT
GCAGCACCACGCTGGAATTACGCCTCAGTTTAATCCGCTCCAACGTCGCTGGGCGGAATC
CTGCCTTGAATTTCAGGTAGCGCAGGAAATTGGACGCCACTGGCAGCGTCGGGCGCTCCA
GCCTGTACCACCTGATGAGCCACTGTTTATGGCACTACTTTTTTCCATGTTGCGGGTTCC
CGATCCATTGCGGGATGCGCATCAGCGGGACAGACAATTGCGTCAGTCTATCAAACGTCT
GGTAAACCATTTTCGTGAGCTGGGAAATGTTCGTTTTTATGATGAACAGGGGTTATGTGA
TCAGCTTTATACCCACCTCGCCCAGGCGTTAAATCGCAGTTTGTTTGCCATCGGTATTGA
TAATACCCTGCCGGAAGAGTTCGCCAGACTGTACCCACGCCTGGTGCGCACCACCCGCGC
GGCGCTGGCCGGATTTGAAAGTGAATACGGCGTCCATCTTTCTGATGAGGAAAGTGGTCT
GGTCGCGGTGATTTTCGGTGCCTGGCTAATGCAGGAAAACGATCTGCATGAAAAACAGAT
TATTCTTCTTACCGGGAATGATAGCGAGCGAGAAGCGCAGATTGAGCAGCAGTTACGCGA
ACTAACGTTACTGCCGCTCAACATTAAGCATATGTCGGTAAAGGCATTTTTGCAGACAGG
CGCTCCGCGTGGCGCGGCACTGATTATTGCGCCTTATACCATGCCATTACCGCTCTTTTC
ACCACCGCTGATCTATACGGACCTGACGCTGACAACACATCAACAGGAGCAGATCCGCAA
AATGCTCGAATCAGCATGAGGGAACAACTTTCGGGCGCAAAAACATTGCCGGAAGCGCCA
CCAGCGCCATTACCCAGAACACGCCGTGGCCCAGATATTGATACAGGAAACCGGCGAAAA
CGGTCATGATAGCGATACTGCCGCCCATCGCGACGGCAGAGTAAACCGCCTGTAAACGGA
TGACTTCGCTACCCTGGCGAGCAGCAATATAACGCATGGCGGCCAGGTGGCAGACCGTGA
AGGTGCCGCAATGCAGAATTTGCACCACTATCAACCACGGCAACGCCGTAGTTGCTCCCA
TAATGCCCCAGCGCACTACGCCGCAAATCGCCGAGATCAACAGCATATCGCGTGCACTAC
AACGGCGGAAAAGTTTATTACTCAGCGCAAAGATAATGACTTCCGCCACCACGCCCAGCG
ACCACAAATACCCCACCGCCGAGGCCGAGTAGCCAGCTGCCTGCCAGTAAATGGCGCTAA
AACCGTAATAGGCCGCATGTGCCCCCTGCAATAAACAAACGCAGGCCAGAAAGCGCCAGT
TCTGGCGAACCAGCGCCAACCACGCAGACCAACCGGTGCTCTCCTGCTGGCGACTTGCCC
CTTGTGGCTGAATCGTCGGACGGATGAGAAAGCCGAGCAGCATGGATGCCACGCCCAACG
TCAACAGCGCGAGGATCACCCGATAATCAAACATAGTGACCAGTTTGCCCGTCAGCGCCG
AGCCAATGACAAACGCCACCGAGCCCCACAGTCGCACTTTGCCGTAATCAAGCGGGAACT
GCTTTTGCCACGTATTCGCCAGTGCATCGGTCAACGGTACCAGTGGTGAGAAAAAGAGGT
TAAAGCCAATCATCACCAGCATCAGCCACGCTACGTGCGCCCCCGCCCAGAAGGCGACAG
CAAAGAGAAGTGTCAGCAGTGCCAGCACGCGCAAGGCGGAAATCAGGCGGGAAGGATCGC
TGACGCGGGGCGCGATGAGCAAACTCCCGAGGAAACGGGCAACCAGACCTGCCCCCAATA
ACAGGCCGATGGTTTCTGGCGTTAAACCAATCCCTTTAAGCCAGACGCTCCAGAAAGGTA
GAAAAATGCCGTAACTAAAAAAGTATGTGAAATAGCCGAGCGCCAACCAGCGCGTGGATT
GCAAAACCATGAGTCCCTCCCGTCAGGAGGCGTTAGTCTGGGGTTAATCGAATGTTGGTG
CAAGTTGAAAAATAAGAATATTCGAGCCTGCTTCCCGATGTCTGTAACGCCAGTTCACAA
GCACTAAAAAACTGAGATCCGCGACGCATGTTGCAAAAATAATGCGTAATTATGCCGTTA
CGCTTGCCAAACGTTCCTGCACAATGGCGATGAAATCGCGTAATGCCGGCTTCATCTCCC
CTTTCTTCCACGCCATCAGTAAAGCAATGGAAGGCACATTTCCGGCAATGGGACGAAAAA
CAACCTGTCCGGTATTAAAATTATTCATATAACCGGGTATCAAAGTGACGCCCAGCCCCA
TGCCCACCAGATTCATGGTCACCAGAATATTCGTTGCCACCTGGACGATATTTGGCTGGC
TGTTTTCTTGCGCAAACCACGCTTTAACGATCGGCGCAAGCGAACCGGAATACACCGGAT
CGGTACTGACGAAATTCACGCCATCCAGTTGCGCGGCGGTGATCTCTTTTTCATGTGCTA
AAGGGTGATCAACCGGTAACACAACCACTAATGGTTCGTCAAAAAGCTCCAGATAATCAA
TCTCCGGGCTATAAACAGGATGGCGCATTAAGCCGACGTCGAGTTCACCACGGCGAATTT
TTTCCTCCTGTTGCGTGGTGATTAAACTCACCAGCTCAATCAAGGTGTCTGGCTGTCTGA
GACGAAACATCGGTAATACTTTTGGCAGTAAATTCACTTCCGCCGATGGCACAAAGCCAA
TGGTTAATTGTCTGTCTTCCTGAACAATTTTCCGCGCCCGTAATTTGGCATTTTCCGCTT
GTTCGAGGATTGCCAGCGCGTCCTGGAGAAAACATTCTCCCGCCGCCGTCAACGCGACTT
TGCGCTTATCCCTCACCAGTAACGGAACACCGACACAGTTTTCAAGATCGCGGATCTGGC
TGCTTAACGAAGGCTGTGAGGTATGCAGTTTTTCCGCCGCACGGGTAAAGTTCAGTGCCT
GCGCCACTGCGACGAAATAGCGTAAATGCCGTAGTTCCATCACCTTCCCCTTGTTATCGA
AAAAACGTCTCAGCTGGTAGAAATTAACTATTTCACATATTAGCAACCAACCAGCAACAT
CCTTATGGCACAAAAATAGAAGGTCAATACATCTTATCTTTCAGGATTAAAAAATATGAC
CACACCCTCAGATTTGAACATTTACCAACTGATTGACACCCAAAATGGTCGGGTCACTCC
GCGTATTTATACCGACCCGGATATTTACCAACTGGAGCTTGAGCGTATTTTCGGTCGTTG
CTGGCTATTTCTCGCCCACGAAAGCCAGATCCCAAAACCCGGTGATTTCTTTAACACCTA
CATGGGAGAAGATGCGGTTGTCGTAGTGCGTCAGAAAGACGGCAGCATCAAGGCGTTTCT
CAACCAATGCCGCCACCGGGCCATGCGTGTGAGTTATGCAGATTGCGGCAACACTCGCGC
CTTTACCTGCCCGTATCACGGCTGGTCTTATGGCATTAACGGCGAGTTGATCGATGTACC
GCTGGAACCTCGCGCCTACCCACAAGGGTTGTGTAAATCCCACTGGGGACTAAACGAAGT
TCCTTGTGTGGAGAGTTATAAAGGGCTAATTTTTGGCAACTGGGATACCAGCGCACCGGG
CCTGCGTGATTACCTGGGTGACATTGCCTGGTATCTGGATGGCATGCTGGATCGTCGCGA
AGGCGGCACCGAAATTGTCGGCGGCGTACAAAAGTGGGTGATCAACTGTAACTGGAAATT
CCCGGCAGAGCAGTTCGCCAGTGACCAGTATCATGCTCTGTTCAGCCATGCTTCTGCCGT
TCAGGTATTAGGGGCGAAAGATGATGGCAGCGATAAGCGCCTCGGTGATGGACAAACCGC
CCGCCCGGTGTGGGAAACCGCCAAAGATGCGCTGCAATTTGGTCAGGACGGTCACGGTAG
CGGTTTCTTCTTTACTGAAAAACCGGATGCTAATGTCTGGGTCGATGGCGCAGTTTCAAG
CTATTACCGCGAAACCTATGCCGAAGCAGAACAACGTTTAGGTGAAGTTCGCGCCCTGCG
CCTGGCGGGTCATAACAATATTTTCCCCACGCTTTCATGGCTAAACGGCACTGCCACACT
CCGCGTCTGGCATCCGCGCGGCCCTGATCAAGTTGAAGTGTGGGCGTTCTGTATTACTGA
CAAAGCCGCCTCCGATGAAGTTAAAGCCGCTTTTGAAAACAGCGCCACTCGTGCTTTTGG
TCCTGCTGGTTTTCTCGAGCAGGATGACTCGGAGAACTGGTGTGAAATCCAGAAATTGCT
TAAAGGCCACCGCGCCCGCAACAGCAAACTGTGTCTGGAAATGGGGCTTGGTCAGGAAAA
GCGCCGCGACGACGGCATTCCTGGCATTACTAACTATATCTTTTCAGAAACTGCCGCTCG
TGGAATGTACCAACGCTGGGCCGATCTTCTGAGTAGCGAAAGCTGGCAGGAAGTGCTCGA
TAAAACCGCCGCTTACCAGCAGGAGGTGATGAAATGAGTGCGCAAGTTTCACTAGAGTTA
CATCACCGCATTAGCCAGTTTCTCTTTCACGAAGCCAGCTTACTGGACGACTGGAAATTT
CGTGACTGGCTGGCGCAGCTCGACGAAGAGATTCGTTACACCATGCGCACCACAGTTAAC
GCGCAAACACGCGACCGCCGCAAAGGCGTCCAGCCACCGACAACCTGGATTTTTAATGAC
ACCAAAGACCAGCTGGAGCGGCGAATCGCCCGTCTGGAAACGGGCATGGCCTGGGCAGAA
GAGCCGCCGTCACGCACCCGTCACTTAATCAGCAACTGCCAGATAAGCGAAACCGACATC
CCAAACGTATTTGCTGTGCGGGTAAATTATCTGCTTTATCGGGCACAAAAAGAGCGCGAT
GAAACATTCTATGTTGGAACGCGTTTCGACAAAGTTCGCCGTCTGGAAGATGACAACTGG
CGCTTGCTGGAACGGGATATCGTCCTGGATCAAGCGGTAATCACTTCCCATAACCTGAGT
GTACTGTTCTGATGAATCGAATTTATGCGTGTCCCGTTGCGGATGTGCCGGAGGGTGAGG
CTCTCCGGATCGATACCTCGCCCGTCATCGCCCTGTTCAACGTTGGCGGCGAGTTTTATG
CCATTAACGATCGTTGCAGCCATGGTAATGCGTCAATGTCAGAAGGGTATCTGGAAGATG
ACGCCACGGTGGAGTGCCCGCTACACGCCGCCAGTTTTTGCCTGAAAACGGGGAAAGCGT
TATGCCTGCCCGCCACCGATCCGCTCACCACTTATCCAGTACACGTTGAAGGTGGTGACA
TTTTCATCGACTTACCGGAGGCGCAGCCATGAGCGATCTGCATAACGAGTCCATTTTTAT
TACCGGCGGCGGATCGGGATTAGGGCTGGCGCTGGTCGAGCGATTTATCGAAGAAGGCGC
GCAGGTTGCCACGCTGGAACTGTCGGCGGCAAAAGTCGCCAGTCTGCGTCAGCGATTTGG
CGAACATATTCTGGCGGTGGAAGGTAACGTGACCTGTTATGCCGATTATCAACGCGCGGT
CGATCAGATCCTGACTCGTTCCGGCAAGCTGGATTGTTTTATCGGCAATGCAGGCATCTG
GGATCACAATGCCTCACTGGTTAATACTCCCGCAGAGACGCTCGAAACCGGCTTCCACGA
GCTGTTTAACGTCAATGTTCTCGGTTACCTGCTGGGCGCAAAAGCCTGCGCTCCGGCGTT
AATCGCCAGTGAAGGCAGCATGATTTTCACACTGTCAAATGCCGCCTGGTATCCTGGCGG
CGGTGGCCCGCTGTACACCGCCAGTAAACATGCCGCAACCGGACTTATTCGCCAACTGGC
TTATGAACTGGCACCGAAAGTGCGGGTGAATGGCGTCGGCCCGTGTGGTATGGCCAGCGA
CCTGCGCGGCCCACAGGCGCTCGGGCAAAGTGAAACCTCGATAATGCAGTCTCTGACGCC
GGAGAAAATTGCCGCCATTTTACCGCTGCAATTTTTCCCGCAACCGGCGGATTTTACGGG
GCCGTATGTGATGTTGACATCGCGGCGCAATAATCGCGCATTAAGCGGTGTGATGATCAA
CGCTGATGCGGGTTTAGCGATTCGCGGCATTCGCCACGTAGCGGCTGGGCTGGATCTTTA
AGGAAGCACGATGAAAGAAAAAACGATCATTATTGTCGGTGGCGGGCAAGCGGCGGCAAT
GGCTGCGGCCTCGCTACGCCAGCAAGGGTTCACCGGTGAGCTGCATCTGTTTTCCGATGA
GCGACATCTTCCTTATGAACGACCTCCACTCTCGAAATCCATGTTGCTGGAAGATTCCCC
GCAGTTACAGCAGGTGTTACCCGCTAACTGGTGGCAGGAAAACAATGTTCATCTGCATTC
CGGTGTAACCATCAAAACGCTGGGTCGCGACACACGAGAGTTAGTGTTAACCAACGGCGA
AAGCTGGCACTGGGATCAGCTTTTTATAGCAACCGGCGCGGCAGCTCGACCGCTGCCGTT
GCTTGATGCACTGGGAGAACGCTGCTTTACCCTACGCCATGCCGGTGATGCCGCCAGACT
GCGAGAAGTTCTGCAGCCCGAACGGTCAGTCGTGATTATCGGTGCCGGAACTATTGGTCT
GGAACTGGCTGCCAGCGCCACGCAGCGCAGATGTAAGGTGACAGTGATTGAACTGGCGGC
AACCGTCATGGGCCGTAATGCACCACCGCCCGTGCAACGCTATCTTTTACAGCGCCACCA
GCAGGCTGGTGTGCGCATTCTGCTCAATAATGCCATTGAACATGTGGTCGATGGTGAAAA
AGTAGAACTGACGCTGCAAAGTGGGGAAACGCTTCAGGCTGATGTGGTGATTTACGGTAT
TGGTATCAGCGCCAACGAGCAACTGGCTCGCGAGGCCAACCTTGATACTGCCAATGGCAT
TGTCATTGATGAGGCTTGCCGCACCTGCGATCCCGCGATCTTTGCCGGTGGCGATGTGGC
AATCACTCGTCTTGATAATGGTGCACTACACCGCTGCGAAAGCTGGGAAAACGCCAATAA
CCAGGCGCAAATTGCCGCTGCCGCAATGTTAGGGCTACCGCTACCGCTACTGCCGCCGCC
GTGGTTCTGGAGCGATCAGTACAGTGATAACTTACAGTTTATTGGCGATATGCGTGGCGA
TGACTGGCTTTGTCGTGGCAACCCGGAAACTCAGAAGGCGATTTGGTTTAATCTGCAAAA
CGGCGTGCTTATCGGTGCGGTCACGCTGAATCAGGGGCGTGAGATTCGCCCAATTCGCAA
ATGGATCCAGAGCGGCAAAACGTTTGATGCGAAACTGCTGATAGATGAGAACATCGCGCT
TAAATCACTGTAACCAGGATAATTAGCGAATATCTCAATGCCTGGGGCGTGGCGAGGTGC
AAGAGTGTGTATTACGTTTAAATCACATTATCTTGCAAAGGGATTGGTTATGAACACACT
ACGTTATTTTGATTTTGGAGCTGCCCGCCCCGTTTTGTTATTAATTGCCCGTATCGCCGT
GGTCTTAATTTTCATTATTTTTGGTTTTCCCAAAATGATGGGCTTTGACGGTACGGTCCA
ATATATGGCCTCGTTGGGCGCGCCAATGCCGATGCTGGCAGCGATTATTGCGGTAGTTAT
GGAAGTGCCCGCCGCGATATTAATCGTGCTTGGCTTTTTCACCCGTCCGCTGGCGGTGCT
GTTTATTTTCTACACGCTGGGTACGGCGGTGATTGGTCACCATTACTGGGATATGACCGG
CGATGCGGTTGGGCCAAATATGATTAATTTCTGGAAGAATGTCAGTATCGCTGGCGCGTT
CTTGCTATTGGCAATTACCGGGCCGGGGGCAATTTCTCTCGATCGGCGTTAGGAAAGATG
CCGGATGCGGCGTGAACGCCTTATCCGGCATTTAATAAATTACAGCCACTCTACCCGCAA
CGACATCTCTGAAGTTGTTGATTCCCCTGGTGCTAGCGCAATGAGATCACCCCCTTCCGG
GCGATGATGATCATCCGGCGCATGGCTCATCGGTTCCAGACAGAAGAAATCAAACGCATA
TCCTTTATCAAACGCAGGGTCGGAAACAAAGATGAAATAACACGGTGCAGGTGGCGTCGT
TTCCATGATGATGGCATAACCTTCCTGCGGCTGCTCGATGCGGGCCTGACCATTCCATCC
GGCAAAACCATTGTTCACCCACTGGCGCGGCAACGGCGCGGGCTGGTTAAAATCCAGTTC
CTGCGGTAGCTGCTCGCAAAACTCACCCGCCAGCCACTGCTCCCGCTCCAGCCAGTAACC
GCTCGCCTGTGCCTGAATCCGCGTTTGCGGCGACAACGGAAAATAAGGATGCCAGCCGGT
ACCAAATGGCAGCGTCTCTGCCCCTTGATTGGTGACAGAGAGCGTCACCGTCAGCGTATC
CGCCGTTAAATGAAACGCCTGACTTACCCGATAGTGATAGACACCGCTGCGATGTTCATA
CACCAGACACAAACTATCATCGCTGTGCGAGACACATTGCCACTCGCCCAGCCAGCCATC
GCCGTGTAGATAGTGCGCATCCCACTCAACATTCGGTTGCAGTTGATACTCACGCCCCTG
CCAGACAAAACGATTGCCGCTCACCCGGTTTGCAAATGGCACCAGCGGAAAACATGAGGC
ATCGGTTGCCACACCGCTTTTTTTACCAGGACGTAAGAGCGGCGTCGTATCGCGCCAGAA
GCCTTCGATTACGCCGCCCTGGTCAGAAACGTCCAGCTTTAGCGACCCGTGGGATAAGGT
ATAGATGGTCATCCGCTAACTCCTTAATCCGGGAAGTTAATCACAACTTTCCCGCATTTG
CCGCTCGCCATCAGCGCATAGGCATCACCTGCCTGTTCCAGCGAGAAGCGATGGGTAATG
GCGTTACGCGGCCACAGCTTCCAGTCCGTCAGATCATGGGCGCATTTTTCCATATGGAAC
AGACTGGTCACCCAGGAGCCGATAATCCGCCGTTGATGGTGCATCAGATCGGCGCTGACC
TCGAATTCCACTTTTCCGGTTTCACCAATGTAAACCACCCGTCCCCAGTCAGCGGTGGAT
TGCAGTGCCAGCAAGCGACCTGCGGCATTACCGGAACAATCGAGCGCAACATCCGCGCCA
CCGTGGGTGAGTTCGGCGATAATCTGCGGCAGACCTTCGGTGGTTGCTAAATAGCCGTGA
TCCATCACCCCTAACTGTTTTGCCATCGCCAGACGTTCCGGCAGCATATCAACGCCGATG
ATCCGTTTTGCACCGCGACCTTTCGCCAGCATCATCGCCATCATGCCGACTGGCCCCAGA
CCGACCACCAGCACGTTATCACTGCCGGAAACTTCGCCGCGCAAAATTCCTTCATACGCT
GTACCAACGCCGCAACTGATAAACGCACCATCTTCGTAGCTCAGCGCATCCGGCAGGAGG
ATCAGATCTTTTTCTTCCGCCAGCAAGTATTCGGCATGACCGCCGTCACGCTGCCAGCCG
TAAGCCGCTTTTCCTTCGCCAGTACAAGAAATAGGAAAACCGCGACGGCAGTTCGGGCAA
AAACCACAGCCAGAAATGTGATACACCAGCACGCGGTCGCCCTCTTTAAAATGGCGGCAG
CCTTGCCCCATCGCCACAATCTGCCCGCACGGTTCATGACCGTTGATAAAGCCCTGGTAT
AACGGTTTATCGGGTGCCGCCGCTGTGGCACGGTGTTGATGATAGATATAGTGGACATCG
CTTCCGCAAATCCCGGAGGATTTCATTTTGATCAGTACCTGGTTAATCCCCGGCGTCGGC
ACCGCAACTTCCCGCAGATCGACGGTCGAATTTCCTGGTAAATAAGCTGCCAGCATCGTT
TTCATAAATCCCTCATTAACAATACGATTAATTTTCATCCCTGCCGCACCCGCGCCAGGG
GCGTTAAGGTTTAGCGTTTCGCTTTACTGCTTCGCTGGGTCAGCAAGATATTCGCCAGCA
CCGCCACCACGATGATGACGCCGCGTACCACCTGCTGGAAAAAGGAGTTAATACCGAGCA
GCACCAGACCGTTACCGATTAGCGTAATCACCAGCACACCAAGCAATGTACCGAACAGGG
AACCGCGACCGCCGGAAAGTGCCGTACCGCCGACCACGACCGCGGCGATGACGTCAAACT
CCAGACCGTTTGCGGCACCTGCGTTACCAGAACCGAGGCGCGCCGCCAACAAAATGCCGG
TCACCGCCGCTAATAATCCCGAAAGGGTAAAGATAAGAATGCGCACCCGACGAACGTTGA
TGCCGCACAACTGCGCCGCCGTAGCATTACCGCCAACGGCAAAAACCGAGCGCCCGAAGG
CGGTTTTGCGGCTGATGAACACAAACAGCGCAAACAACACAATCATGATCAGCGCGGATA
CCGGCACACCGAGAAATTGTCCGCCCAGCCAGTCCAGCACCTCGTTTTCATCAATCGGCA
CTGGCAGTGCGTTCGTCATAAACAGCCCCATTCCGCGCAGGGCGCTCCACAGCCCCAGTG
TGGCAACGAAACTTGGTACATTAAACACGCCGCGCAGCACCCCGGCCAGCGTTCCCATCA
GCGCGCCTAACAGCAACACCAGCAGGCACGCCACCGCCAGCGGAACTTCAAATTGCAGCA
AAAATGCCAGGCACACCGAGACAAAAGCCACCATCGGCCCAACGCTGACATCAATTTCAC
CGGAGATAATAATCAGCGTCATCGCCCAGGCGGCAATCCCAATGGTGGCGGCATCGCGCA
GCACGTTCATCTGGTTATTCAATGAGATAAAGCCAGGCGCGTTCAGGGAGAAGACCAGAT
AAAGAATGGCAATCACCACCAGCAAACCGATCTCATTAATATGGCGACTGACAAATTGTT
TGAGCGAGACGCTCTTGCCCTGCGGCAATGGTAATGACGAAGCAGACATCTTCAGGTTCC
TCGGTAAAATTCATCAGTGCACAGACAGAATGGCGGACATCAGCTCATCCACATTGACCG
GAGCGTGAAACTCCTGCGAGAACGTGCCGTGCTGTAATAACAGGATGCGGTCACACACCA
GCGGCAACTCCTCCACTTCACTGGAGATAAACACCACGCTTTTTCCTTCGGCAGCCAGCT
CACGGACAATACGGTAAATCTGCTGTTTGGCTTCGATATCGACGCCGCGCGTTGGCTCGT
CGAGCAACAAAATCTGGCTGGCAGCATAGACCCAACGACCGATCACCACTTTTTGCTGAT
TGCCACCAGAAAGCGTGCCGATGGGTGTTTCGCTACTGGCGGCCTTGACCGTCATCCGCT
GCATCACCTCTTCGGTCAGGCGGCGGATGGTGGACCATTGCAGCACACCGTTGGCGCTGA
TTTTTTGCCGATTGGTCAGCACTGTATTTTCGTCAACGCCCAACCAGGGAATGATCCCCG
CTTCTTTGCGGTTTTCTGGCGTATAGCCAATGCCGCGTTTCAGCATGTCGCCGTAATCGG
GGCGCGTGATTTTCTCGCCGTTGATAACAATTTCGCCCTGTTCATACTCCTCCAGCCCAA
CAATCGCCTTCAGCAATTCACTGCGCCCTGCCCCCAGCAGACCAGCAATGCCGAGCACTT
CGCCACGACGTAGCGTAAAACTGATATCCTCCAGCTTGGGCTTATGGCGTAACGCACGGA
CTTCCAGCACGGCCTGATCCACAATTTCCTGAGGGGCTACCGGCGCAATATCAACGTGAT
CGCGCCCGAGCATCAGCGACACAATATGATGCGTGGAGGTGTTTTCGAGCATCACATCGC
CCGCCACCTGACCATCGCGCATAACGGTGGCACAGGAGGCAATGCGGCGAATTTCTTCCA
TCCGGTGGCTGACATAAATCACCGCCACGCCCAGTGCCGACATCTTTTTCACCGCGCTGA
TCACCAGTTCAACTTCCGCACTCGCAAGCGAACTGGTAGGTTCATCAAGAATGACCACGC
GCGGCTCGCCCTTCATCACCCGCGCAATTTCCACCAGCTGCTTTTGCGCCGGGCTTAGCG
TTGAAACAAGTTGTTCAGGACTAACGTCAACGCCCAGCGCCTGTAAGCAACGTTGGGCAT
CCTGCGCCATTTGCAGGTAATCAATCATGCCGTTGCGGCGGGGCCACTGACCGAGGCAGA
GGTTTTCCGCCACTGTCAGCCCTTCCACCAGACTTAACTCCTGATAAACCGCGCGCACCC
CCAGTTCAGCGGCACGGCGAGTCAGCGTAGCTTCGTCACCTTCCAGTCGCGTCTCGCCAA
TCCAGATATCACCGCTATCCGGGCGTTCGCTGCCGGTAAGCATTCGAATGAGAGTCGATT
TGCCCGCGCCGTTTTTACCTAACAGCGCACGAACTTCGCCTTTATTGAGCGTGAAGTTAA
CGTTATCCAGCGCAACGACGCCGGGATAACGCTTATTTCCTGCCACCACTTTTGCTACCG
GGACTGCCTCTGTTGCCGTGAACATAGGGACCTCTGCGAATCAGCGATTAGGGCAGACCA
TCAACGTGCGTTGCCAGCCACTGTTTACCGTCTTCCGTTTTGGTATAGAGATCGATAGGC
ACCTGAATCACTTTTTCACCGTCGGCTTGTTTATTGATAACCTTCAATGTTTGCGCGAAA
ACAGCATTGCCCATTTTCTTACCGGAAATATCCACTACCGCTTTCAGCACCTGATTGTTT
TCCAGCTCCTGAGCAATTTCGGTTGTCATATCCGAACCGAAAACAGCAATTTTTCCGGCC
TGATTTTGATTACGTACCGCTTTTACCGCGCCGAGTGTCGCACCGCCCGATTCCCCCATA
ATGGCGTTGAGATCCGGCGTGGAGATAATTAGTTTTTCACCAACGGAAATCGCTTTATCT
AAAACAGTCCCTTCCTGATTAGCGACAATTTGCGCGCCGGGAACGCGGGATTTTAAAACT
TCTTCAAATCCTTTACGTCGCTGCACACAAACTTCAAAGGCTTCGCAATTGATGACGGCA
ATTTTCGGCTGGTCAATTTTATTGGCAATAAAATAATCAGCGGCAGCGTTACCCAGTTTT
TTACCAAATTCCAGCGGATCGCCGACCAGATACGCCGAGACATATTTATCGACCCCCTTT
TGATTAATACAGGTGTTGTAGCAAATCACCGGAATGCCCGCTTCACTGGCGCGACGAACG
GTACGGCTACTGCCATTTTCAGACACTGCCGATAAAATAATGGCATCGACATTACGCGCC
ACGAGGGTATCAACAAAGGTACTTTCTTTCGAAATATCACCCTGGGCGTTAGTTTCTATT
AACTGAACTTGTACTGAGGAATCTTTTGCCGCATCCTGAACGCCCTGACGCACTCCAGCG
TAGTATCCCTGAGTATCAAGGTATATTGCGCCAATGGTCATTTCTTTTTCCGCAGCCCTG
GCAAATAGTGCGCTACCTAATAGCGTAGCCATTAATAATAGATTACGGGTTGTTCTCATT
TTTGTAGGCATAGAGCCTCCTGTAGGGTTTTTATTAACAACGGCTTATTCTAATTATTTT
GTGATGAGCGGCAGCGCGTGCCGCTCAAATATTACAGTTAATAGGGTTTAGTGAACGCGG
TTAAAAATAAAAGGCATCACGGTGGTGAATAATGCCGCTTTCGGCCAAGCCGGATTAATC
GCCGTCAATTCAGCGCGAGCAGACTCATATTGCGCAACCTCCCCGAGTCCCGCGGACGCC
AGCATCGCCACCATCAGGCATTTTTCTTTATGCTGCTGTTGTAAATCGCCATACAGCGAC
AACAAGTCAGGTTGCGAGACGGCAAAGAAATCCGCTTCGATACTGGTTTTCGCCATCTCT
TGCGCCCACTGTTTCATTTCACTAAACAGTTGCTGTGCGGTTTGTTGTTCGCCCAGCAGT
CGCAGCGCCATCCCTTGCCAGAAGAGATAATCAACCGGCTGATCGTTGTAATAACTGTGA
ATGTTAATAGTGCGATCGCCGGTCGCCGCCAGACGTAAACAACGCGTCGCTTCAGTTTCA
TCGCCCTGCGCGTTGGCGCATATCGCCTGCCAGAACCAGATGTCGTTATCAGTTTGCCCC
GGTAAACGGCCTTCGCTTAAATTCTCCGGATAATGCAGCGCGGCATGAAGCAGTTCGCAG
GCCTGCTGCGGCTGTCTGGCATCAAGATGCTGCCAGGCGCGTAATAACTGGTTGAGGATA
AACTGACTGGTGACCTTCCCTTCCCCGCCTTCCCACGGGTGGAATTTGCGCGTGGCGAGA
ATGTCCGCCGCTTTGTCTGCCTGACCCGTGAGATGCCACAAATTGAGCAGTTCTGCGGTC
ATGTCGTCGCGTTTCAGCGCAATTTCCAGATTATTTTCCAGACGCGCCAGTCGTTTCTCC
GGTGTGGCTCCACTTAACTTATCCAGCAAATCCCGTTCGAAAAGCAGACGTGCATCCTGC
GGCGCAAGCTGATAAGCATTATCAAGATAACGCGCGGCCAGCTCATAATCGTGTTGCTTA
TTCCACGCATGGATCGCTAACCCGCGCCAGCCGTCGGCAAACTCCGGCGACATCTCTACG
CAACGTTGCCAAAAGGCAATGGCTTTGTTGTAGCTACGTTTGTTGTAGTAGAAGCAAGCT
AGTAAATGGCGAGCAAACCAGCACTCTTCAATACTCTCCAGCGCCGCCACTTCTTCCAGC
GTATTCGGGAAACGGACAAACTGCGGGAAGACATCAATGGCTTTTGCGACCAGTTCGCCA
CGTTCGGCTTTCGGCAGCAAGCTGGCTTGCAGGTAAAGCGGCAGCGTGCGCTGGCAGTCC
AGTGCGTTCAGCATCTCTGCCGCCAGGGTGGGCATTCCCCAGTTAATCAGTTGCCCGGCG
GTCATCAGGGCGTTAACGTCGCGTCCCTGACACAGACCGCGCCACTGCGCGAGAGCTGAT
TCGCTACGACCATCGAACCAGTTCAGCCACCACAGAGTGGCGTTCAGCGGATAATCGCGC
AGCAGTTTCTCGCGCTGCACACGCGCGTTGTCCTGACGACCACTTAACACCAGCAGCAGA
TTATGCAGGCAAAGCACTTCCTGATTGGTTGGGCAGGCGCGAAGACTTTGTTGGCAAAAA
TCCAGACCAGCGTCGAAGTTACCATTACGCGCCGCCAGTCGTGCCAGGCCATAATAGCCA
CCGGCTTTGCTGTTGCCGCTCCAGACCGCACGCCAGAAATCCTCTTCGGCTTGTTGATAT
TGTCCCTGACGTTCGTAAGCACTGGCGCGAATCAAACTCGCCTGTCCGCACTGCGGATTT
TTGTTCAGCGCATGTGCGCGTTTCAGAGCCTGAGTGGCATACGCCACCGCTTGCGGGAAA
TCTGCGCGGTTATATTCCAGCATCGCCAGCGCCAGGTTACAGCGATAATCCAGCGGGTCC
AGCGCCACGCCGCGCAGGTAGTAATCGAACGGTGAACGGCTGGCGTGATGATATTGCTCC
AGATGCTGACCGATAAACCAGGCTTCATCTGTACTGGTAATGTCTTGTGCTGCCAGTGGC
GCTTTGGCGACGTCCGGTAACGGCAACGCTTGCGGCTGATGTTCCTGATAACTCAGTACA
ATATTGCCGTCGGCATCGGAGAGCTCAATGGTCAGCCTTTCAGGATTGATACCGTGCAAC
ACGCCCTGGATGGCGGTCGCAGGCATCAGTGCCACGGCATCATCAAGTAACGCGTTGCAT
TTACCGATTTCGCGGATCGCCAGGCGGTATCCGTTCAACGGAGAGATGGCATACAGCCCC
CACTCAATCCCCCGCTTACTACGCTGGAGTTTTATCACCGCATCGCGGGAGGCATTTTGC
ACCATGCCCAAAGAATGATAAGGCAGGAAATACTGCTCAAAACGCTTCTCTTCGTAAGCA
TCAAGCCAGGTAAAATCGGGCTGGTTATCGGCAAAAATACCGGTCATCAGTTCGATATAC
GGGCCGTTATTGTCGGTCAGACTCTTATCCCACGCCTGGCCAAATTCACTGTGTCCCCAA
CTCCACTGTTTTTTACCTGGCGCAATATGGTGGTTGGCAACGTGCAGCAAACCGCCATCT
TCATCGTGACACCACGCGCCGACAAAATCGTACTGCGATTTTTCGGCCATATATGAGGTT
GGAACAGGCACATTTTTATAGCGAGAAATGTCCACTCCAGCGGAGTAGTCCACTTTGTAG
TAAGTGCCGGTAGCGATGGGGAAAGCGGAGACGGCCCGTTTGCCGTGATCAAACACCGCC
GTTACATCCGGCGGGAAGACGCTCTGATGCCCTTCCCCCCCTTTCACTGCCGGGTTGGCC
CACCACAAGAAATGACGCGGCGTGGCGTTCCCGTTATAGACGCGGCTGGCGATTTCCAGC
GCCGCCCGGTCAGGGCGCAGGGTGAAACCTGTCATCACCTGTAAACCATGCATCGGCTCC
GTTTCGCCTACCCACACCGTCTGTGCACCGTCTTCATGGGCTTCGAGGGTGAAATCAACG
GGCATAAAGGTGGTCGGGCGATGATGTTGCGGCCAGTTAAACTCAATCCCACCGGAAATC
CACGGCCCCAGCAGCCCCACCAGCGCAGGTTTAATGACTTCATTGTGATAAACAAAATCG
CGCTGTTTCACTTTATCCCACGCGCGATGCACCCGACCGCCCAGTTCCGGCAGGATCATC
ACTTTGATGTAGTCGTTTTCCAGCCACACCGCCTGCCAGGATTTCAGGGTTTTCTGCTCG
CTCAGCGTATCGGTCACGCCGTAGGGATAAACCGCGCCGGACGATCCCTGATAAACGCGA
TTTTCCAGGAACATGGGATGTATATCCTGCGGCCCGGTTTCATAGGTCGGGATCTCAACG
CGCTCTTGCCACACTTTTACTGGAGTCATGGTGCCCTCAATATTAACAAGACATACTGAA
TTAAAAGATTTGTGGCAGTGTATTGAACAATCTGGCAATGTTTTCGCGGAATAATCACGC
AATTAACTAAACAAGGTTTAGTGAAGATGAGAGCCTGCATTAATAATCAACAGATTCGCC
ACCATAACAAATGCGTGATTCTGGAACTGCTGTACCGGCAAAAGCGCGCCAATAAATCAA
CGCTGGCCCGGCTGGCGCAAATTTCGATTCCGGCAGTCAGTAATATTTTGCAGGAACTGG
AAAGCGAAAAACGGGTGGTGAATATTGACGATGAAAGCCAGACGCGCGGGCATAGTAGCG
GTACATGGCTGATTGCGCCGGAAGGTGACTGGACGCTGTGCCTGAACGTGACGCCCACCA
GTATTGAGTGTCAGGTTGCTAATGCTTGTTTAAGTCCGAAAGGTGAATTTGAGTATTTAC
AGATTGATGCACCGACGCCGCAGGCGCTGCTGTCCGAAATCGAAAAATGCTGGCATCGCC
ACCGTAAATTGTGGCCGGACCATACCATCAACCTGGCGTTGGCAATCCACGGTCAGGTTG
ATCCTGTGACCGGCGTGTCGCAAACCATGCCGCAAGCGCCGTGGACAACGCCGGTGGAGG
TGAAATATCTGCTGGAAGAGAAGCTCGGCATTCGGGTGATGGTCGATAATGACTGCGTGA
TGCTGGCGCTGGCGGAGAAATGGCAAAATAATTCGCAGGAACGGGATTTCTGCGTGATCA
ACGTTGATTACGGCATTGGCTCGTCGTTCGTGATTAACGAGCAAATTTATCGCGGCAGTT
TGTATGGTAGCGGACAGATTGGTCACACCATCGTTAATCCGGATGGCGTCGTCTGCGACT
GTGGACGTTATGGCTGCCTGGAAACTGTCGCCTCGTTAAGCGCATTAAAAAAACAGGCGC
GGGTATGGCTAAAATCACAACCGGTTAGTACTCAACTTGATCCTGAAAAACTGACTACAG
CGCAGTTAATCGCTGCCTGGCAAAGTGGAGAACCGTGGATCACCAGCTGGGTTGATCGCT
CTGCCAATGCCATTGGTTTGAGTCTGTATAACTTCCTCAACATCCTCAATATTAATCAGA
TTTGGTTGTACGGTCGCAGTTGTGCCTTTGGTGAGAACTGGCTTAATACTATTATTCGCC
AGACAGGATTTAACCCGTTCGACCGCGACGAAGGACCGAGCGTGAAAGCGACGCAAATTG
GCTTTGGGCAATTAAGCCGCGCACAACAGGTGCTGGGAATTGGCTATTTGTATGTTGAGG
CGCAGTTACGACAGATTTGATGGCGCGATAACGTAGAAAGGCTTCCCGAAGGAAGCCTTG
ATGATCATAAACGAAAAATTGCCTGATGCGCTACGCTTATCAGGCCTACACGGAGATTGC
AATATATTGAATTTGCAAAGTTTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCAT
GAACAACGAGCACATTGACAGCAAATCACCGTTTCGCTTATGCGTAAACCGGGTAACGTG
CGCAGATGTCGAGAACTTTACCTTTGATGCGCTCGATAACGGCTTCATCATTGATGCTGT
CCAGCACGTCACACATCCAGCCAGCCAGTTCTTTCGCTTCGGCTTCTTTAAAGCCGCGAC
GGGTAATCGCCGGAGTACCTACACGAATACCGGAGGTCACAAACGGGCTCTTCGGATCGT
TCGGTACGCTGTTTTTGTTGACGGTGATGTTAGCACGGCCCAGAGCGGCGTCTGCTTCTT
TACCGGTCAGGTTTTTATCAACCAGATCAACCAGGAACAGGTGGTTATCAGTGCCGCCGG
AAACCACTTTGTAGCCGCGCTCGAGGAACACTTCTACCATCGCTTTAGCGTTTTTAGCGA
CCTGCTGCTGGTAAGTTTTGAACTCAGGCTCCATCGCTTCTTTCAGAGCAACCGCTTTAC
CGGCGATTACGTGCATCAACGGACCGCCCTGACCACCAGGGAAAACGGCAGAGTTCAGTT
TTTTGTACAGCTCTTCGCTACCACCTTTCGCCAGGATCAGGCCGCCGCGCGGACCCGCCA
GGGTTTTGTGAGTGGTGGTAGTAACAACGTGAGCATGAGGAACCGGGTTCGGGTAGACGC
CAGCAGCAACCAGGCCCGCAACGTGCGCCATATCAACGAACAGGTAAGCACCGATGCTGT
CAGCGATTTCACGCATTTTCGCCCAGTCCACCACGCCGGAATATGCAGAGAAACCACCGA
TAATCATTTTCGGCTTGTGTTCTTTGGCTTGTTTTTCCAGATCGGCGTAGTCGATATGAC
CGGTAGCATCGATACCGTAAGGAACGATGTTGTACAGTTTACCGGAGAAGTTAACCGGAG
AACCGTGAGTCAGGTGACCGCCATGCGCCAGGTTCATACCCAGAACGGTATCACCTGGTT
CCAGCAGCGCGGTGTAGACCGCAAAGTTAGCCTGGGAGCCGGAGTGCGGCTGGACGTTAG
CGTAGTCAGCGCCGAACAGTTCTTTCGCACGATCGATCGCCAGTTGTTCAACGATATCAA
CATACTCGCAACCGCCGTAGTAGCGTTTGCCCGGATAACCTTCAGCATATTTGTTGGTCA
GCTGAGAACCCTGCGCCTGCATTACGCGCGGGCTGGTGTAGTTTTCGGAGGCGATCAGTT
CGATGTGCTCTTCCTGACGTACTTTTTCCTGCTCCATAGCCTGCCACAGTTCGGCATCAT
AATCGGCAATGTTCATTTCACGCTTTAACATCCGCATCTCCTGACTCAGCTAACAATAAA
ATTTTTGGCCTTTATAGGCGGTCCTGTTGGACAACGGCGAACAGTATAACCGAATCATTG
TGCGATAACAGGTCTTGACAAAGGAATTTACGCAAACGATTACCTTCAGGCTACGCAAGG
CTTTGGAGAATAAAGAGCTTGCAACCGGAAACGGATTTCTTTTCAGGTTTGTGATGCAAA
TTTTTCACTTCATCACATTCTTTCTGAAAAACACCAAAGAACCATTTACATTGCAGGGCT
ATTTTTTATAAGATGCATTTGAGATACATCAATTAAGATGCAAAAAAAGGAAGACCATAT
GCTTGACGCTCAAACCATCGCTACAGTAAAAGCCACCATCCCTTTACTGGTGGAAACGGG
GCCAAAGTTAACCGCCCATTTCTACGACCGTATGTTTACTCATAACCCAGAACTCAAAGA
AATTTTTAACATGAGTAACCAGCGTAATGGCGATCAACGTGAAGCCCTGTTTAACGCTAT
TGCCGCCTACGCCAGTAATATTGAAAACCTGCCTGCGCTGCTGCCAGCGGTAGAAAAAAT
CGCGCAGAAGCACACCAGCTTCCAGATCAAACCGGAACAGTACAACATCGTCGGTGAACA
CCTGTTGGCAACGCTGGACGAAATGTTCAGCCCGGGGCAGGAAGTGCTGGACGCGTGGGG
TAAAGCCTATGGTGTACTGGCTAATGTATTTATCAATCGCGAGGCGGAAATCTATAACGA
AAACGCCAGCAAAGCCGGTGGTTGGGAAGGTACTCGCGATTTCCGCATTGTGGCTAAAAC
ACCGCGCAGCGCGCTTATCACCAGCTTCGAACTGGAGCCGGTCGACGGTGGCGCAGTGGC
AGAATACCGTCCGGGGCAATATCTCGGCGTCTGGCTGAAGCCGGAAGGTTTCCCACATCA
GGAAATTCGTCAGTACTCTTTGACTCGCAAACCGGATGGCAAAGGCTATCGTATTGCGGT
GAAACGCGAAGAGGGTGGGCAGGTATCCAACTGGTTGCACAATCACGCCAATGTTGGCGA
TGTCGTGAAACTGGTCGCTCCGGCAGGTGATTTCTTTATGGCTGTCGCAGATGACACACC
AGTGACGTTAATCTCTGCCGGTGTTGGTCAAACGCCAATGCTGGCAATGCTCGACACGCT
GGCAAAAGCAGGCCACACAGCACAAGTGAACTGGTTCCATGCGGCAGAAAATGGCGATGT
TCACGCCTTTGCCGATGAAGTTAAGGAACTGGGGCAGTCACTGCCGCGCTTTACCGCGCA
CACCTGGTATCGTCAGCCGAGCGAAGCCGATCGCGCTAAAGGTCAGTTTGATAGCGAAGG
TCTGATGGATTTGAGCAAACTGGAAGGTGCGTTCAGCGATCCGACAATGCAGTTCTATCT
CTGCGGCCCGGTTGGCTTCATGCAGTTTACCGCGAAACAGTTAGTGGATCTGGGCGTGAA
GCAGGAAAACATTCATTACGAATGCTTTGGCCCGCATAAGGTGCTGTAATTTGATGTTGC
CGGATGGAAACATCCGGCAACCCTTGACGCGGTTTAAATTGCCGCGTCGTCCTCTTCACC
GGTACGGATGCGAATGACCCGTGCCACGTCAAAGACGAAGATTTTACCGTCACCGATTTT
GCCGGTTTGCGCCGTGCGAATAATGGTATCGACACAGGTATCGACAATGTCGTCCGGTAC
GACAATCTCAATTTTCACTTTCGGCAGAAAATCCACCATATACTCCGCGCCGCGGTACAG
CTCGGTATGGCCTTTCTGGCGACCAAAGCCTTTCACTTCGGTCACCGTCATGCCGGTAAT
ACCGACTTCGGCCAGTGCTTCGCGGACATCGTCCAGCTTGAAGGGTTTTATAATCGCATC
AATCTTTTTCATGCTATTCCTTGAAAAGGTCGCCTGTCTTTTGATCTGCTAAACGTAACA
CATAACGCCAATTCATTCCTTGAAATCGTTTGCATCCAGCTCGTGTCGGGAAAGCAGTTT
ATAAAATTCTGTCCGGTTGCGCCCCGCCATTCTCGCCGCGTGGGTGACGTTGCCTTTGGT
GATTTGCAGCAGCTTACGCAAATAGTTGAGTTCAAACTGATTACGTGCCTCAACAAAGGT
TGGCAGCGCCGTATTTTCACCCTCCAGCGCCTGCTCCACCAGCGCATCACTAATCACCGG
AGATGAGGTCAGCGCCACGCACTGTTCAATCACGTTGACCAACTGGCGCACATTACCCGG
CCAGCTCGCGGTCATCAGGCGTTTCATCGCATCGGTAGAGAACGCGCGGACAAACGGTTT
ATGTCGCTCTGCCGCCTGGCGCAACAGGTGATTTGCCAGTAGCGGAATGTCTTCTGTGCG
CTCCGCCAGTGCCGGAATTTTCAGGCTGACAACGTTGAGGCGGTAATAGAGATCTTCGCG
GAATTCCCCGCGCGCCATCGCTTTTGGCAGATCACGGTGAGTGGCAGAAATAATCCGCAC
ATTGATATCAATATCGCGGTTACTGCCCAGCGGGCGCACTTTACGCTCCTGCAACACGCG
CAGCAGTTTGACCTGTAACGGCGCAGGCATATCGCCAATTTCATCGAGAAATAGCGTTCC
GCCTTCCGCCGCCTGGAATAAACCTTCGCGATTGCTGACAGCGCCAGTAAACGCGCCACG
CGCATGACCAAACAGCTCCGACTCCAGCAATTGCTCGGGCAATGCGCCACAGTTAATAGC
AATAAATGGTTTGCTGTTGCGCGGGCTGGCGTTGTGGATAGCCTGGGCGAAAATCTCTTT
CCCGGTGCCGCTCTGACCGTTAATCAAAACGCTGACGTCTGATTGCGCCACCAGCCGCGC
CTGTTCCAGCAAACGCAGCATCAGCGGGCTGCGGGTGACAATTGCCTCGCGCCAGCGTTC
ATCGGTGGCTGGCGCGGATTGCTCCAGCGCATCGTCAATTGCCTGATATAGCGCGTCTTT
GTCGACAGGCTTGGTGAGGAAACTAAAAACGCCCTGCTGTGTTGCAGCAACGGCATCGGG
AATAGAACCATGCGCGGTAAGAATAATTACCGGCATTCCCGGCTGCACTTTCTGGATTTC
AGCAAACAGCTGCATACCGTCCATTTCATCCATCCGCAGGTCGCTGATGACTAAATCTAC
TTTTTCGCGATTCAGTACCCGTAATCCTTCAGCGCCACTTTCCGCCGTGACCACACTGTA
GCCTTCGCTGGTCAGGCGCAGGCCAAGCAGTTTCAGCAATCCCGGATCGTCATCGACCAA
TAATAAATGCGCAGGTTTATGGCTCATCAGGAGTGACCTCATGGGTGGATGGCGCGGGCT
TTTCACTCTCGTGCGGCGTATCCGGCGAGAAATTTCCAGCCGGTTTGCGGGTCGAGAGCT
GGCGTTCAATATCGGTCAGGTTTTCCAGCTTGCGGGTGGTGAGTTCCAGTTGCTGCTGTA
GAACGTGATGTTGCTGGCGCAATGTATCCAGCTCGCTGTCGCTGGACTGCTGGAGTTTAC
TGTAACGTTGGCGCTCTTCCGCCAGTTGCAGTTGCAGCGCCTGACCATCGCGCCAGAGTT
GATACAGTGGGCGAACCTGTGCCGGGATCTCGGTACTTAACGCTTCAATACGCGCGACCA
GCTGGCGGCGCTCATACGGCGTAATTTTGGCGTCGGCGAGCAAAATCCCTTGTTTAAAGG
TATTTTGCCAGCTGCCGTCGTCATATTGGCGAGCTTGCTGACGCGACTGCGCAGGCATTA
AACGATCAGCACAATCCATCGCCCGCAGCCAGTAAAGCGGATTGGTTTCGGTTGATTTAC
CTTGCAGCGCCCAGATGTCGCTACATTCAGTAGAAAGATAGTCAGCCAGTTGATAAACCG
GAATTTTTTCTTCTGCTGGCGTATCAATGGCTGGCTTATTGTGATTCTGCACGCAACCCA
GCAATGCCAGACATGGCAGCCCTGCCAGCCACAGCCGTCGGGGCAATAATCGTTGAAAAA
TGTGTCGCATATTCACCAGACTTAAAGCCTATCCCAGTGGGCGTAATTGTTGCAGACAGT
CTGGACATGGACAGCGCGGAGAAACCGGAGCGTACATATCGTACGTGAAGATTTCGAGCA
CTGCCCGGGGCCGAACTGACAAATAAAATAGCCTGATAGGATAGGCTGTTAGCATTATTT
CGTGTTTTTCGACGACGGTAATTCAATGCGGAAACAAACGTCTTGCCCGCTCTCGTCGAC
CAGATACAGTTCCCCTTGCATACGGCGAATACAATCCCTGGCAATGCTTAATCCCAGACC
GCTGCCCTTCACCGCCCCTTTTCGCTGGTGGCTTCCCTGAAAAAAGGGTTCGAAGATCAT
GGCGCGTTCCTCTTGCGGAATGGGCGTGCCTGTATTGATGACATCAATATAAACCCGCGC
ACCATGTAAACTGCTGCGAAGGCAAATGTTACCGGATTCAGCCCCGTAGTGCACCGCATT
GGAGTAAAGATTATCCAGTACGCTCATCAGCAGCATTGGCTCCGCCAGGCAAGCTGTTGC
TTTGAGATCGACGTCGGTATGCATCATTTTAGCCCGTGCGGGCAGGCTATGAGCAGAAAC
CACTGTCTCCACCAGCGGTGCTAACTCAACATTCTCCAGTTCCACCGCACTGTCCGCCTG
TTTACGGTTGTAATCAAGCAGTTGTTCGATCAGTTTTTGCAAATTGCGGCTGCTGCTATC
AAGAATGCTCACCACCTCTTTTTGCTCTGGCGTAAGCGGCCCGACAACCTGGTCAGCCAG
TAATTCAGTGCCCTCGCGCATACTCGCCAGTGGCGTTTTTAATTCATGAGATAAATGTCT
TAAAAATTGATGGCGTTGGGATTCCAGCCATGACAGGCGCTCACTTAACCAAAGAATACG
TTGCCCAACCGAGCGTAACTCGCTCGGTCCACTGAACGAGACGCTATTGCCCAGAGAACG
CCCTTCCCCCAGACGGTTGATCATGCGCTCGATATTTTTCACCGGCCCGATAATCATCCG
CGTGAAAAGCAGTACCATTACCAGACTCACCAGAAATAGCACCAGCGATTGCCAACCAAA
ATATTGCCCACGTTCGGCGATTTCACGCTGAAGCTGCTGCCCACGAGAGAACACCACTGT
GCGCGTGGCCTGTACCATTTCGGTATTGGCACTGGCAAAGGCTTCAAGACGTGCGGCGGC
GGCAGCATCGGGACCGCTGTTGTTACACTGAAGTTGAGCCAGATTGTGCAAATCCTGACG
TAATGCCTGGTAGAGTTTATCGTCCGGCAGCACGCCTGCGTGGGCATCGAGCATTTCGCT
GTAACGCTTGCGCTGGCTTTGATAAACCTTCGCCAGGGTTGGGTCGTCCAGCACGCAATA
CTGACGGTAACTACGCTCCATCTCCAGCGCCGCGTTGGTCATCGCTTCACTGCGCCGGGC
ATCAATAAGCGTAGTGCGGTTAACCAGCGCCGCCTGATCGCTAAGCGCATTCAGGCTTTG
CCAGGCTTGCCATGCCAGCACCAACAGGGGCAGCAGAATCAGCAAAAATGCCAGCATTAC
CAGTTGTCGTAATGAGCGGGGAAAAACGGGCCAGCGTTTCAAGGTGTTACTCTCGTCAGA
CGCGAATAGCCTGATGCTAACCGAGGGGAAGTTCAGATACAACAAAGCCGGGAATTACCC
GGCTTTGTTATGGAATAAGGCGGTGCCTAACTCGACGTTTCGCCCGATGGTTGATATAGC
TACGCTGATATCAGAAGTTGGACGGCAGGCACCTTGTTGTGCGTCATTCGTATTTTATGT
AGCACGTCCCGAAGGGGCTGACATAAGTCGGTGAATGAGCCACTGGTTACTATTATGCAG
TAACTGTGCCAATAAAGAAAATAGTTTGGTAACGTACTGATTATACGTTGCTTTGAGGGG
TTTATGTCTCCTCCGCTGTTTGAATGTAAATCAGCCACTGTGTCGCTAAAAAGAGACAAC
TTAAGATAAACTTATTAGATAATATTAAAATCAATGAGTTAAGTGTCGCCAGAAAGCGAC
ACGGCAAACCACCCATTGTCGTGATTTACAGACACAAAAAAGCTCCCGGAGTTGGGAGCT
TATGATAGTGGTTGGTGCTTAATGCCGCATCCGGGCTGCAAAACCAATGGGCTGACGACT
TACCCCAACTGCTTACGCGCATTGCGGAAAATGCGCATCCATGGGCCATCCTCGCCCCAG
TTTTCCGGATGCCAGGAGTTGCTGACAGTACGGAAAACACGTTCCGGGTGCGGCATCATA
ATGGTGACTCGACCACTTTCAGTCGTGACTGCCGTAATACCGTTCGGTGAACCGTTCGGG
TTAGCCGGGTAGGTTTCAGTGACTTTGCCGAAGTTATCGACATAGCGCAGTGCCACCAGC
CCTTTGCTTTCCAGTGCCGCCAGATGCGCCGCATCACGCACTTCCACGCGCCCTTCACCA
TGAGAGACAGCAATCGGCATTTGCGAGCCCACCATCCCCTGCAACAGCAGAGACGGGCTT
TGGGTTACTTCAACCAGGCTGAAACGCGCTTCAAAGCGATCGGAGGTATTGCGCACAAAA
CGTGGCCACAACTCACTACCTGGGATCAGTTCACGCAGATTAGACATCATCTGGCAACCG
TTACATACCCCCAGCGCCAGCGTTTGCGGACGGTGGAAGAAGGTTGCAAACTCATCGCGT
ACACGGTCATTGAACAGGATTGACTTCGCCCAACCTTCACCGGCACCCAGCACATCACCG
TAGGAGAAACCACCGCACGCGACCAGGGCGTGGAAATCTTCCAGGCCCGTGCGTCCGGTC
AGCAGGTCACTCATATGCACGTCGATAGCATCAAAGCCTGCACGGTGGAAAGCTGCCGCC
ATTTCAACATGCGAGTTCACGCCCTGCTCACGCAGTACGGCAACTTTCGGACGTGCGCCA
GTGGCAATATACGGTGCTGCCACATCTTCGTTGATATCGAACGACAGTTTTACATTCAGG
CCCGGATCGGCGTCGTTAGATTTCGCCTGATGCTCCTGATCGGCACACTCCGGGTTGTCA
CGCAGGCGCTGCATCTGCCAGGTAGTTTCTGCCCACCAGACACGCAACGTGGTGCGGCTT
TCGCTGAATACAGTCTGCCCGTTGGCGGTAATCACAAAACGGTCACCGGAAACCGCCTGC
CCTACATAATGGACACAATCAGCAAGCCCATGCTGTGCCAGTACGGACTCGACCGCTTCA
CGGTCAGCGGCACGAACCTGAATCACCGCACCCAGTTCTTCGTTAAACAACGCCGCCAGG
CGATCGTCACCCAGAGTGGCGATATCCGCGTCAATGCCACAATGACCAGCAAAGGCCATT
TCCGCCAGCGTTACCAGCAGGCCGCCATCAGAGCGGTCGTGATACGCCAGCAGCTTACGC
TGTGCAACCAGCGCCTGAATCGCGTCATAGAAGCCTTTCAGTTGCGCGACATCGCGTACA
TCTGCCGGTTTGTCGCCAAGCTGACGATAAACCTGCGCCAGCGCCGTTGCGCCCAGCGCG
TTATTGCCTTTGCCCAAATCAATCAGCAGCAGTGCGTTATCTTCGGTAGAAAGCTGCGGC
GTGATGGTGTGACGTACATCTTCCACGCGGGCAAATGCAGAAATCACCAGCGACAGCGGC
GACGTCATTTCGCGCTCTTCGTTACCTTCCTGCCAGCGGGTTTTCATCGACATGGAGTCT
TTACCCACCGGGATCGTCAGGCCCAGCGCCGGACAAAGCTCTTCGCCCACGGCTTTAACG
GCTTCATACAGGCCCGCATCTTCACCAGGGTGGCCTGCCGCCGCCATCCAGTTGGCGGAA
AGTTTGATGCGTTTGATATCGCCAATTTGTGTTGCGGCGATGTTGGTTAACGCTTCACCG
ACCGCCAGACGGGCAGAGGCGGCGAAATCCAGCAGCGCAACCGGCGCACGCTCGCCAATC
GCCATCGCTTCACCGTAGTAGCTGTCGAGGCTGGCGGTAGTGACCGCGCAGTTAGCGACC
GGCACCTGCCACGGCCCCACCATCTGATCGCGCGCTACCATGCCGGTTACGCTGCGGTCG
CCAATGGTCACCAGGAAGGTTTTTTCCGCCACAGTCGGCAGATGCAGCACACGTTTCACC
GCGTCTGCAATGGTGATCCCTTCACGGGCCAGCGCGTCGCCTTTCGCTTTCAGCGTTTGT
ACATCGCGGGTCATCTTCGGCGTTTTACCAAGCAGGACGTCCAGCGGCAGATCGATCGGC
TGATTATCAAAATGACGATCGTGCAGAGAAAGATGCAGTTCTTCGGTCGCTTCACCAATC
ACCGCGTAGGGTGCGCGCTCACGCTTACACAGTTCGTCAAACAGCGGTAATTGATCGGCA
GCAACCGCCAGCACGTAGCGTTCCTGGGATTCGTTACACCAGATTTCCAGCGGGCTCATG
CCCGGTTCGTCGCTTAGAATCTCGCGCAGTTCAAATTTACCGCCGCGCCCGCCGTCGCTC
ACCAGTTCCGGCATGGCGTTAGAAAGACCGCCAGCGCCAACGTCGTGGATAAACAGGATT
GGGTTGGCATCACCAAGCTGCCAGCAACGGTCGATCACTTCCTGGCAGCGACGCTCCATC
TCCGGGTTGTCGCGCTGTACGGAAGCAAAGTCGAGGTCGGCATCAGACTGACCAGACGCC
ATAGAAGACGCTGCACCACCGCCAAGACCGATGTTCATTGCCGGGCCGCCGAGAACGACC
AGCTTCGCACCGACGTTGATCTCGCCTTTTTGTACGTGATCGGCGCGAATGTTGCCGATC
CCGCCCGCCAGCATGATCGGTTTGTGATAACCGCGCAGCTCTTCGCCGTTGTGGCTGTTC
ACTTTTTCTTCATAAGTACGGAAGTAGCCGTTCAGTGCCGGACGACCAAATTCGTTGTTA
AACGCCGCGCCGCCCAGCGGGCCTTCGGTCATGATGTCCAGCGCGGTGACAATGCGCTCA
GGCTTACCGAAATCTTCTTCCCACGGCTGTTCGAAGCCAGGAATTCGCAGGTTGGAAACG
GAGAAACCAACCAGACCCGCTTTCGGCTTTGCGCCGCGCCCGGTGGCACCTTCATCGCGG
ATTTCACCGCCGGAACCGGTCGCCGCGCCCGGCCACGGAGAAATCGCCGTCGGGTGGTTG
TGAGTTTCGACTTTCATCAGAATATGCGCCGGTTCCTGATGGAAATCGTAGCGGCCCGTT
TCGTGGTCAGCAAAGTAGCGGCCCACTTCAGAACCTTCCATTACGGCGGCGTTATCTTTA
TAAGCAGAGAGAACGTGATCTGGCGTGGTTTCGAAAGTATTTTTGATCATCTTGAACAGC
GATTTCGGCTGCTGTTCACCATCGATAACCCAGTCGGCGTTAAAAATTTTGTGGCGGCAG
TGCTCGGAGTTCGCCTGGGCAAACATATACAGTTCGATGTCGTTCGGGTTACGACCAAGC
TTTGTGAAAGCATCCTGCAGATAGTCAATTTCATCTTCCGCCAGAGCCAAGCCAAGACGC
AGGTTAGCGTCGATCAGCGCCTGACGGCCCTGCCCCAGCAAATCAACGCTGGTAACCGGA
GTCGGTTGATGGTGGGCAAACAACTGCTCTGCATCATCTAAAGCAAAAAAGACCGTTTCC
ATCATGCGGTCGTGCAGTTCAGCGGTAACCTGCTGCCATTGTTCATTGGTCAGCGTACCG
GCTTCTATATAGTAAGCAACGCCGCGCTCAAGGCGGTTTACCTGTTGTAGCCCGCAGTTA
TGGGCAATATCGGTCGCTTTCGAAGACCAGGGAGAGATGGTGCCAGGACGCGGGGTCACC
AGCAGGAGTTTGCCTTGCGGGGCGTGGCTGGCGAGTGCCGGGCCATATTTCAGCAGGCGT
TCAAGTTGTGCGTGCTCATCATCGTTTAACGGCGCATTGAGGTCAGCAAAATGGACATAC
TCGGCGTAAATATTGTGAACCGGGAGCCTGGCAGCCTGAAAACGTGCCAGCAGTTTGTTG
ATTCGGAATGCCGACAGTGCAGGCGAACCACGCAGAATTTCCATCATAAGTCTCTCGTCT
TCTAAGCTTTCGGTGTACCCAAGGGGGGGAAACGGGCGTCATTATAAAGAATCTGATGCG
CTGACGAAACCGTTTGCGTGGAAATAAAATCACCATCGTGAATTAGCAACGCGTGCCGCC
AATGGCTGTAATAAGTTGCCATCTGGCGCAGGTTTACGCAAAATGCCGCTCATTTATGAG
TAAACCTTTCACTATTATTACGTTTTTTCAAGCTGGGACGCGCACGACACAGAGAATTAA
CTAATTGAAAAAATTAAAGATTAATTATCTGTTCATCGGCATTCTGGCACTGCTGCTCGC
GGTCGCTCTCTGGCCATCCATTCCCTGGTTTGGTAAAGCCGACAACCGTATCGCCGCCAT
TCAAGCGCGGGGAGAGTTGCGTGTGAGCACCATTCATACTCCCCTGACTTATAACGAAAT
CAACGGGAAACCTTTTGGCCTGGATTACGAACTGGCGAAACAGTTTGCCGATTACCTCGG
CGTAAAACTGAAAGTGACCGTGCGGCAGAATATCAGCCAGCTGTTTGACGACCTTGATAA
TGGTAACGCCGACCTGCTGGCGGCAGGACTTGTCTATAACAGTGAGCGGGTAAAAAATTA
TCAGCCTGGCCCTACCTATTATTCCGTGTCACAACAACTGGTTTATAAAGTGGGTCAGTA
TCGCCCACGTACGCTGGGCAACCTGACGGCGGAGCAACTCACCGTTGCACCGGGTCATGT
GGTGGTTAACGATCTCCAGACCCTGAAAGAAACAAAATTCCCGGAATTAAGCTGGAAGGT
AGACGACAAAAAAGGCTCTGCGGAATTAATGGAAGATGTCATCGAAGGAAAACTCGATTA
CACCATTGCTGATTCTGTCGCCATCAGCCTGTTTCAGCGCGTTCACCCGGAGCTCGCCGT
AGCGCTCGATATCACCGATGAACAACCGGTGACTTGGTTTAGCCCGTTAGATGGCGATAA
TACCCTTTCCGCCGCCCTGCTCGACTTCTTCAACGAAATGAATGAAGACGGTACGCTGGC
ACGCATTGAAGAGAAATACCTGGGGCATGGCGATGATTTTGATTACGTCGATACGCGCAC
ATTTTTACGCGCCGTCGATGCGGTACTGCCGCAGTTAAAGCCCCTGTTTGAGAAATACGC
CGAAGAAATTGACTGGCGTTTGCTGGCCGCTATTGCTTATCAGGAATCGCACTGGGATGC
ACAGGCCACTTCACCGACGGGTGTGCGCGGCATGATGATGTTAACCAAAAATACCGCGCA
AAGCCTCGGCATTACGGATCGTACCGATGCCGAACAGAGCATCAGCGGTGGCGTGCGTTA
TTTGCAGGATATGATGAGTAAAGTGCCGGAAAGTGTGCCGGAGAACGAGCGGATCTGGTT
TGCCCTCGCTGCGTACAATATGGGCTATGCGCATATGCTGGATGCCCGCGCCCTGACGGC
AAAAACCAAAGGGAATCCTGACAGTTGGGCTGACGTAAAACAGCGTCTGCCTTTACTTAG
CCAGAAACCCTATTACAGCAAGCTGACTTACGGCTACGCTCGTGGACATGAAGCCTACGC
TTATGTCGAAAATATTCGTAAGTATCAGATTAGCCTGGTGGGTTATCTGCAAGAGAAAGA
GAAGCAGGCTACAGAAGCGGCGATGCAACTGGCGCAGGATTATCCGGCGGTATCGCCTAC
GGAGTTGGGCAAAGAGAAATTTCCTTTTCTCTCGTTTCTTTCCCAGTCGTCATCAAACTA
TTTGACCCATTCTCCCTCTCTGCTGTTTTCCAGGAAAGGGAGTGAAGAGAAACAAAATTA
ATCCGTCGAGGATTGCGCTTTTTTCTGCGCTTTAATTTCCTGGCGGCGCATGCGAAAGAA
GTCACTGAGCAACGCCGCGCACTCATCCGCCAGTATTCCTTCCGTAATTTCCACTCGGTG
ATTCATACCCGGATGATGCAGCACATCCATTAAAGATCCCGCAGCGCCAGTTTTCGCGTC
ACGCGCACCAAAGACCACGCGACCAATGCGACTGTGGATCATCGCTCCGGCACACATTAC
ACATGGTTCAAGCGTGACATACAACGTGGCGTCGATCAGACGATAATTTTGCATCACCAG
ACCACCCTGCCGCAGGGCCATGATTTCTGCATGTGCGGTGGGATCATGGCGACCAATCGG
GCGGTTCCAGCCTTCGCCGATTACCCGATTGTTATGCACTAATACCGCGCCGACCGGCAC
TTCCCGCTCATCCCAGGCACGTTTCGCCAGCGTCAGCGCGTGACGCATCCAGTATTCGTG
GCTAAATTCGACTTCAGACAAAAAGAAAACTCCGGTTATAAAAGCGCGGCGCATTATACA
CGGACGCTATGCTTTACTCTATTCCAGTTGCTGGAGTTCACCGCGCGGGGTTACTCGCCA
ACGATGCTGACAGAAATAAAGCAGCGGATTGTCCTGATTACTGTCGCTATAGCCACTGTA
CAGCCGCAGCGGAGTGCCGATTTTGCGCTCCAGTTGTGCGACCTTTTCATGTCCCAGACA
ACGCATCGTCAATACCCAACCACCATAGCCACGCTGAATTTGGCTGGCGATAAGATTAAC
CCGCGGCAGCCAGGGCGTATCGAAATAAACCGCTTCAACCAGCGGCTGCGGAGAGCCGGT
AATCAACCAGATATCAGCATCGGAACTTAACAGGTAGGTGGTTAATCGCTCCTGAACCAG
CGGAAAGGCGGTAACATTGTCGCGAAACCAGCGCACGAAATCGGCCTGCAACGTCTGTAA
ACGTGCTTCGCTGTGACCAAAAGTGCACCCCCACAGAAGCAGACTCATCGGCCAGCGTGC
CGCACGACCTTTTATCAATAACGCAATGGCTATAATCGGTAACAACGGCAGGACAAGTAA
CGCATTCAGCGGTTGGCGACGTAGTAAATAGCGCAGAAAACTGCCGAACATATCCTGCTG
ATGCAATGTTCCATCTAAGTCAAAAAACACCACACGACGCTCGTGAGTTGCCAAACCATA
CTCCTCTGGACTGAAACATCCTGATTAATTTTCGCTACTACATAGCCTAACAGATAGATC
ATCACTTTTCCGGCAACAATCGACCGCATCATGGCTAACTGGAATTTTTAATTCATGGCA
ATTAGCGGCAATGGAATATAAAATTCACTCGCGTGTGTCTCATATTGCCTGTTGTCGCCA
CTATTTCATCGCGAGGAAAGATATGAACGGCTTACTTCGTATCCGTCAGCGTTACCAGGG
GCTTGCCCAGAGTGATAAAAAACTGGCGGATTATCTGCTGCTACAACCTGATACGGCGCG
CCATTTAAGCTCTCAGCAACTGGCCAACGAAGCCGGAGTCAGTCAGTCCAGCGTCGTGAA
GTTCGCGCAAAAACTCGGCTATAAAGGTTTTCCGGCGCTTAAGTTGGCGTTGAGTGAAGC
GCTGGCAAGCCAGCCGGAATCACCCTCCGTGCCCATTCATAACCAAATCCGCGGTGATGA
TCCGTTACGGCTGGTCGGCGAAAAACTGATTAAAGAAAATACTGCCGCTATGTACGCAAC
GCTAAACGTTAATAGTGAAGAGAAACTGCATGAATGCGTAACAATGTTGCGCTCTGCGCG
GCGGATAATTCTGACCGGTATTGGCGCTTCGGGTCTGGTGGCGCAAAACTTTGCCTGGAA
GCTGATGAAGATTGGCTTCAATGCTGCCGCAGTGCGCGATATGCATGCGCTACTCGCAAC
AGTACAGGCGTCGTCCCCTGACGATCTGTTATTAGCCATTTCCTACACCGGTGTACGACG
CGAGTTAAACCTGGCGGCAGATGAGATGCTGCGAGTGGGCGGAAAAGTGCTGGCGATTAC
CGGCTTTACTCCGAATGCCCTGCAACAGCGTGCTTCTCATTGCCTGTATACCATTGCCGA
AGAACAAGCGACAAACAGTGCTTCAATCTCTGCTTGTCACGCTCAGGGAATGTTAACGGA
TTTGCTGTTCATTGCGCTGATTCAGCAGGATCTGGAACTGGCACCAGAACGTATTCGTCA
TAGTGAAGCGCTGGTGAAAAAACTGGTCTGAGTAAAGAATGCGCGTATAATGCCCGCCCG
GTTTGTGTTGTTTTGAGAGTTTCCTTATGGCGTTGTTAATCACTAAAAAATGCATCAATT
GTGATATGTGTGAACCCGAATGCCCGAATGAGGCGATTTCAATGGGAGATCATATCTACG
AGATTAACAGCGATAAGTGTACCGAATGCGTAGGGCACTACGAGACACCAACCTGCCAGA
AGGTGTGCCCGATCCCCAATACTATTGTGAAAGATCCGGCGCATGTCGAGACAGAAGAAC
AGTTGTGGGATAAATTTGTGCTGATGCACCACGCGGATAAAATTTAATATTCTACTCTGG
AAGTAGAGTATTAATTATATTACTGGGAAGCCTTAACGCCATTATATTTATTTAATTGAT
GACATTAGCATAATCATTCACTAAGTTAATTTATATAGTATCTGCCCAGACACTTATTTA
TAGTTATTAAAGGTGCGTCCGACTGGTTCACCGGACGCACCTTAAGTACGTTTCCTTGTG
TTATAAGAACAGAAGGATCAGCTGTAAAACAGCAATGATGATTTTGATGACCCGTTTAAT
CAGGTATCGGCAATCAGTCATTCGTTTTTCCTTAAACAAGGAATGCAGCCATTCAGATTA
GCCCTTACATCTCCCCAAAACTGAACGTGCGAGTTATTGAGGGTGCATGCTGCACTCCAC
ACCAGAGCTTTGACGACACCACTCGTTTCAATGGGGGAATTCTGTGGCATGGTGTAAAGC
ACAGCAAAATCTTCAATAACGAAGCCAATTTTAATGTACTTACGAATTGGCGGTCACGTT
AATCTTTCCATCAATATTGCTTTCTTCGTAAAGGCTCGAGTTTTTATGCTAAAGATTGCA
AGTTGCTTGTAAAAGATAAGTACACTGATCCATAATCGCTGTTGTTGAGGGTGCATGCTG
CACAAAATTAAAGTTAAAAAGTAAAACCCCCGTTCCTTACCAGTTCGGGGGTTTTACTTT
TTAAAGAGAACGGTATTATTTTTAACTTTCAATAATTACCGTGGCACAAGCATAGTGCCG
CTCATCTGCCAGCGTTACATGCATATTTGCAACGCCCAGCTTTTCCGCCAGTTTTAATGC
CTCGCCCCATAGCCGTAGCCGTGGTTTGCCGAGCTCATCATTGAATACTTCAAATTGATT
AAACGCCAGACCATTGCGGATCCCGGTGCCAAACGCTTTTGCTGCGGCTTCTTTCACAGC
AAAACGCTTCGCCAGAAAACGCACCGGCTGGTGGTGCGTTTTCCAGATAGCCCATTCGTT
ATCGCTTAATACGCGGCGTGCCAGGCGATCACCGGATCGGGCGATCACCGCTTCGATGCG
AGCGATCTCCACAATATCCGTGCCTAAACCTAATATTGCCATTAGCCACGCGCTTCCAGC
ATCAGACGCTTCATTTCTGCCACCGCATCTTTCAGTCCGGTCATCACTGCACGACCAATA
ATGGCATGACCGATATTCAGTTCATGCATCTCAGGGATGGCGGCAATGGCTTTCACGTTG
TGATAGGTCAGACCGTGTCCGGCGTTAACTTTCAGACCGAGGCTTGCGGCAAAGGTCGCG
GCTTTGGCGATACGCGCCAGCTCTTGCGCCTGTTCGGCGTCAGTTTTGGCATCAGCATAG
CAACCGGTGTGGATCTCGATAAACGGTGCGCCAACCTCTGCCGCAGCTTTGATCTGCTCT
TCATCGGCGTCAATAAACAGAGAAACCTGAATCCCGGCATCTGCCAGACGTTTGCAGGCA
TCGCGCATTTTGTCACGCTGCCCTGCGACATCCAGGCCGCCTTCGGTTGTTACTTCCTGA
CGCTTTTCCGGTACCAGGCAGCAAAAATGTGGCTTCGTCTCAACGGCGATCGCCAGCATC
TCTTCGGTCACCGCCATCTCCAGATTCATGCGGGTATCCAGCGTCTGACGCAGGATGCGC
ACGTCGCGGTCAGTAATGTGACGGCGATCTTCACGTAAATGCACGGTAATGCCGTCCGCT
CCCGCCTGCTCGGCAATAAACGCGGCCTGCACCGGATCCGGGTAAGCGGTACCGCGCGCG
TTGCGCAGCGTAGCGATATGGTCAATGTTGACGCCTAACAGTAATTCAGCCATGACAATC
CTCATCATTCATAATGTGTTTTCACCGTTCGCTTAGGCATAAACTGCCGGAACAGTTCCC
TGCTCTTTAAAGGTTTACCGCCAAGATACGGCTTAAGCGCCATGCGGGTAAAGCGTTTCG
CGGCGCGCAGTGTGTCTGCGTCAGGAAATTCCCGTGCGTTTAACGCTTTTAACTGCCTTC
CGGTGAACGTTTTATTGTCGATAACGACGCTTGCGATAAACCCTTTTTCTTCGCGATAAC
GATACGTCATGGTGTCATCTACCGGCTCGCCGCTACCCGCACAATGGGTAAAATTGACGC
CATAACCCAGATGCCCGAGCAGTGCCAGTTCAAAGCGGCGCAGCGCGGGTTCTGGCGTAC
CAGTGACCCCTGCAAGAGACTGAATGCAGTGCAAGTAATCGAAAAAAAGTTCAGAGAAGC
GCGTCTCGTATTCCAGTACGCGGGAGAGAAGTTCGTTGATGTACAGACCGCTGTAAAGCG
TGATACCGCTTAATGGCAGCGCCAGCGAGACGGCTTCAGCACTGCGCAGCGTTTTGACTT
CGCCACGCCCGCCAAAACGTAGCAAGAGAGGGGTGAAAGGCTGTAATGCACCTTTCAGGG
TAGAGCGTTTAGAGCGTGCGCCTTTGGCAACCAGACGCACGCGCCCCGATTCCTCCGTGA
AGACGTCCAGCATCAGGCTGGTTTCGCTCCACGGGCGACTATGCAGGACAAATGCGCGCT
GCCAGCCTTCCATCGGAGTTACTCTTAAAGATCGTCAACGTAACCGAGACTGCGCAGTGC
GCGTTCGTCGTCGGCCCAACCGGATTTCACTTTTACCCACAGTTCAAGGTGAACAGGCGC
TTCGAACATTTCCTGCATGTCTTTACGCGCTTCAATCCCGATGGTTTTGATCTTGGCCCC
TTTGTTGCCAATGACCATCTTCTTCTGCCCTTCACGCTCAACGAGAATCAAACCGTTGAT
GTCATAACCACCGCGTTCGTTAGAGACGAAACGTTCGATCTCCACGGTCACGGAGTACGG
CAGTTCAGCGCCGAGGAAACGCATCAGTTTTTCGCGGATGATTTCAGACGCCATAAAACG
CTGTGAGCGATCGGTGATGTAATCTTCCGGGAAGTGATGAGTCGCTTCAGGTAGATGCTT
ACGCACGATTGCCGCAATAGTGTCAACATTCAGCCCGGTTTCGGCAGAGATTGGCACGAT
ATCGAGGAAGTTCATCTGGCTTGCCAGGAACTGCAGGTGCGGCAGCAGATCGGCTTTCTC
CTGCACGTTGTCCACTTTGTTCACCGCGAGGATTACCGGCGCTTTGCCTTCGCGCAGTTT
GTTGAGCACCATTTCGTCGTCCGGCGTCCAGCGGGTGCCTTCAACGACAAAAATCACCAG
CTCAACATCGCCAATAGAGCTGCTCGCCGCTTTGTTCATCAGGCGGTTAATGGCGCGTTT
TTCTTCCATATGCAGGCCCGGTGTATCGACGTAGATCGCCTGATACGCGCCTTCAGTATG
GATCCCCACAATGCGGTGACGAGTTGTCTGCGCCTTGCGGGAAGTGATGGAGATTTTCTG
CCCCAGCAGTTTGTTCAACAATGTGGATTTGCCAACGTTCGGACGTCCGACGATGGCAAT
AAATCCGCAGTAACTTTTATCGATGCTCATTCCAGCTCCAGTTTTTTCAACGCCTGTTCG
GCGGCAGCCTGCTCAGCCTTACGACGGCTTGAACCTGTGCCAACCACCGGTTCACTCAGG
CCGCTGACCTGGCAGTGGATAGTAAATTCCTGATCGTGCGCTTCGCCACGTACCTGGACT
ACCAGATAAGTCGGCAGCGGCAGATGGCGACCCTGCAAATATTCTTGCAAGCGCGTTTTC
GGATCTTTTTGTTTATCGCCTGGGCTAATTTCGTCCAAACGAGTTTGATACCAGTTGAGG
ATTAATTTCTCGACGGTTTGAATATCACTGTCGAGGAATACGCCACCAATTAATGCTTCG
ACGGTGTCGGCGAGAATTGACTCACGACGAAATCCACCGCTTTTAAGTTCACCTGGCCCT
AAACGTAAGCACTCGCCTAACTCAAATTCGCGCGCCAGTTCCGCCAGCGTATTGCCACGG
ACCAGCGTGGCGCGCATCCGGCTCATATCGCCTTCATCCACACGAGGGAAACGGTGATAA
AGCGCATTGGCGATAACGTAGCTCAGAATAGAGTCGCCTAAAAATTCTAAACGCTCGTTA
TGTTTACTGCTGGCACTACGATGAGTTAATGCCTGCTGCAACAGTTCCTGATGATTAAAA
GTGTAGCCCAGCTTCCGTTGAAGCCGATTAATTACGATGGGGTTCATGCGATACCAATAA
ATAAATGCGTCAACAATTCAGCACACGAAACAGACCTGATATACATGGTTCTGCTAACTG
CTTCGCTGCAGTTTCAGTTTACCGGTATATGGGGACCAACGCTGTTTCGTGTGCCGTGGC
AACCTGGAGGTGCCAACCTTAAACTTCGGGGGAATATTCTATACACAACGACGGGGGATG
TCGTTAGCCACGGGAGATTTATCTCATAAATAATTCACGTTGTCGCCATAACGGCGACAA
CGTGAACGAAGATGGCTATTAATGGATGCCGCCAATGCGACTTAAGCGCAGACCAGTCGG
CCATTCGCCTTCTTGCTTATCGAAGCTCATCCAGATAGCCGTTGCCCGACCGACCAGATT
CGCTTCCGGCACAAAGCCCCAGTAACGGCTGTCCGCGCTGTTGTCGCGGTTGTCGCCCAT
CATGAAGTATTGTCCCGGAGGAACAATCCAGGTTGCCAGTTGTTGCCCTGGCTGCTGGTA
ATACATCCCCACCTGATCCTGCGCAATCGGCACTGTCAGAATGCGGTGCGTCACATCACC
CAGTGTCTCTTTACGCTCGGAAAGACGAATTCCATTTTCTTTGGTTTCGTTTTTCGGCAC
TTCAAAGAATCCGCTGGTCGCTTCCCCACCATTACGGCGTGAGAAGGTCTGAACGAAATC
GCTCGGTTCCACGTTTGAGTAGGTGACCGGCAGCGCGTTTTCACACGCCTGGCCGGAACT
GCATCCCGGTTGAATCGTCAGCTCTTTTGAGACCGGATCGTAAGTGACTTTATCGCCCGG
TAAACCCACCGCGCGCTTGATGTAATCAAGCTTTGGATCTTCCGGATATTTAAAGACCAC
GATATCGCCGCGTTTCGGATGACCGGTTTCGATCAGCGTTTTCTGGTAGATAGGATCTTT
AATGCCATAAGCAAACTTCTCTACCAGAATAAAATCACCAATTAACAGAGTCGGCATCAT
CGAACCTGACGGGATCTGGAACGGTTCATAAATAAACGAACGCACAATCAATACGATAGC
CAGTACCGGAAAAACAGAAGCACCGGTTTCCAGCCAGCCAGGCTTCGGCGCAACCTTTTT
CAACGTTGCTTTATCCAGTGAGTCCCCGGCAGCCGCCTGCGCCGCTGCCTGACGTTCCCG
CCGTTTAGGTGCGAAAAAGAATTTATCCACGCACCATAAAATGCCCGTCACCAGTGTGGC
AATCACCAGAATCAGGGCAAACATATTCGCCATGCCAACTCCTAAGGGTTATTTGTTGTC
TTTGCCGACGTGCAGAATGGCGAGGAACGCTTCCTGCGGCAGCTCGACGTTACCGATCTG
CTTCATGCGTTTCTTACCTTCTTTCTGCTTCTGCAGCAGCTTTTTCTTACGGCTGATATC
GCCGCCATAACATTTAGCCAGTACGTTTTTACGCAGCTGTTTCACGGTGGATCGCGCAAT
GATGTGCGTACCAATCGCTGCCTGAATGGCGATATCAAACTGCTGGCGTGGGATCAGATC
TTTCATCTTCTCCACCAACTCGCGACCGCGGTTTTGCGAATTATCACGGTGGGTGATCAA
CGCCAGCGCATCAACACGTTCACCGTTGATTAATACGTCTACACGTACCATGTCGGACGC
CTGGAAGCGCTTGAAGTTGTAATCCAGAGACGCATAACCACGCGAGGTAGATTTCAGGCG
ATCGAAGAAGTCGAGCACCACTTCCGCCATCGGGATCTCGTACGTCAGCGCCACCTGATT
ACCGTGGTAAACCATATTGGTCTGCACGCCGCGTTTTTCTACGCACAACGTAATAACGTT
GCCGAGATATGCCTGCGGCAGCAGCATGTGACACTCTGCAATCGGCTCGCGCAGTTCGTA
GATGTTATTTACCGCAGGCAGCTTGGATGGGCTGTCGACGTAGATAACTTCTCTTGACGT
GGTTTCAACTTCATACACTACGGTCGGCGCAGTGGTGATCAGATCCAGATCGTATTCACG
TTCCAGACGTTCCTGGATGATCTCCATGTGCAGCAGGCCGAGGAAGCCGCAGCGGAAACC
AAAGCCCAGCGCGCTGGAGCTTTCCGGCTCATAGAACAGTGAGGCATCGTTCAGGCTGAG
TTTACCCAGCGCGTCACGGAAGGCTTCATAGTCGTCGGAACTTACCGGGAACAGACCGGC
GTATACCTGCGGTTTGACTTTCTTAAAGCCAGGCAGCGCCTTTTCTGCCGGATTACGCGC
CAGCGTTAAGGTATCGCCGACTGGAGCGCCGTGGATATCTTTAATCGCACATACGAGCCA
GCCTACTTCGCCACATTTCAGTTCAGTGCGGTCAACCTGTTTCGGCGTGAAGATGCCCAG
ACGGTCGGCGTTATAGGTCTGCCCGGTACTCATGACTTTCACTTTGTCGCCCTTACGCAG
GGTGCCGTTTTTAATACGGATAAGTGAAACAACGCCCAGGTAGTTGTCGAACCATGAGTC
GATAATTAGTGCCTGCAACGGGCCTTCCGGATCGCCTTCCGGCGGCGGAATGTCGCGCAC
CAGACGTTCGAGAACGTCCTGCACACCAACGCCGGTTTTCGCTGAACAGCGCACCGCGTC
GGTGGCGTCGATGCCGACGATATCTTCAATTTCTTCCGCCACGCGTTCAGGATCGGCTGC
CGGCAGGTCAATCTTGTTCAGTACCGGCACAACTTCGAGATCCATTTCCATGGCGGTGTA
GCAGTTTGCCAGGGTTTGCGCTTCTACGCCCTGCCCGGCGTCGACCACCAGCAATGCACC
TTCACAGGCAGCCAGCGAACGGGAAACTTCATAGGAGAAGTCTACGTGGCCCGGGGTGTC
GATAAAGTTAAGCTGATAGGTTTCGCCGTCAGACGCTTTGTAGTCCAGCGTCACGCTTTG
CGCTTTGATGGTAATGCCACGCTCACGCTCAAGATCCATGGAATCGAGAACCTGCGCCTC
CATTTCACGGTCAGACAGGCCACCGCAGATCTGGATAATACGGTCAGACAGCGTCGATTT
ACCGTGGTCAATGTGAGCTATGATCGAAAAGTTACGTATATTCTTCATAAAGTATGATTA
TTGTGCCTTAATGCCCGGTTAACCAGGCTTTTAGAAGTCGCTGTTCTGAGCTTAACGTCT
GTATTAATAGAAACGCCGCATTCTACACTACAACATTGAGGCGAGGAAATGTTCATACCG
TATGGATTGTGGTATCTGGAAACGTCCTCGCATTTGTTATGCAAAATGCAACAAAGCCAG
TGAAATCACTGGCTCGCGTCTTCCGAAGATGTTTCAAATCGCACAAGGCCAGGCGGCAAT
GCCACGCTTAAGATGATCGGTTGCCATTCTGCCCGGGCAGCAAACTTACGCGAGTAGCCG
CGCGCAATCAGGAACCCGCCAATACCACCGAGGATCGCACCACATAATGCTGCGACGTCA
GAAGCAAAGAGTAGCTGAAATAGCGAAGCGATAAGGAATAATCCCACCAGCGGCGACATA
TAAACCAGTAATGCGGAGCTAAGCAGGCTGCCTTCGGCGATCCCCAATTCCACTTTTTGC
CCCGGCACTAACGGCTCATCACAGGGTACGACAATGGTATGCGTGGTTTGCGGGCCAAGT
TTATTTAACACGCGGCTACCGCAACCGGCGCGTGAAGCGCAGCTGCTGCATGAAGCTTTA
ACATCACAACTGACCAGCGCCTGCCCGTTTTGCCAGGAGACGACGGTAGCCCACTCTTTG
ATCATTGCGCTGCCCCGAACTTAATATTCTCGGCAATGCGTTTCGCCGTTTGCGGCGGCA
GTTCACCGACAATGGTGATTTCGGCGTTATCACGTACGCTTGTACTGACGGTTCTGCGTC
CGGTGCGCAACATCTGATCGGTGCTCGATGGCGTAGCGCGGTTAACGTTTACCGAGAAGC
TGAATAATCCGTCGGAATAGAGACGTGATTCGATAGGCATGTTGTCCATCGTCGGTAGCG
GACGTCGACTACTGGAAACTTCGCTAAAACCCTGTGGCAACCAGGTTGGCGTCCAGCTGA
ATTTAGCTTTTTCACCTACAGGAACAGAAAGCAACGGCGGCAAATTTGCCTTCGCCAGCG
TCTGCATACTGCTGCTGATATCCTGATTGACGTTAAAAGCAATCACGCGAAATTGTTCCA
GCGTTTCACCATCGCGATCAAGGAGATCAACCCGCATCGGTAATTTCGATTCGGTGTCCA
TCCACACGATGTAGCTGTAGCGTGTACCATCTCGGGCAACCACGCGAATGACTTCGCAAA
GACGATCAGCAATACGCGTGCGCCCGACGGAGATAAAGTCGTAGTAAGGAGAAAGGCGTT
TGAAATCGGTATAGATAAGCGATGGCAGAGAATCAACAATGTAATCGCCATTAAGCGTGA
ACGGTTCAAGTCCCGGTTCAAAATAGCTGATTTCATTGCCGCGCTGTACCACTTCCCGGC
GCGGGCCATCCATTTGCAACAATTGTGCAAGAGGACGGTTATCGAGGCGTGCATGTCGAT
AACGCAGAGACTCAACACCCTGTTTATTGATGCTGATGAATGACAGCTCGTAATTCAGTG
ACTGACTGGCCAGGTTCATCTGCTGTAATAACGCCCCGGACGCGGGAGTGGCCGAGGCGT
TAGCAGAGAATAACAGGCTACCTGTCACTAATGACATGGCAAACCAAAGTTGCTTCATTA
CTGCGATTGCGTTCCTAAAGTTTGAATTCCTGGCACCTGTACAGCGGCTTGCTGGGTTTG
CGCCTGCTCAAACTGAAGCTGTTCAGAGTGGAGTCGGCGTTGCAGTTCGTAATCCTGCAA
CATTGCATTAATGCGACGACGCTGCTCCTGTACCTGCTGCTGTTGACCATTGTTTGCGGT
CGCTTCAGAAGGTACTCCCAGGCTTACCGGGCTGGCTTTACCCATCATCGGCAGTGTATT
AAATACCGGCGTTTCGGGCTGCTGGGACGTTTCAGATTGTCCATTATAGTGCTGGACGCC
AACGATAACTGCAAGCGATACGCATGCGGCTACGCCCATTTGGGTAAGCTGTGCCGCCCA
CGGACGTACTTTCTGCCAGAATGGCATTTTCTGCCATTGATGCGGCGCAGGCTGGGCTTC
CGGGATCAATGTCGCCGGTTGACGTACTGGCTCTTCTTCAATGGCGGCCATCACGCGTGA
AGAGATATCGAAATGGAGCACCTCGGGAGTATCACCCCGCATTGAGTCACGGATTAAGTG
ATAGCTTTCCCAGGTTTTCTGCATTTCTGGGTTATGAGCCAGTTCGTTAAGCAGCTCACT
ATCCAGCGTTTCGCCATCCATTAAAGCGGAAAGTTGTTCTTTCTGCATGCCTAATACCCT
TATCCAGTATCCCGCTATCGTCAACGCCTGATAAGCGGTTGAACTTTGTTATCAATAGCT
TCCCTCGCTCGGAAGATACGTGAACGCACCGTACCTACCGGACAATCCATGATAGCGGCT
ATCTCTTCATAGCTCAGGCCATCCAGCTCCCGCAAGGTTATTGCCATGCGTAAATCTTCC
GGGAGGGACTCAATAGTTCGGAAAACTATCTGTCTCAGTTCTTCTGACAACATTAAGTTC
TCAGGGTTCGAAATTTCTTTCAACGCGCCGCCACTTTCGAAGTTTTCAGCTTCAATGGCA
TCCACATCACTGGAAGGTGGACGACGCCCCTGAGCAACCAGGTAATTTTTCGCTGTATTT
ACAGCAATCCGATACAGCCATGTATAAAAAGCGCTATCTCCCCGGAACGAATCCAGCGCA
CGATAGGCTTTAATAAAAGCTTCTTGTACCACATCGGGAACATCACCCGACGGCACATAG
CGGGAAACCAGACTCGCCACTTTATGCTGATAGCGCACTACCAGTAAGTTAAAGGCTTTC
TGATCTCCCTTCTGGACCCGTTCAACCAGGACCTGGTCCGTTAACTGCTCGCTCATCCGA
GGTAAAGTCTCCCCAAACCAAATTTCCACGCGCTATCGAAACGCCACTCCATTAGCTGCA
ATTTGAGCAAGCAAAGGGTTAGAGTGTCTCGTTTTTGTAAAGTTCCGTAACGCATCTGTT
TTTGTTTGTCATGCTGTAGACGGATCATTATCTATCATTATAAGTCTACAGAATCTGAAC
ATCGCATTATCTGTGTAGAAATGCCCATTTAACTGCCTGAAGAGTAACCCAACGGCCTTT
TTATTTCACCACCTAATCCTCCACCAGCCAGTAACTTCTCTTTTTCTCGCCGCCCTGCGT
CAGCGTGTTTAGCAACTGTAACAAATATTAAAATAGCAGGTGTTTATCCGCACAACATGA
TGCTATGCTGACCAAACCATGTTTAGTAAATTAAACAAAGAAAATGAATACTCTCCCTGA
ACATTCATGTGACGTGTTGATTATCGGTAGCGGCGCAGCCGGACTTTCACTGGCGCTACG
CCTGGCTGACCAGCATCAGGTCATCGTTCTAAGTAAAGGCCCGGTAACGGAAGGTTCAAC
ATTTTATGCCCAGGGCGGTATTGCCGCCGTGTTTGATGAAACTGACAGCATTGACTCGCA
TGTGGAAGACACATTGATTGCCGGGGCTGGTATTTGCGATCGCCATGCAGTTGAATTTGT
CGCCAGCAATGCACGATCCTGTGTGCAATGGCTAATCGACCAGGGGGTGTTGTTTGATAC
CCACATTCAACCGAATGGCGAAGAAAGTTACCATCTGACCCGTGAAGGTGGACATAGTCA
CCGTCGTATTCTTCATGCCGCCGACGCCACCGGTAGAGAAGTAGAAACCACGCTGGTGAG
CAAGGCGCTGAACCATCCGAATATTCGCGTGCTGGAGCGCAGCAACGCGGTTGATCTGAT
TGTTTCTGACAAAATTGGCCTGCCGGGCACGCGACGGGTTGTTGGCGCGTGGGTATGGAA
CCGTAATAAAGAAACGGTGGAAACCTGCCACGCAAAAGCGGTGGTGCTGGCAACCGGCGG
TGCGTCGAAGGTTTATCAGTACACCACCAATCCGGATATTTCTTCTGGCGATGGCATTGC
TATGGCGTGGCGCGCAGGCTGCCGGGTTGCCAATCTCGAATTTAATCAGTTCCACCCTAC
CGCGCTATATCACCCACAGGCACGCAATTTCCTGTTAACAGAAGCACTGCGCGGCGAAGG
CGCTTATCTCAAGCGCCCGGATGGTACGCGTTTTATGCCCGATTTTGATGAGCGCGGCGA
ACTGGCCCCGCGCGATATTGTCGCCCGCGCCATTGACCATGAAATGAAACGCCTCGGCGC
AGATTGTATGTTCCTTGATATCAGCCATAAGCCCGCCGATTTTATTCGCCAGCATTTCCC
GATGATTTATGAAAAGCTGCTCGGGCTGGGGATTGATCTCACACAAGAACCGGTACCGAT
TGTGCCTGCTGCACATTATACCTGCGGTGGTGTAATGGTTGATGATCATGGGCGTACGGA
CGTCGAGGGCTTGTATGCCATTGGCGAGGTGAGTTATACCGGCTTACACGGCGCTAACCG
CATGGCCTCGAATTCATTGCTGGAGTGTCTGGTCTATGGCTGGTCGGCGGCGGAAGATAT
CACCAGACGTATGCCTTATGCCCACGACATCAGTACGTTACCGCCGTGGGATGAAAGCCG
CGTTGAGAACCCTGACGAACGGGTAGTAATTCAGCATAACTGGCACGAGCTACGTCTGTT
TATGTGGGATTACGTTGGCATTGTGCGCACAACGAAGCGCCTGGAACGCGCCCTGCGGCG
GATAACCATGCTCCAACAAGAAATAGACGAATATTACGCCCATTTCCGCGTCTCAAATAA
TTTGCTGGAGCTGCGTAATCTGGTACAGGTTGCCGAGTTGATTGTTCGCTGTGCAATGAT
GCGTAAAGAGAGTCGGGGGTTGCATTTCACGCTGGATTATCCGGAACTGCTCACCCATTC
CGGTCCGTCGATCCTTTCCCCCGGCAATCATTACATAAACAGATAAAAAGCCTGGGTCAG
CGCCGTATACGCTTCGGAATAGTTCTGGTCTGGCCCACGAATGACTAAGCGATCGCTAAA
GCATTCTCCCGCCTGCGGGGAGAATGCCAGCAGCACCCGATGCGGCAGTCGCGCTTCGTT
TTCCGCCACATCCGTCCGCAAACGTAAATGCCAGCCCATGCTTAATGCCAGCTCCGTAAA
ACCATTACCAATCTGCTCTGGCAGCACTACGCAGAAAAATCCCTCTTCGGTAATGCACTC
CGCCGCACAGGTCAGCAACGATGGGTGATCAAGCGTAGTGGTATAGCGAGCCTGTTCCCG
TTGAGGTGTCGAGCACTCTACTCCCTGCTGATAGTAAGGTGGGTTACTGATGATTAAATC
GAAGCGTACTGTCTGCTGTGTGATCCACTGCTGAATATCCGCCGTATGGACGTTAATCCG
CTCTGCCCACGGGGACTGGTTGATATTTTCCTGCGCCTGCGCGGCAGCTTCACTTTCCAG
TTCAACTGCATCAATCATCACGCTGTCATCGGTTCGCTGCGCCAGCATTAATGCCAGCAA
CCCGCTACCCGCGCCGATATCAAGGCAACGTTTTACCCCAGCCACCGGTGCCCATGCGCC
CAATAAAATACCATCCGTTCCCACTTTCATCGCACAGCGATCGTGAGCAACAAAAAACTG
TTTAAAAGTAAATCCATTACGACGAAGCACGGATGTAGACTGTGACATGAAAATAAAACC
TTGCAGGAAAAACGGCGATAGCACCGGGTGAGAACAATACCCGAGAAGCGATATCCATAC
AAACAGATGAAGATTGCAGCCGTAACGTCTATAATCAGCGCCCCACACAGAGGTAGAACA
TGACTGTAACGACTTTTTCCGAACTTGAACTCGACGAAAGCCTGCTGGAAGCCCTCCAGG
ATAAAGGTTTCACTCGCCCGACCGCCATTCAGGCTGCCGCCATTCCGCCTGCGCTCGATG
GCCGTGATGTACTCGGTTCTGCGCCGACAGGCACCGGTAAAACGGCGGCGTATCTGCTGC
CAGCGTTGCAGCACCTGCTCGATTTCCCGCGTAAGAAATCCGGTCCGCCGCGTATTTTGA
TCCTCACCCCAACTCGCGAGCTGGCGATGCAGGTGTCCGATCATGCCCGCGAACTGGCGA
AACATACGCATCTGGATATCGCCACCATCACCGGCGGCGTAGCCTATATGAACCACGCGG
AAGTGTTCAGCGAAAATCAGGACATCGTGGTCGCCACGACCGGACGTCTGCTGCAATACA
TAAAAGAAGAGAACTTCGATTGCCGCGCGGTTGAAACGCTGATCCTCGACGAAGCAGACC
GTATGCTGGATATGGGCTTCGCTCAGGATATCGAACATATTGCTGGCGAAACGCGCTGGC
GTAAACAGACCCTGCTCTTTTCGGCAACGCTGGAAGGCGATGCGATTCAGGACTTTGCCG
AGCGTCTGCTGGAAGATCCGGTGGAAGTTTCTGCCAATCCCTCCACCCGTGAGCGCAAAA
AAATTCATCAGTGGTATTACCGCGCCGATGATCTTGAGCATAAAACCGCGTTGCTGGTGC
ATCTGTTAAAACAGCCGGAAGCGACCCGCTCAATTGTGTTTGTGCGTAAGCGTGAGCGTG
TGCATGAGCTGGCAAACTGGCTGCGCGAAGCGGGCATCAACAACTGCTATCTCGAAGGTG
AGATGGTACAGGGCAAGCGTAACGAAGCGATCAAGCGTTTGACCGAAGGTCGCGTAAACG
TACTGGTCGCAACCGATGTTGCCGCGCGCGGTATCGACATTCCTGACGTCAGCCACGTCT
TTAACTTCGATATGCCGCGCAGTGGCGATACTTATTTGCACCGTATCGGACGTACCGCGC
GCGCCGGTCGTAAAGGCACCGCAATTTCGCTGGTGGAAGCCCATGACCATCTGCTGCTGG
GTAAAGTAGGCCGCTATATTGAAGAGCCAATTAAAGCTCGCGTTATTGATGAGTTACGCC
CGAAAACGCGTGCGCCAAGCGAAAAGCAGACCGGCAAGCCATCGAAGAAAGTACTGGCTA
AACGTGCTGAGAAGAAAAAAGCTAAAGAGAAAGAGAAGCCGCGGGTGAAAAAACGCCATC
GCGACACCAAAAATATTGGTAAGCGCCGTAAACCAAGCGGAACGGGCGTGCCACCGCAAA
CGACAGAAGAGTAATCTCAATGCCAGGTTTAAGCCTGGTATTAAAAGTGCTGGCAAACGC
AAAACTGCCTGATGCGCTACGCTTATCAGGCCTACGTGGCTCATGCAATATATTGAATTT
GCACGATCTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCATGAATAAAGCGCACT
TTGTCGACAAGTTAAATGCCGGGTTTAATCCCGACATTATTTTTATCCAGCCACAAAACT
CTCTTCAACACACTGAATAAAAGTGTGCATCGCCGGGCTAACCGCTTTTCCAGCATGATG
TGCGCACATGGCCGTAATGGTCTGCGACTGTTCGCCAAAAGGCAATTCAATTAATTCTCC
GCACTCCAACTCTTTTGCCACCGCAAAGCGCGGTAGGTAGCTGACCCCGATATTCGCCGC
GACACAACGCTTGATGCTTTCGATACTTATAAGCTCAATGGTGTTTTCCACCGTGATCCG
CCGCTGACGCAGCGTGCTCTCAAATATCTGCCGGAAGACACATTGCGGTTCGTTGATAAT
AAAGCTACAGGCGTTATGTCTTCCCGGCTCAGTAAAATCGACATCTGCAATTTGCGGTGA
AGCCACCAGCACCAGTGATTGTTCACCCAACTCTCGTCGATTCAGAGCATCATCATTCCC
TACACGATAAAAGACGCCAACATCGGCCTCATCATTCAGTAGCGCATCACGGATCACGTA
ACAGTTCAGCGACTGCAACGATAAACGCACTTTTGGGGCGCGTTGCCGAAAACGCTGCAA
CACCTGCGGCATTCGGTAAGAGAGCAACGTTTCGCCCGAAACAACGCGTAGTTCCCCGTC
CGGATCTGACTCCTTTTTGGCAGCCTCACGAAGCGTATCCATCACTCGGGTAAGTTCATA
AATGTGCGGCAGCAACTTTTTTCCTTCGCGGGTAAGGCACATCCGTCGGCCAATTTTCTC
AAATAACTGGACTGAAAACTCCTGCTCAAGCTGCTGAATATGAAAAGTCACCGTCGATTG
TGTACAGCACAATTTTTGCGAAGCTCGCAAAAAGGAACCCTCTTCCACCACGGTTTTAAG
CGTAATAAAACGGCGCAGATCCATAACCCCAAACCTATCGAAAATATCGAATCTAGAATA
TAAAAACATTCATTTTTTTAAATGTTCCGTGTCGGGTACTGTCTACCAAAACAGAGGAGA
TAACAAGTGACACCGACCCTTTTAAGTGCTTTTTGGACTTACACCCTGATTACCGCTATG
ACGCCAGGACCGAACAATATTCTCGCCCTTAGCTCTGCTACGTCGCATGGATTTCGTCAA
AGTACCCGCGTGCTGGCAGGGATGAGTCTGGGATTTTTGATTGTGATGTTACTGTGTGCG
GGCATTTCATTTTCACTGGCAGTGATTGACCCGGCAGCGGTACACCTTTTGAGTTGGGCG
GGGGCGGCATATATTGTCTGGCTGGCGTGGAAAATCGCCACCAGCCCAACAAAGGAAGAC
GGACTTCAGGCAAAACCAATCAGCTTTTGGGCCAGCTTTGCTTTGCAGTTTGTGAACGTC
AAAATCATTTTGTACGGTGTTACGGCACTGTCGACGTTTGTTCTGCCGCAAACACAGGCG
TTAAGCTGGGTAGTTGGCGTCAGCGTTTTGCTGGCGATGATTGGGACGTTTGGCAATGTG
TGCTGGGCGCTGGCGGGGCATCTGTTTCAGCGATTGTTTCGCCAGTATGGTCGCCAGTTA
AATATCGTGCTTGCCCTGTTGCTGGTCTATTGCGCGGTACGCATTTTCTATTAACGAAAA
AAAGCGGAAGAGGTCGCCCTCTTCCGCTTAGTAACTTGCTACTTAAGCCTTACAGGCTTT
CAGTAAAGGTACGAGCGATAACGTCGCGCTGCTGTTCCGGAGTCAGAGAGTTAAAGCGAA
CTGCATAACCGGATACACGGATGGTCAGCTGCGGATATTTTTCCGGATGCTTAACTGCAT
CTTCCAGAGTTTCGCGACGCAGAACGTTAACGTTCAGGTGTTGACCACCTTCAACGCGAA
CTTCTGGTTTCACTTCTACTGGAACTTCACGGTATTCAATGTCACCCAGTTTGCTTACTG
CAACCACTTCATCTTCTGCATAACCTGCTTTTGCAACGATGCAACGCGCTTCGCCTTTTT
CGCTGTCCAGCAGCCAGAAAGAGTTCAGCAGATCGTCGTTAGCGGCTTTAGTAATCTGGA
TACCTGTAATCATGTGATGCCTCCCCGGCAAAATTATTTGATTTGTTCAGCCTGTCGCGG
CCAATTGGTAAAACCATTGTTGCTTGAGTGTATATATACTCCTCAAACACCCTTGAATCT
TTGATTTAAATCAATAAAAACCACACATCAAGTATGGTCGCAAATGGATTTTATTGTTTT
ACATCAACTTATGCGGGTGTGAAATTTTACCAATTTACATTTTTTTGCACTCGTTTAAGT
CTAAAAAATGAGCATGATTTTGTTCTGTAGAAAGAAGCAGTTAAGCTAGGCGGATTGAAG
ATTCGCAGGAGAGCGAGATGGCTAACGAATTAACCTGGCATGACGTGCTGGCTGAAGAGA
AGCAGCAACCCTATTTTCTTAATACCCTTCAGACCGTCGCCAGCGAGCGGCAGTCCGGCG
TCACTATCTACCCACCACAAAAAGATGTCTTTAACGCGTTCCGCTTTACAGAGTTGGGTG
ACGTTAAAGTGGTGATTCTCGGCCAGGATCCTTATCACGGACCGGGACAGGCGCATGGTC
TGGCATTTTCCGTTCGTCCCGGCATTGCCATTCCTCCGTCATTATTGAATATGTATAAAG
AGCTGGAAAATACTATTCCGGGCTTCACCCGCCCTAATCATGGTTATCTTGAAAGCTGGG
CGCGTCAGGGCGTTCTGCTACTCAATACTGTGTTGACGGTACGCGCAGGTCAGGCGCATT
CCCACGCCAGCCTCGGCTGGGAAACCTTCACCGATAAAGTGATCAGCCTGATTAACCAGC
ATCGCGAAGGCGTGGTGTTTTTGTTGTGGGGATCGCATGCGCAAAAGAAAGGGGCGATTA
TAGATAAGCAACGCCATCATGTACTGAAAGCACCGCATCCGTCGCCGCTTTCGGCGCATC
GTGGATTCTTTGGCTGCAACCATTTTGTGCTGGCAAATCAGTGGCTGGAACAACGTGGCG
AGACGCCGATTGACTGGATGCCAGTATTACCGGCAGAGAGTGAGTAAATTTGCGGGGAAA
TGCCGGATGGCAGAGTTGCCACCCGGCTGATTTATCAGGCTTTATTCTGACGCCACCATT
CACCAAGCAAAACGCCGGTTGCGACAGAGATATTCAGCCCGGCAACGTTGCCCGTACCGT
CAATCTTCACGCGCAGATCGTTCGGATCGCGTGCGGCATCCGGTAACCCTTCATATTCCT
GACCCAGCACCAGTACCATTTTCGCTGGCAGACTAGTTTTGAACAGCGGTTTACCCTGCT
CGCTGGAAGTGGTCACTACGGTGTAACCTGCCTGACGGAAATCATCCAGCACGTTAACAA
TGTTGTCGCCAGTAATCGGCTGAACGTGCTCTGCGCCGCCTTCTGCGGTACGGATAGCCG
CCCCCGACTCCAGCAGTGCCGCATCCTGCACCACGACACCTTTCACGCCGAAGTGCGCGC
AGCTGCGCATCATGCCACCCAGGTTATGCGGGTTAGATTCGTTTTCCAGTGCCAGAACGC
AATCCTGCGCGCCTGCCTGGCTTACCCACTGCTGCACGGTTGTACCGTTACGCTTTTTGA
TCAAGAAGCAAACGCCGCCGTGATGTTCCGTGCCTGACGCTTTTGTCAATTCCGCTTCAT
CCACCACATGGTACGCTTTGCGGTTTGCTGCCATCCAGCGCAAAGCTTCTTTAAAACGCG
GCGTTACACTCTGGATAAACCAGGCGCGAACAATCGCTTCCGGACGGCTCTGGAAAAGTG
CCTGACATGCATTTTCGCCGTAGACGCGGGTTTCTTCCGCACGCTGACGACGCAACACTT
CCGGATCAATAAAACTTTTACCACTGATGCCACCGTGATCGGCCTTTTCCGGCGTCTCAT
CACCCGGCGCGCGGGAAACCGTGCGCCACGGCGAATCTTCCCACTTGCGGTCACGGGGCT
GACTCTGTTTGTCATCGCGGGCGGGGCGACGGCCACCGTCAGCACGAGATTTTCCTGGAC
GCCCGCCCCCTTTCCCGGTACGCGGGTTGTGGGTACGTTTATCAGAATCATCATCACTGC
GGACATACATCACTTTGACCTTGCCGCTTTTACCTTTCATTTCATCGTTCATGCTTTTCT
CCACCAGCGCTGCGCGAAGCGCGCAGATTACCCGAAGTCCGCGCGGTTCGCCATGATTTC
GTACCAAAGCCTGCGACTATCATACCTATTGAATAAAACAGATTGTTGTCTGGAACAATG
TCCCCGATAATATGTAACATATTAGAAACATACCGGCGTCGTTGCCGATAAGTCTCCTTA
CTCATCCCGAGGTTAGTTATGAATACCGTTTGTACCCATTGTCAGGCCATCAATCGCATT
CCCGACGATCGGATCGAAGATGCGGCAAAATGCGGACGCTGCGGTCACGACTTGTTTGAC
GGAGAGGTGATTAATGCGACCGGTGAAACACTCGACAAATTGCTGAAGGATGATCTACCT
GTGGTGATCGACTTCTGGGCACCGTGGTGCGGCCCCTGCCGTAATTTCGCACCAATTTTT
GAAGATGTCGCGCAAGAGCGTAGCGGTAAAGTGCGCTTTGTGAAAGTGAATACCGAAGCT
GAACGTGAATTGAGCAGTCGCTTTGGAATTCGTAGTATACCGACGATCATGATTTTCAAA
AACGGTCAGGTTGTCGACATGCTTAATGGCGCAGTACCGAAAGCGCCGTTCGATAGCTGG
CTGAACGAATCTCTTTAATCTTACCGGGGCGCATCTTGTGCCCCGTTTTCTCCTCTGCGA
CAATGGCGTTTTTTCGACGCTCTCTTATGACCGAAAACGCTGTTCTCCAGTTACGCGCCG
AGCGTATTGCGCGCGCAACACGTCCTTTTCTTGCCCGCGGTAATCGCGTTCGTCGCTGCC
AACGCTGTCTTTTGCCAGAGAAATTATGTCTCTGTTCGACAATTACCCCAGCACAAGCAA
AAAGTCGCTTCTGTTTGCTGATGTTCGACACCGAGCCAATGAAGCCCAGTAATACCGGGC
GTCTCATTGCTGATATTTTGCCTGATACCGTTGCGTTTCAATGGTCGCGTACCGAACCCT
CGCAGGATTTGCTGGAGTTGGTGCAAAACCCGGACTATCAGCCAATGGTGGTCTTTCCCG
CTTCGTATGCTGATGAGCAACGGGAAGTGATCTTCACACCACCTGCCGGTAAGCCACCGC
TGTTTATCATGCTCGATGGTACCTGGCCGGAAGCTCGCAAGATGTTTCGTAAAAGTCCGT
ATCTGGATAATCTTCCCGTCATTTCCGTCGATCTTTCCCGGCTTTCTGCCTATCGCCTGC
GTGAAGCCCAGGCTGAAGGCCAATATTGTACTGCCGAGGTAGCCATCGCACTGTTAGATA
TGGCCGGCGATACCGGGGCGGCGGCAGGGTTAGGCGAGCATTTTACCCGCTTTAAAACAC
GCTATCTGGCAGGAAAAACGCAACATCTGGGTAGCATCACAGCAGAACAGTTAGAAAGCG
TTTAAAATCATTCGGTCACTTCTGCGGGAGACCGGTATGAGTCAGCGAGGACTGGAAGCA
CTACTGCGACCAAAATCGATAGCGGTAATTGGCGCGTCGATGAAACCCAATCGCGCAGGT
TACCTGATGATGCGTAACCTGCTGGCGGGAGGCTTTAACGGACCGGTACTCCCGGTGACG
CCAGCCTGGAAAGCGGTGTTGGGTGTGTTGGCCTGGCCGGATATTGCCAGCTTGCCCTTT
ACACCCGACCTTGCGGTTTTATGTACCAATGCCAGCCGTAATCTTGCTCTTCTGGAAGAG
CTCGGCGAGAAAGGCTGTAAAACCTGCATTATTCTTTCCGCCCCGGCATCGCAACACGAA
GATCTCCGCGCCTGCGCCCTGCGCCATAACATGCGCCTGCTTGGACCAAACAGTCTGGGT
TTACTGGCTCCCTGGCAAGGTCTGAATGCCAGCTTTTCGCCTGTGCCGATTAAACGCGGC
AAGCTGGCGTTTATTTCGCAATCGGCTGCCGTCTCCAACACCATCCTCGACTGGGCGCAA
CAGCGTAAGATGGGCTTTTCCTACTTTATTGCGCTCGGCGACAGCCTGGATATCGACGTT
GATGAATTGCTTGACTATCTGGCACGCGACAGTAAAACCAGCGCCATCCTGCTCTATCTC
GAACAGTTAAGCGACGCGCGACGCTTTGTTTCGGCGGCCCGTAGTGCCTCGCGTAATAAA
CCGATTCTGGTGATTAAAAGCGGACGTAGCCCGGCGGCACAGCGACTGCTCAACACGACG
GCAGGAATGGACCCGGCATGGGATGCGGCTATTCAGCGTGCCGGTTTGTTGCGGGTACAG
GACACCCACGAGCTGTTTTCGGCGGTGGAAACCCTTAGCCATATGCGCCCGCTACGTGGC
GACCGGCTGATGATTATCAGCAACGGTGCTGCGCCTGCCGCGCTGGCGCTGGATGCCTTA
TGGTCACGCAATGGCAAGCTGGCAACGCTAAGCGAAGAAACCTGCCAGAAACTGCGCGAT
GCACTGCCAGAACATGTGGCAATATCTAACCCGCTCGATCTACGCGATGACGCCAGCAGT
GAGCACTATATTAAAACGCTGGATATTCTGCTCCACAGCCAGGATTTTGACGCGCTGATG
GTTATTCATTCGCCCAGCGCCGCTGCTCCCGCAACAGAAAGCGCGCAAGTATTAATTGAA
GCGGTAAAGCATCATCCCCGCAGCAAATATGTCTCTTTGCTGACGAACTGGTGCGGCGAG
CACTCCTCGCAAGAGGCACGACGTTTATTCAGCGAAGCCGGGCTGCCGACCTACCGTACC
CCGGAAGGAACCATCACTGCTTTTATGCATATGGTGGAGTACCGGCGTAATCAGAAGCAA
CTACGCGAAACGCCGGCGTTGCCCAGCAATCTGACTTCCAATACCGCAGAAGCGCATCTT
CTGTTGCAACAGGCGATTGCCGAAGGGGCTACGTCGCTCGATACCCATGAAGTTCAGCCC
ATCCTGCAAGCGTATGGCATGAACACGCTCCCTACCTGGATTGCCAGCGATAGCACCGAA
GCGGTGCATATTGCCGAACAGATTGGTTATCCGGTGGCGCTGAAATTGCGTTCGCCGGAT
ATTCCACATAAATCGGAAGTTCAGGGCGTCATGCTTTACCTGCGTACAGCCAATGAAGTC
CAGCAAGCGGCGAACGCTATTTTCGATCGCGTAAAAATGGCCTGGCCACAGGCGCGGGTC
CACGGCCTGTTGGTGCAAAGTATGGCTAACCGTGCTGGCGCTCAGGAGTTGCGGGTTGTG
GTTGAGCACGATCCGGTTTTCGGGCCGTTGATCATGCTGGGTGAAGGCGGTGTGGAGTGG
CGTCCTGAAGATCAAGCCGTCGTCGCACTGCCGCCGCTGAACATGAACCTGGCCCGCTAT
CTGGTTATTCAGGGGATCAAAAGTAAAAAGATTCGTGCGCGCAGTGCGCTACGCCCATTG
GATGTTGCAGGCTTGAGCCAGCTTCTGGTGCAGGTTTCCAACTTGATTGTCGATTGCCCG
GAAATTCAGCGTCTGGATATTCATCCTTTGCTGGCTTCTGGCAGTGAATTTACCGCGCTG
GATGTCACGCTGGATATCTCGCCGTTTGAAGGCGATAACGAGAGTCGGCTGGCAGTGCGC
CCTTATCCGCATCAGCTGGAAGAATGGGTAGAATTGAAAAACGGTGAACGCTGCTTGTTC
CGCCCGATTTTGCCAGAAGATGAGCCACAACTTCAGCAATTCATTTCGCGAGTCACCAAA
GAAGATCTTTATTACCGCTACTTTAGCGAGATCAACGAATTTACCCATGAAGATTTAGCC
AACATGACACAGATCGACTACGATCGGGAAATGGCGTTTGTAGCGGTACGACGTATTGAT
CAAACGGAAGAGATCCTCGGCGTCACGCGTGCGATTTCCGATCCTGATAACATCGATGCC
GAATTTGCTGTACTGGTTCGCTCGGATCTCAAAGGGTTAGGCTTAGGTCGACGCTTAATG
GAAAAGTTGATTACCTATACGCGAGATCACGGACTACAACGTCTGAATGGTATTACGATG
CCAAACAATCGTGGCATGGTGGCGCTAGCCCGCAAGCTCGGGTTTAACGTTGATATCCAG
CTCGAAGAGGGGATCGTTGGGCTTACGCTAAATCTTGCCCAGCGCGAGGAATCATGAGTA
AGGTACTGGAAATGTTGACCACTTAATCGGGACTGGTGTTATTATTGCCCGCTTATGTCG
TCTGCATTGCACAGAGGACCCTTCAATGAACAGAGAAGAAATGCACTGTGATGTTGTCAA
AATTTAAGCGTAATAAACATCAACAACACCTTGCCCAACTACCCAAGATTTCTCAATCAG
TTGATGATGTCGATTTCTTTTACGCTCCCGCCGACTTCCGGGAGACGCTGCTGGAAAAAA
TAGCCAGCGCGAAGCAGCGCATTTGCATTGTCGCCCTGTATCTCGAACAGGATGACGGTG
GCAAAGGCATTCTGAACGCGTTGTATGAGGCTAAAAGGCAGCGTCCGGAACTGGATGTGC
GGGTGCTGGTCGACTGGCATCGTGCACAACGTGGACGCATTGGCGCTGCGGCATCTAACA
CTAACGCTGACTGGTACTGCCGCATGGCGCAGGAAAATCCGGGCGTAGATGTTCCGGTTT
ATGGCGTTCCAATCAATACTCGTGAAGCCCTTGGTGTTCTGCACTTTAAAGGCTTTATCA
TCGACGATAGCGTACTTTATAGCGGTGCCAGCCTGAACGATGTTTACCTGCATCAGCACG
ATAAATATCGCTACGACCGTTATCATCTGATCCGTAACCGTAAGATGTCAGACATTATGT
TTGAATGGGTTACACAGAATATTATGAATGGCCGCGGCGTTAATCGTCTGGATGATGTTA
ATCGGCCAAAAAGCCCGGAAATCAAGAACGATATTCGTCTGTTCCGCCAGGAGCTGCGTG
ATGCCGCTTATCATTTCCAGGGCGATGCCGACAACGATCAGCTTTCTGTAACGCCGCTAG
TGGGGCTGGGGAAATCGAGTCTGTTGAACAAGACCATTTTCCATCTTATGCCTTGTGCCG
AGCAGAAACTAACCATCTGTACGCCATACTTCAACCTGCCAGCAATCCTTGTGCGCAATA
TTATCCAGTTGCTGCGCGAAGGGAAAAAGGTCGAAATTATTGTTGGTGATAAAACCGCGA
ATGACTTCTACATTCCGGAAGATGAACCTTTCAAGATAATTGGCGCATTGCCTTATCTCT
ATGAGATCAATCTGCGTCGTTTCCTGAGCCGTTTGCAGTATTACGTCAATACTGACCAGC
TAGTGGTTCGGTTATGGAAAGATGACGACAACACCTATCACCTGAAAGGGATGTGGGTTG
ATGATAAGTGGATGTTGATCACCGGTAATAACCTGAACCCGCGCGCCTGGCGTCTGGATC
TGGAAAACGCCATTTTGATCCACGATCCGCAACTTGAGCTGGCGCCACAGCGAGAGAAAG
AACTGGAGCTGATCCGCGAGCATACCACCATCGTTAAGCACTATCGCGATCTGCAAAGTA
TTGCCGATTATCCGGTGAAGGTTCGTAAACTCATCCGCCGTTTGCGCCGTATCCGCATCG
ACCGATTAATTAGCCGCATCCTGTAATCACAACCCCGTCCTGTACGGGGTTTGTTTTTTG
GAGGCCACGTTTTGCGTATTCTTTTTGTCTGTTCGCTATTGTTACTTTCTGGATGCAGCC
ATATGGCTAACGATAGCTGGAGCGGGCAGGATAAAGCTCAACACTTTATCGCCTCGGCGA
TGCTTTCCGCCGCCGGAAATGAATATTCACAGCATCAGGGGATGAGCCGGGATCGCAGTG
CCATGTTTGGATTGATGTTCTCTGTCAGTTTGGGGGCGTCAAAAGAGCTTTGGGATAGCC
GCCCCGAAGGGAGCGGCTGGAGCTGGAAGGATTTGGCCTGGGATGTCGCCGGTGCAAGCA
CCGGCTATACCGTCTGGCAACTGACCCGTCACTAAAGACGCATCCCCTTCCCTTTGCGAT
GTAGCATCAAAGAAACCAGAAACGCCACCACGGCCATCAAGGTCACATACCAGAAGAAGG
CTGTTTCCATTCCTATTGATTTCAGCGACAACGCTACGTACTCCGCCGAACCACCAAATA
TAGCATTAGCGACCGCATATGACAGACCAACGCCTAATGCGCGAACCTGTGCCGGGAACA
TCTCAGCCTTCAGTATTCCACTGATTGATGTATAAAAACTCACTATCAGCAGGGCACACA
TCACCAGACCAAAAGCGGCATAAGGCGAGGAAACGTTTTGCAATGCTGAGAGAATAGGAA
CGGTAAAAATGGCTGCCAGCGAACCGAAACATAACATTGAGGTACGGCGACCAATCTTAT
CCGACAGCGCGCCAATGAGTGGTTGAATAAGCATGAATACAAACAATGCGGCAGTCATAA
TGCCACTCGCCACGTTGGCATGCATTCCCGCAGTATTTACCAGATACTTCTGCATATAAG
TAGTGAAGGTATAGAAACAAAGGGAGCCCGCAGCGGTAAAACCGAGAACCATGATGAATG
CACGGCGATTGCGCCATAATCCTTTCAGAGATCCAGCTTCTTTTAAAGCGCGCGTTTCTT
GTTGCGAAGTTTCATCTAACTGACGACGTAACCACAACGCCACAACAGCTAACACAGCTC
CTAACGCGAAAGGAATACGCCATCCCCACTCTCTGAGTGCAGCGTCTTCCATGGTGTGTT
GTAAAACCACGACAACCAGTAGGGCTAGCAGTTGTCCGCCGATCAACGTCACATACTGAA
ATGATGCGTAAAAACCTTTGCGCCCTTCAACGGCAACTTCACTCATATAGGTGGCGCTGG
TGCCATATTCTCCGCCAACAGATAATCCCTGAAATAAACGAGCGAGAAGCAATAATGCCG
GAGCCCACGTACCTATAGTTTCATAACCTGGGAGGCAGGCGATAACCAGCGATCCGAAAC
ACATCATACACACCGATAACAGCATCGATTTTTTGCGACCATGTTTATCGGCTATGCGGC
CAAATAGCCAACCGCCTATTGGGCGCATCAGGAATCCCGCAGCAAAAACACCTGCTGTTT
GTAGTAGTTGAGTCGTCGTGTTCCCGGAAGGGAAGAAGATGTGGGCAAAGTAGAGTGAAC
AGAACGAGTAGACATAGAAATCGAACCACTCGACCAGATTACCTGAAGAGGCCCCCACAA
TCGCCCAAATGCGGCGACGAGTATCACTACTTGTCAGTTTGCTGTCTGCCGTTACAGTAC
TTTCAGCCATGCCATTATGTCTCCTGCCGTAATCCGATGCTTTTGTCGGTCGCTTTTGTT
TATTTTTTTTGTAAAGGAAATATTATACATTTGTTGCATATCATTATGCAACCTTAACCA
TGAATTTAGTTAGCAGGAAAATGGTTATTGAGGAGCTTAAGGATAAATTTCTGGTAAGGA
GGACACGTATGGAAGTGGGCAAGTTGGGGAAGCCGTATCCGTTGCTGAATCTGGCATATG
TGGGAGTATAAGACGCGCAGCGTCGCATCAGGCATTTTTTTCTGCGCCAATGCAAAAAGG
CCATCCGTCAGGATGGCCTTTCGCATAATTTGATGCCTGGCAGTTCCCTACTCTCGCATG
GGGAGACCCCACACTACCAT
>seq4
TGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCTACCT
CAATGTGTATCACAATATCCATATTCTTTGTGGGGGAGTCTGGAGATTGAGTAGATATTC
TTGTTCAGAATGTATCAGCCGATGGTTCTACGATTCTTAAGCCACGAAGAGTTCAGATAG
TACAACGGCATGTCTCTTTTGACTATCTGGCAACCGGCAGTGTGTTCTCTCACGCATCAC
AAAAGCAGCAGGCATAAAAAAACCCGCTTGCGCGGGCTTTTTCACAAAGCTTCAGCAAAT
TGGCGATTAAGCCAGTTTGTTGATCTGTGCAGTCAGGTTAGCCTTATGACGTGCAGCTTT
GTTTTTGTGGATCAGACCTTTAGCAGCCTGACGGTCCACGATCGGTTGCATTTCGTTAAA
TGCTTTCTGTGCAGCAGCTTTGTCGCCAGCTTCGATAGCTGCGTATACTTTCTTGATGAA
AGTACGCATCATAGAGCGACGGCTTGCGTTGTGCTTACGAGCCTTTTCAGACTGAATGGC
GCGCTTCTTAGCTGATTTGATATTAGCCAAGGTCCAACTCCCAAATGTGTTCTATATGGA
CAATTCAAAGGCCGAGGAATATGCCCTTTTAGCCTTCTTTTGTCAATGGATTTGTGCAAA
TAAGCGCCGTTAATGTGCCGGCACTCGTTACGTAGTGATGGCGCAGGATTCTACCAGCTT
GCGGGGTGTGAATACAGCTTTTCCGCGATAAAAATTGCAGCAGGCGGTCAGTTTCTTCCC
GTGATTTGCGCCATGGCAATGAAAAGCCACTTCTTTCTGATTTCGGTACTCAATCGCCGG
TTAACCTTGACCGCTGTACAAGGTATACTCGGACGATTTTCACTGTTTTGAGCCAGACAT
GAAGCTGATACGCGGCATACATAATCTCAGCCAGGCCCCGCAAGAAGGGTGTGTGCTGAC
TATTGGTAATTTCGACGGCGTGCATCGCGGTCATCGCGCGCTGTTACAGGGCTTGCAGGA
AGAAGGGCGCAAGCGCAACTTACCGGTGATGGTGATGCTTTTTGAACCTCAACCACTGGA
ACTGTTTGCTACCGATAAAGCCCCGGCAAGACTGACCCGGCTGCGGGAAAAACTGCGTTA
CCTTGCAGAGTGTGGCGTTGATTACGTGCTGTGCGTGCGTTTCGACAGGCGTTTCGCGGC
GTTAACCGCGCAAAATTTCATCAGCGATCTTCTGGTGAAGCATTTGCGCGTAAAATTTCT
TGCCGTAGGTGATGATTTCCGCTTTGGCGCTGGTCGTGAAGGCGATTTCTTGTTATTACA
GAAAGCTGGCATGGAATACGGCTTCGATATCACCAGTACGCAAACTTTTTGCGAAGGTGG
CGTGCGCATCAGCAGCACCGCCGTGCGTCAGGCCCTTGCGGATGACAATCTGGCTCTGGC
AGAGAGTTTACTGGGGCACCCGTTTGCCATCTCCGGGCGTGTAGTCCACGGTGATGAATT
AGGGCGCACTATAGGTTTCCCGACGGCGAATGTACCGCTGCGCCGTCAGGTTTCCCCGGT
GAAAGGGGTTTATGCGGTAGAAGTGCTGGGCCTCGGTGAAAAGCCGTTACCCGGCGTGGC
AAACATCGGAACACGCCCAACGGTTGCCGGTATTCGCCAGCAGCTGGAAGTGCATTTGTT
AGATGTTGCAATGGACCTTTACGGTCGCCATATACAAGTAGTGCTGCGTAAAAAAATACG
CAATGAGCAGCGATTTGCGTCGCTGGACGAACTGAAAGCGCAGATTGCGCGTGATGAATT
AACCGCCCGCGAATTTTTTGGGCTAACAAAACCGGCTTAAGCCTGTTATGTAATCAAACC
GAAATACGGAACCGAGAATCTGATGAGTGACTATAAATCAACCCTGAATTTGCCGGAAAC
AGGGTTCCCGATGCGTGGCGATCTCGCCAAGCGCGAACCCGGAATGCTGGCGCGTTGGAC
TGATGATGATCTGTACGGCATCATCCGTGCGGCTAAAAAAGGCAAAAAAACCTTCATTCT
GCATGATGGCCCTCCTTATGCGAATGGCAGCATTCATATTGGTCACTCGGTTAACAAGAT
TCTGAAAGACATTATCGTGAAGTCCAAAGGGCTTTCCGGTTATGACTCGCCGTATGTGCC
TGGCTGGGACTGCCACGGTCTGCCGATCGAGCTGAAAGTCGAGCAAGAATACGGTAAGCC
GGGTGAGAAATTCACCGCCGCCGAGTTCCGCGCCAAGTGCCGCGAATACGCGGCGACCCA
GGTTGACGGTCAACGCAAAGACTTTATCCGTCTGGGCGTGCTGGGCGACTGGTCGCACCC
GTACCTGACCATGGACTTCAAAACTGAAGCCAACATCATCCGCGCGCTGGGCAAAATCAT
CGGCAACGGTCACCTGCACAAAGGCGCGAAGCCAGTTCACTGGTGCGTTGACTGCCGTTC
TGCGCTGGCGGAAGCGGAAGTTGAGTATTACGACAAAACTTCTCCGTCCATCGACGTTGC
TTTCCAGGCAGTCGATCAGGATGCACTGAAAGCAAAATTTGCCGTAAGCAACGTTAACGG
CCCAATCTCGCTGGTAATCTGGACCACCACGCCGTGGACTCTGCCTGCCAACCGCGCAAT
CTCTATTGCACCAGATTTCGACTATGCGCTGGTGCAGATCGACGGTCAGGCCGTGATTCT
GGCGAAAGATCTGGTTGAAAGCGTAATGCAGCGTATCGGCGTGACCGATTACACCATTCT
CGGCACGGTAAAAGGTGCGGAGCTTGAGCTGCTGCGCTTTACCCATCCGTTTATGGGCTT
CGACGTTCCGGCAATCCTCGGCGATCACGTTACCCTGGATGCCGGTACCGGTGCCGTTCA
CACCGCGCCTGGCCACGGCCCGGACGACTATGTGATCGGTCAGAAATACGGCCTGGAAAC
CGCTAACCCGGTTGGCCCGGACGGCACTTATCTGCCGGGCACTTATCCGACGCTGGATGG
CGTGAACGTCTTCAAAGCGAACGACATCGTCGTTGCGCTGCTGCAGGAAAAAGGCGCGCT
GCTGCACGTTGAGAAAATGCAGCACAGCTATCCGTGCTGCTGGCGTCACAAAACGCCGAT
CATCTTCCGCGCGACGCCGCAGTGGTTCGTCAGCATGGATCAGAAAGGTCTGCGTGCGCA
GTCACTGAAAGAGATCAAAGGCGTGCAGTGGATCCCGGACTGGGGCCAGGCGCGTATCGA
GTCGATGGTTGCTAACCGTCCTGACTGGTGTATCTCCCGTCAGCGCACCTGGGGTGTACC
GATGTCACTGTTCGTGCACAAAGACACGGAAGAGCTGCATCCGCGTACCCTTGAACTGAT
GGAAGAAGTGGCAAAACGCGTTGAAGTCGATGGCATCCAGGCGTGGTGGGATCTCGATGC
GAAAGAGATCCTCGGCGACGAAGCTGATCAGTACGTGAAAGTGCCGGACACATTGGATGT
ATGGTTTGACTCCGGATCTACCCACTCTTCTGTTGTTGACGTGCGTCCGGAATTTGCCGG
TCACGCAGCGGACATGTATCTGGAAGGTTCTGACCAACACCGCGGCTGGTTCATGTCTTC
CCTAATGATCTCCACCGCGATGAAGGGTAAAGCGCCGTATCGTCAGGTACTGACCCACGG
CTTTACCGTGGATGGTCAGGGCCGCAAGATGTCTAAATCCATCGGCAATACCGTTTCGCC
GCAGGATGTGATGAACAAACTGGGCGCGGATATTCTGCGTCTGTGGGTGGCATCAACCGA
CTACACCGGTGAAATGGCCGTTTCTGACGAGATCCTGAAACGTGCTGCCGATAGCTATCG
TCGTATCCGTAACACCGCGCGCTTCCTGCTGGCAAACCTGAACGGTTTTGATCCAGCAAA
AGATATGGTGAAACCGGAAGAGATGGTGGTACTGGATCGCTGGGCCGTAGGTTGTGCGAA
AGCGGCACAGGAAGACATCCTCAAGGCGTACGAAGCATACGATTTCCACGAAGTGGTACA
GCGTCTGATGCGCTTCTGCTCCGTTGAGATGGGTTCCTTCTACCTCGACATCATCAAAGA
CCGTCAGTACACCGCCAAAGCGGACAGTGTGGCGCGTCGTAGCTGCCAGACTGCGCTATA
TCACATCGCAGAAGCGCTGGTGCGCTGGATGGCACCAATCCTCTCCTTCACCGCTGATGA
AGTGTGGGGCTACCTGCCGGGCGAACGTGAAAAATACGTCTTCACCGGTGAGTGGTACGA
AGGCCTGTTTGGCCTGGCAGACAGTGAAGCGATGAACGATGCGTTCTGGGACGAGCTGTT
GAAAGTGCGTGGCGAAGTGAACAAAGTCATTGAGCAAGCGCGTGCCGACAAGAAAGTGGG
TGGCTCGCTGGAAGCGGCAGTAACCTTGTATGCAGAACCGGAACTGTCGGCGAAACTGAC
CGCGCTGGGCGATGAATTACGATTTGTCCTGTTGACCTCCGGCGCTACCGTTGCAGACTA
TAACGACGCACCTGCTGATGCTCAGCAGAGCGAAGTACTCAAAGGGCTGAAAGTCGCGTT
GAGTAAAGCCGAAGGTGAGAAGTGCCCACGCTGCTGGCACTACACCCAGGATGTCGGCAA
GGTGGCGGAACACGCAGAAATCTGCGGCCGCTGTGTCAGCAACGTCGCCGGTGACGGTGA
AAAACGTAAGTTTGCCTGATGAGTCAATCGATCTGTTCAACAGGGCTACGCTGGCTGTGG
CTGGTGGTAGTCGTGCTGATTATCGATCTGGGCAGCAAATACCTGATCCTCCAGAACTTT
GCTCTGGGGGATACGGTCCCGCTGTTCCCGTCGCTTAATCTGCATTATGCGCGTAACTAT
GGCGCGGCGTTTAGTTTCCTTGCCGATAGCGGCGGCTGGCAGCGTTGGTTCTTTGCCGGT
ATTGCGATTGGTATTAGCGTGATCCTGGCAGTGATGATGTATCGCTCGAAGGCCACGCAG
AAGCTAAACAATATCGCTTACGCGCTGATTATTGGCGGCGCGCTGGGCAACCTGTTCGAC
CGCCTGTGGCACGGCTTCGTTGTCGATATGATCGACTTCTACGTCGGCGACTGGCACTTC
GCCACCTTCAACCTTGCCGATACTGCCATCTGTGTCGGTGCGGCACTGATTGTGCTGGAA
GGTTTTTTGCCTTCTAGAGCGAAAAAACAATAATAAACCCTGCCGGATGCGATGCTGACG
CATCTTATCCGGCCTACAGATTGCTGCGAAATCGTAGGCCGGATAAGGCGTTTACGCCGC
ATCCGGCAAAAATCCTTAAATATAAGAGCAAACCTGCATGTCTGAATCTGTACAGAGCAA
TAGCGCCGTCCTGGTGCACTTCACGCTAAAACTCGACGATGGCACCACCGCCGAGTCTAC
CCGCAACAACGGTAAACCGGCGCTGTTCCGCCTGGGTGATGCTTCTCTTTCTGAAGGGCT
GGAGCAACACCTGTTGGGGCTGAAAGTGGGCGATAAAACCACCTTCTCGTTGGAGCCAGA
TGCGGCGTTTGGCGTGCCGTCACCGGACCTGATTCAGTACTTCTCCCGCCGTGAATTTAT
GGATGCAGGCGAGCCAGAAATTGGCGCAATCATGCTTTTTACCGCAATGGATGGCAGTGA
GATGCCTGGCGTGATCCGCGAAATTAACGGCGACTCCATTACCGTTGATTTCAACCATCC
GCTGGCCGGGCAGACCGTTCATTTTGATATTGAAGTGCTGGAAATCGATCCGGCACTGGA
GGCGTAACATGCAGATCCTGTTGGCCAACCCGCGTGGTTTTTGTGCCGGGGTAGACCGCG
CTATCAGCATTGTTGAAAACGCGCTGGCCATTTACGGCGCACCGATATATGTCCGTCACG
AAGTGGTACATAACCGCTATGTGGTCGATAGCTTGCGTGAGCGTGGGGCTATCTTTATTG
AGCAGATTAGCGAAGTACCGGACGGCGCGATCCTGATTTTCTCCGCACACGGTGTTTCTC
AGGCGGTACGTAACGAAGCAAAAAGTCGCGATTTGACGGTGTTTGATGCCACCTGTCCGC
TGGTGACCAAAGTGCATATGGAAGTCGCCCGCGCCAGTCGCCGTGGCGAAGAATCTATTC
TCATCGGTCACGCCGGGCACCCGGAAGTGGAAGGGACAATGGGCCAGTACAGTAACCCGG
AAGGGGGAATGTATCTGGTCGAATCGCCGGACGATGTGTGGAAACTGACGGTCAAAAACG
AAGAGAAGCTCTCCTTTATGACCCAGACCACGCTGTCGGTGGATGACACGTCTGATGTGA
TCGACGCGCTGCGTAAACGCTTCCCGAAAATTGTCGGTCCGCGCAAAGATGACATCTGCT
ACGCCACGACTAACCGTCAGGAAGCGGTACGCGCCCTGGCAGAACAGGCGGAAGTTGTGT
TGGTGGTCGGTTCGAAAAACTCCTCCAACTCCAACCGTCTGGCGGAGCTGGCCCAGCGTA
TGGGCAAACGCGCGTTTTTGATTGACGATGCGAAAGACATCCAGGAAGAGTGGGTGAAAG
AGGTTAAATGCGTCGGCGTGACTGCGGGCGCATCGGCTCCGGATATTCTGGTGCAGAATG
TGGTGGCACGTTTGCAGCAGCTGGGCGGTGGTGAAGCCATTCCGCTGGAAGGCCGTGAAG
AAAACATTGTTTTCGAAGTGCCGAAAGAGCTGCGTGTCGATATTCGTGAAGTCGATTAAG
TCATTAGCAGCCTAAGTTATGCGAAAATGCCGGTCTTGTTACCGGCATTTTTTATGGAGA
AAACATGCGTTTACCTATCTTCCTCGATACTGACCCCGGCATTGACGATGCCGTCGCCAT
TGCCGCCGCGATTTTTGCACCCGAACTCGACCTGCAACTGATGACCACCGTCGCGGGTAA
TGTCTCGGTTGAGAAAACTACCCGCAATGCCCTGCAACTGCTGCATTTCTGGAATGCGGA
GATTCCGCTCGCCCAAGGGGCCGCTGTGCCACTGGTACGCGCACCGCGTGATGCGGCATC
TGTGCACGGCGAATCGGGAATGGCTGGCTACGACTTTGTTGAGCACAACCGAAAGCCGCT
CGGGATACCGGCGTTTCTGGCGATTCGGGATGCCCTGATGCGTGCACCAGAGCCTGTTAC
CCTGGTGGCCATCGGCCCGTTAACCAATATTGCGCTGTTACTTTCACAATGCCCGGAATG
CAAGCCGTATATTCGCCGTCTGGTGATCATGGGTGGTTCTGCCGGACGCGGCAACTGTAC
GCCAAACGCCGAGTTTAATATTGCTGCCGATCCAGAAGCTGCTGCCTGTGTCTTCCGCAG
TGGTATTGAAATCGTCATGTGCGGTTTGGATGTCACCAATCAGGCAATATTAACTCCTGA
CTATCTCTCTACACTGCCGCAGTTAAACCGTACCGGGAAAATGCTTCACGCCCTGTTTAG
CCACTACCGTAGCGGCAGTATGCAAAGCGGCTTGCGAATGCACGATCTCTGCGCCATCGC
CTGGCTGGTGCGCCCGGACCTGTTCACTCTCAAACCCTGTTTTGTGGCAGTGGAAACTCA
GGGCGAATTTACCTCAGGCACGACGGTGGTTGATATCGACGGTTGCCTGGGCAAGCCAGC
CAATGTACAGGTGGCATTGGATCTGGATGTGAAAGGCTTCCAGCAGTGGGTGGCTGAGGT
GCTGGCTCTGGCGTCGTAACCTGTCACATGTTATTGGCATGCAGTCATTCATCGACTCAT
GCCTTTCACTGATATCCCTCCCTGTTTATCATTAATTTCTAATTATCAGCGTTTTTGGCT
GGCGGCGTAGCGATGCGCTGGTTACTCTGAAAACGGTCTATGCAAATTAACAAAAGAGAA
TAGCTATGCATGATGCAAACATCCGCGTTGCCATCGCGGGAGCCGGGGGGCGTATGGGCC
GCCAGTTGATTCAGGCGGCGCTGGCATTAGAGGGCGTGCAGTTGGGCGCTGCGCTGGAGC
GTGAAGGATCTTCTTTACTGGGCAGCGACGCCGGTGAGCTGGCCGGAGCCGGGAAAACAG
GCGTTACCGTGCAAAGCAGCCTCGATGCGGTAAAAGATGATTTTGATGTGTTTATCGATT
TTACCCGTCCGGAAGGTACGCTGAACCATCTCGCTTTTTGTCGCCAGCATGGCAAAGGGA
TGGTGATCGGCACTACGGGGTTTGACGAAGCCGGTAAACAAGCAATTCGTGACGCCGCTG
CCGATATTGCGATTGTCTTTGCTGCCAATTTTAGCGTTGGCGTTAACGTCATGCTTAAGC
TGCTGGAGAAAGCAGCCAAAGTGATGGGTGACTACACCGATATCGAAATTATTGAAGCAC
ATCATAGACATAAAGTTGATGCGCCGTCAGGCACCGCACTGGCAATGGGAGAGGCGATCG
CCCACGCCCTTGATAAAGATCTGAAAGATTGCGCGGTCTACAGTCGTGAAGGCCACACCG
GTGAACGTGTGCCTGGCACCATTGGTTTTGCCACCGTGCGTGCAGGTGACATCGTTGGTG
AACATACCGCGATGTTTGCCGATATTGGCGAGCGTCTGGAGATCACCCATAAGGCGTCCA
GCCGTATGACATTTGCTAACGGCGCGGTAAGATCGGCTTTGTGGTTGAGTGGTAAGGAAA
GCGGTCTTTTTGATATGCGAGATGTACTTGATCTCAATAATTTGTAACCACAAAATATTT
GTTATGGTGCAAAAATAACACATTTAATTTATTGATTATAAAGGGCTTTAATTTTTGGCC
CTTTTATTTTTGGTGTTATGTTTTTAAATTGTCTATAAGTGCCAAAAATTACATGTTTTG
TCTTCTGTTTTTGTTGTTTTAATGTAAATTTTGACCATTTGGTCCACTTTTTTCTGCTCG
TTTTTATTTCATGCAATCTTCTTGCTGCGCAAGCGTTTTCCAGAACAGGTTAGATGATCT
TTTTGTCGCTTAATGCCTGTAAAACATGCATGAGCCACAAAATAATATAAAAAATCCCGC
CATTAAGTTGACTTTTAGCGCCCATATCTCCAGAATGCCGCCGTTTGCCAGAAATTCGTC
GGTAAGCAGATTTGCATTGATTTACGTCATCATTGTGAATTAATATGCAAATAAAGTGAG
TGAATATTCTCTGGAGGGTGTTTTGATTAAGTCAGCGCTATTGGTTCTGGAAGACGGAAC
CCAGTTTCACGGTCGGGCCATAGGGGCAACAGGTTCGGCGGTTGGGGAAGTCGTTTTCAA
TACTTCAATGACCGGTTATCAAGAAATCCTCACTGATCCTTCCTATTCTCGTCAAATCGT
TACTCTTACTTATCCCCATATTGGCAATGTCGGCACCAATGACGCCGATGAAGAATCTTC
TCAGGTACATGCACAAGGTCTGGTGATTCGCGACCTGCCGCTGATTGCCAGCAACTTCCG
TAATACCGAAGACCTCTCTTCTTACCTGAAACGCCATAACATCGTGGCGATTGCCGATAT
CGATACCCGTAAGCTGACGCGTTTACTGCGCGAGAAAGGCGCACAGAATGGCTGCATTAT
CGCGGGCGATAACCCGGATGCGGCGCTGGCGTTAGAAAAAGCCCGCGCGTTCCCAGGTCT
GAATGGCATGGATCTGGCAAAAGAAGTGACCACCGCAGAAGCCTATAGCTGGACACAAGG
GAGCTGGACGTTGACCGGTGGCCTGCCAGAAGCGAAAAAAGAAGACGAGCTGCCGTTCCA
CGTCGTGGCTTATGATTTTGGTGCCAAGCGCAACATCCTGCGGATGCTGGTGGATAGAGG
CTGTCGCCTGACCATCGTTCCGGCGCAAACTTCTGCGGAAGATGTGCTGAAAATGAATCC
AGACGGCATCTTCCTCTCCAACGGTCCTGGCGACCCGGCCCCGTGCGATTACGCCATTAC
CGCCATCCAGAAATTCCTCGAAACCGATATTCCGGTATTCGGCATCTGTCTCGGTCATCA
GCTGCTGGCGCTGGCGAGCGGTGCGAAGACTGTCAAAATGAAATTTGGTCACCACGGCGG
CAACCATCCGGTTAAAGATGTGGAGAAAAACGTGGTAATGATCACCGCCCAGAACCACGG
TTTTGCGGTGGACGAAGCAACATTACCTGCAAACCTGCGTGTCACGCATAAATCCCTGTT
CGACGGTACGTTACAGGGCATTCATCGCACCGATAAACCGGCATTCAGCTTCCAGGGGCA
CCCTGAAGCCAGCCCTGGTCCACACGACGCCGCGCCGTTGTTCGACCACTTTATCGAGTT
AATTGAGCAGTACCGTAAAACCGCTAAGTAATCAGGAGTAAAAGAGCCATGCCAAAACGT
ACAGATATAAAAAGTATCCTGATTCTGGGTGCGGGCCCGATTGTTATCGGTCAGGCGTGT
GAGTTTGACTACTCTGGCGCGCAAGCGTGTAAAGCCCTGCGTGAAGAGGGTTACCGCGTC
ATTCTGGTGAACTCCAACCCGGCGACCATCATGACCGACCCGGAAATGGCTGATGCAACC
TACATCGAGCCGATTCACTGGGAAGTTGTACGCAAGATTATTGAAAAAGAGCGCCCGGAC
GCGGTGCTGCCAACGATGGGCGGTCAGACGGCGCTGAACTGCGCGCTGGAGCTGGAACGT
CAGGGCGTGTTGGAAGAGTTCGGTGTCACCATGATTGGTGCCACTGCCGATGCGATTGAT
AAAGCAGAAGACCGCCGTCGTTTCGACGTAGCGATGAAGAAAATTGGTCTGGAAACCGCG
CGTTCCGGTATCGCACACACGATGGAAGAAGCGCTGGCGGTTGCCGCTGACGTGGGCTTC
CCGTGCATTATTCGCCCATCCTTTACCATGGGCGGTAGCGGCGGCGGTATCGCTTATAAC
CGTGAAGAGTTTGAAGAAATTTGCGCCCGCGGTCTGGATCTCTCTCCGACCAAAGAGTTG
CTGATTGATGAGTCGCTGATCGGCTGGAAAGAGTACGAGATGGAAGTGGTGCGTGATAAA
AACGACAACTGCATCATCGTCTGCTCTATCGAAAACTTCGATGCGATGGGCATCCACACC
GGTGACTCCATCACTGTCGCGCCAGCCCAAACGCTGACCGACAAAGAATATCAAATCATG
CGTAACGCCTCGATGGCGGTGCTGCGTGAAATCGGCGTTGAAACCGGTGGTTCCAACGTT
CAGTTTGCGGTGAACCCGAAAAACGGTCGTCTGATTGTTATCGAAATGAACCCACGCGTG
TCCCGTTCTTCGGCGCTGGCGTCGAAAGCGACCGGTTTCCCGATTGCTAAAGTGGCGGCG
AAACTGGCGGTGGGTTACACCCTCGACGAACTGATGAACGACATCACTGGCGGACGTACT
CCGGCCTCCTTCGAGCCGTCCATCGACTATGTGGTTACTAAAATTCCTCGCTTCAACTTC
GAAAAATTCGCCGGTGCTAACGACCGTCTGACCACTCAGATGAAATCGGTTGGCGAAGTG
ATGGCGATTGGTCGCACGCAGCAGGAATCCCTGCAAAAAGCGCTGCGCGGCCTGGAAGTC
GGTGCGACTGGATTCGACCCGAAAGTGAGCCTGGATGACCCGGAAGCGTTAACCAAAATC
CGTCGCGAACTGAAAGACGCAGGCGCAGATCGTATCTGGTACATCGCCGATGCGTTCCGT
GCGGGCCTGTCTGTGGACGGCGTCTTCAACCTGACCAACATTGACCGCTGGTTCCTGGTA
CAGATTGAAGAGCTGGTGCGTCTGGAAGAGAAAGTGGCGGAAGTGGGCATCACTGGCCTG
AACGCTGACTTCCTGCGCCAGCTGAAACGCAAAGGCTTTGCCGATGCGCGCTTGGCAAAA
CTGGCGGGCGTACGCGAAGCGGAAATCCGTAAGCTGCGTGACCAGTATGACCTGCACCCG
GTTTATAAGCGCGTGGATACCTGTGCGGCAGAGTTCGCCACCGACACCGCTTACATGTAC
TCCACTTATGAAGAAGAGTGCGAAGCGAATCCGTCTACCGACCGTGAAAAAATCATGGTG
CTTGGCGGCGGCCCGAACCGTATCGGTCAGGGTATCGAATTCGACTACTGTTGCGTACAC
GCCTCGCTGGCGCTGCGCGAAGACGGTTACGAAACCATTATGGTTAACTGTAACCCGGAA
ACCGTCTCCACCGACTACGACACTTCCGACCGCCTCTACTTCGAGCCGGTAACTCTGGAA
GATGTGCTGGAAATCGTGCGTATCGAGAAGCCGAAAGGCGTTATCGTCCAGTACGGCGGT
CAGACCCCGCTGAAACTGGCGCGCGCGCTGGAAGCTGCTGGCGTACCGGTTATCGGCACC
AGCCCGGATGCTATCGACCGTGCAGAAGACCGTGAACGCTTCCAGCATGCGGTTGAGCGT
CTGAAACTGAAACAACCGGCGAACGCCACCGTTACCGCTATTGAAATGGCGGTAGAGAAG
GCGAAAGAGATTGGCTACCCGCTGGTGGTACGTCCGTCTTACGTTCTCGGCGGTCGGGCG
ATGGAAATCGTCTATGACGAAGCTGACCTGCGTCGCTACTTCCAGACGGCGGTCAGCGTG
TCTAACGATGCGCCAGTGTTGCTGGACCACTTCCTCGATGACGCGGTAGAAGTTGACGTG
GATGCCATCTGCGACGGCGAAATGGTGCTGATTGGCGGCATCATGGAGCATATTGAGCAG
GCGGGCGTGCACTCCGGTGACTCCGCATGTTCTCTGCCAGCCTACACCTTAAGTCAGGAA
ATTCAGGATGTGATGCGCCAGCAGGTGCAGAAACTGGCCTTCGAATTGCAGGTGCGCGGC
CTGATGAACGTGCAGTTTGCGGTGAAAAACAACGAAGTCTACCTGATTGAAGTTAACCCG
CGTGCGGCGCGTACCGTTCCGTTCGTCTCCAAAGCCACCGGCGTACCGCTGGCAAAAGTG
GCGGCGCGCGTGATGGCTGGCAAATCGCTGGCTGAGCAGGGCGTAACCAAAGAAGTTATC
CCGCCGTACTACTCGGTGAAAGAAGTGGTGCTGCCGTTCAATAAATTCCCGGGCGTTGAC
CCGCTGTTAGGGCCAGAAATGCGCTCTACCGGGGAAGTCATGGGCGTGGGCCGCACCTTC
GCTGAAGCGTTTGCCAAAGCGCAGCTGGGCAGCAACTCCACCATGAAGAAACACGGTCGT
GCGCTGCTTTCCGTGCGCGAAGGCGATAAAGAACGCGTGGTGGACCTGGCGGCAAAACTG
CTGAAACAGGGCTTCGAGCTGGATGCGACCCACGGCACGGCGATTGTGCTGGGCGAAGCA
GGTATCAACCCGCGTCTGGTAAACAAGGTGCATGAAGGCCGTCCGCACATTCAGGACCGT
ATCAAGAATGGCGAATATACCTACATCATCAACACCACCTCAGGCCGTCGTGCGATTGAA
GACTCCCGCGTGATTCGTCGCAGTGCGCTGCAATATAAAGTGCATTACGACACCACCCTG
AACGGCGGCTTTGCCACCGCGATGGCGCTGAATGCCGATGCGACTGAAAAAGTAATTTCG
GTGCAGGAAATGCACGCACAGATCAAATAATAGCGTGTCATGGCAGATATTTTTCATCCG
CTAATTTGATCGAATAACTAATACGGTTCTCTGATGAGGACCGTTTTTTTTTGCCCATTA
AGTAAATCTTTTGGGGAATCGATATTTTTGATGACATAAGCAGGATTTAGCTCACACTTA
TCGACGGTGAAGTTGCATACTATCGATATATCCACAATTTTAATATGGCCTTGTTTAATT
GCTTCAAAACGAGTCATAGCCAGACTTTTAATTTGTGAAACTGGAGTTCGTATGTGTGAA
GGATATGTTGAAAAACCACTCTACTTGTTAATCGCCGAATGGATGATGGCTGAAAATCGG
TGGGTGATAGCAAGAGAGATCTCTATTCATTTCGATATTGAACACAGCAAGGCGGTTAAT
ACCCTGACTTATATTCTGTCGGAAGTCACAGAAATAAGCTGCGAAGTTAAGATGATCCCT
AATAAGCTGGAAGGGCGGGGATGCCAGTGTCAGCGACTGGTTAAAGTGGTCGATATCGAT
GAGCAAATTTACGCGCGCCTGCGCAATAACAGTCGGGAAAAATTAGTCGGTGTAAGAAAG
ACGCCGCGTATTCCTGCCGTTCCGCTCACGGAACTTAACCGCGAGCAGAAGTGGCAGATG
ATGTTGTCAAAGAGTATGCGTCGTTAATTTTATCTCGTTGATACCGGGCGTCCTGCTTGC
CAGATGCGATGTTGTAGCATCTTATCCAGCAACCAGGTCGCATCCGGCAAGATCACCGTT
TAGGCGTCACATCCGTCGTCCCCTGCAAACGGGGGCGATTTTCCTCCATTTGCCTCAGTG
GCTGCGTTTCATGTAACGATACATGACAGCGCCCGACAAGATCCTGATACTCTTTGGTAT
TCAACCGTTTCCAGTGTAACTCGTCGTCACTAACATTGCGTACAGCGCGGGCTGGCGTAC
CCATCAACAACTGGCGTTTCTCGCCGCGAAAGCCCGCTTTGACAAAGCTCATGGCGGCAA
CAATGCTCTCTTCGCCAATGACCGCGCCATCCATAATCACGCTGTTCATCCCGACCAATG
CATCGCGACCAATCAAACAACCATGCAGGATCGCTCCGTGCCCGATATGGCCGTTTTCCC
CAACGATAGTGTCAGTGTCGCAGTAGCCATGCATAATGCAGCCATCCTGAATATTGGCTC
CCGCTTGCACGATCAACCGCCCGTAGTCACCACGCAGTGAGGCGAGTGGGCCGATGTAGA
CACCGGCTCCCACAATCACATCGCCAATCAAGACGGCACTGGGATGGACAAACGCCGTCG
GGTGAACCACCGGAATTAACCCCTCAAAGGCGTAATAGCTCACGGTTGTTAACGTCCTTT
CCACACCGGATCGCGCTTCTCGGCAAACGCCAGCGGCCCTTCAATGGCATCTTCCGAATG
CAGAACCGATGGATAGTGTTTCAACACGCCGCTGCGAATATAGCGATACGCTTCTTCTAC
CGGCATTTCGCTGGTGGTGCGGTAGATCTCTTTCAGCGCCGCAATCGCCAGCGGGGCGCT
GTTAACCAGCTGCTGAGCCAGTTCGCGGGCGTTATCCATCAGTTCCGCCTGGCTAACCAC
GCGGTTGACTATCCCCCAACGCAGCGCCTCTTCTGCGCCCATTCGTCTGCCGGTCATCAC
CATTTCATTGACGATGGCAGGCGGCAGGATCTTCGGCAGACGCAGCACACCGCCGCTGTC
AGGAACGATGCCCAGTTTGGCTTCCGGCAGGGCGAAGCTGGCGTTATCGGCACAAACAAT
AAAATCTGCCGCCAGCGCCAGTTCAAAGCCGCCGCCAAAGGCATAGCCGTTCACAGCTGC
GATAACCGGTTTGTCGAGATTGAAAATTTCGGTTAATCCCGCAAAACCACCCGGACCAAA
GTCAGCATCCGGTGCTTCGCCTTCTGCTGCCGCTTTTAAATCCCAGCCCGCGGAAAAGAA
CTTCTCTCCGGCACCGGTAATAATGGCGACACGTAATTGCGGATCGTCACGGAAATTTAG
AAATACTTCGCCCATTTCAAAGCTGGTTTTTGCATCAATAGCATTCGCTTTTGGACGATC
AAGGGTAATTTCCAGAATTGATCCATTGCGGGTCAGATGTAATGATTCACTCATTCCTTT
TCTCCATTTTTGCTTTTTCAGGGACGACAACATCCCTGCAAAAAATGCATATTGTTTTAG
AGTGTGATTATTAGCTGGCAGGGTAGTTCCCTGCTGTTTCATTTATTTCAGATTCTTTCT
AATTATTTTCCCCGAGCAATTACGTGGCAGATCTTTTCTGATCTCCAGATAAGAGGGCAC
TTTAAATTTCGCCATATTTTGTTCGCAGAAGCGGAAAAATTCCTCTTCGCTCAATGTTTC
ACCTTCATTCAGCACCACAAATGCTTTGATGGCTTCATCGCGAATCGAATCTTTAATACC
CACAACCACGATGTCCTGAATTTTCGGGTGCGCGGCGATAATATTTTCCAGCTCCACGCA
GGAGACATTCTCGCCGCCACGTTTAATCATATTGCAGCGGCGATCGACGAAATAAAAAAA
GTCCTCTTCGTCGCGGTATCCGGTATCGCCGGTATGCAGCCAGCCATCGGCTTCCAGCAC
TTTCGCAGTGGCTTGTGGGTTGAGAAAGTACTCTTTGAAGATGGTTTTCCCAGGTATGCC
TTTAATGCAGATTTCACCGATCTCACCAGCCGGGAGCGGGCGATTGTGATCGTCGCGGAT
CTCCGCTTCGTAGCAAAACCCCACCCGACCAATCGACGGCCAGCGTCGTTTATCGCCAGG
ACGATCGCCGATAATGCCCACAATGGTTTCCGTCATCCCATAAGACGTCAGCAAGCGAAC
GCCGAAGCGTTCACAAAACGCATCTTTTTCCTGCTCCGACAAGTTGAGATAAAACATCAC
TTCCCGCAGGCGGTGTTGCTGATCGTTCGCTGAAGGCGGCTGTACCATCAACGTACGGAT
CATCATCGGAATACATTCGGTAACGGTGGCGCGGTACTTCTGTACCTGTCCCCAGAAGGC
GCGGGCGCTGTATTTCTCGACCAGCACAAAGGTGGCCCCGGCAGAAAACGCCGCCATCGC
CGCAGTACACTGGCAATCGATATGAAACGCAGGCATTACCGTCAGGTAGACGTCATCGTC
ACGCAGTGCACACTGCCAGGCGGAGTAATATCCAGCGAAGCGCAGGTTGTAATGGGTAAT
CACCACACCTTTCGGTCGGGAGGTGGTGCCGGAGGTGAAGAGAATTTCCGCCGTATCGTC
AGTCGATAGCGGCGGTGCATAGCACAAGGTGGCAGGTTGTTGATTTTTCAGTTGAGTAAA
CGAACTCACGCCATCATCAGCGGGAAGTGCCACATCTGTCAGGCAAATGTGCCGCAATTG
AGTGGCATCTTCCTGCTGAATCTGTTGATACATAGGATAGAATTGCGCACTGGTCACCAG
CAGGCACGCCTGGCTATTTTGCAGGATCCACGCGCTTTCCTCGCACAACAGGCGGGCGTT
AATCGGCACCATAATCGCGCCAATTTTTGCCAGCCCGAACCAGCAAAAGATAAATTCCGG
GCAGTTGTCGAGATGTAGTGCAACCTTGTCGCCTTTGCGAATCCCCAGCGTATAAAACAG
GTTTGCCGTGCGGTTAATCTCCTGATTTAACTCAAGATAACTATACCGGTTAACGACTCC
GCCGCTGGATTCACAAATCAGCGCCGTTTTATGACCGTAAACGTCCGCAAGATCGTCCCA
CATTTGACGTAGATGTTGTCCGCCAATGATATCCATTGCACCTCTATCCATTTTTGTTCG
TTTGTTATTGGGCGGGCGCTAGTCAGGCAAGCCGACTGACGCCACGCGTTTAGTCCTCAA
CTTTGGCCAGACCTTTGCTGACCAACTCCTGAATGTCGTTTTCGCTGTAGCCGATATTTT
TCAAAATGGCAGCCGTGTCCATGCCATGTGAGGGCATTCCGCGCCAGATTTGTCCGGGGT
TATTTTTGAATTTCGGCATGATGTTCGGCCCTTTGCAGGTGCGACCATCCATCGTTTGCC
ACTGAGTGATTGATTCGCGAGCCACATACTGTGGATTGCTTTCCAGTTCCGGTACGGTCA
GCACTTTGGCGCAGGCGATATTCAGTTCAGCAAAGCGTTCTTTTACTTCCGCGATGGTAT
GTGTCGCCAGCCAGGCATCGAGTTTCTCTTCAACCAGTGGGCCGTAAGGGCATTCGATAC
GGTGGATAAGCTGAGTGCCTTCCGGGATTTCTGGCGTGCCAAGCAGATGTGCGAGGCCAA
TATCTTTAAAGCACTCTTCAATTTGGGTAATGCCCACCAGTTCCATCACGATGTAGCCGT
CGGCACATTTATACAGACCGCAACCGGCGTAGTAGGGATCTTTACCTTTGCTCATGCGCG
GGCACATTTCGCCGCCGTTGAAGTAATCCATCATGAAGTACTGGCCCATACGCAGCATCA
CTTCATACATGGCGATGTCGATACTTTCGCCTTTACCGGTTTCACGCACTTTATGCAGTG
CTGCCAGCGCCGCCGTGGTGGCGGTCAGGCCAGAAAAGTAATCGGCGGTATACGGGAAGG
CAGGCATTGGCTGGTCAACATCACCGTTCTGAATCAGGTAACCACTAAAGGCCTGGGCGA
TAGTGTTATAGGCCGGAAGATTGGTGTACTCCTCGGTGCCGTACTGACCAAAACCGGACA
GGTGAGCGATAACCAGTTTCGGGTTGTGCTGCCACAGTACTTCATCGGTAATGCCACGAC
GGGCAAAGGCCGGACCTTTACTGGCTTCGATGAAGATATCGGTGGTTTCCATTAATTTCA
GAAACGCTTCGCGGCCTTCATCTTTGAAAATATTTAACGACAGCGCGTGCAAATTGCGGC
GGGAGAGTTGCGGGTAGTTCGGTTGAACGCGAATGGTGTCGGCCCAGGCGACGTTCTCGA
TCCAGATAACTTCCGCGCCCCATTCTGCGAACATTTGCCCGGCAAACGGTCCGGCGATTT
CGATACCGGAGAAGACAACGCGCAATCCGGCCAACGGCCCGAATTTCGGCATGGGTAGAT
GATCCATTATTTGCTCCTGAAAAATTTATGTAGCGCATGACTGCCGGATGCGGCGTAAAC
GCTTTATCCGGCCTACATTCGTGCTCCCGTAGGCCTGATAAGACGCATCAGCGTCGCATC
AGGCAGCGCACGGACTTAGCGGTATTGCTTCAGCACCGCACGACCCAGCGTCAGGATCTG
CATTTCGTCAGATCCCCCGGAGACGCGGTCTACACGCAGATCACGCCAGAAGCGGCTGAT
GCGGTGGTTGCCCGCAATCCCGACACCGCCCAGCACCTGCATTGCGCTATCCACAACTTC
AAATGCCGCATTGGCGCAGAAGTATTTGCACATCGCTGCATCGCCAGAGGTGATGGTGCC
GTTGTCTGCTTTCCACGCTGCTTCATACAGCATGTTTTTCATGGAGTTTAATTTGATCGC
CATGTGGGCGAATTTTTCCTGAATCAACTGGAAACGACCAATAGCCTCGCCAAACTGCAC
GCGCTGATTGGCGTAGCGCGCCGCATCTTCAAAGGCGCACATCGCCGTACCGTAGTTGGT
GAGGGCTACCAGGAAACGTTCATGGTCGAACTCTTCTTTGACGCGGTTAAAGCCGTTACC
TTCCCGACCGAACATGTCTTTCTCGTCCAGTTCCACGTCGTCAAAGGTGATTTCACAGCA
GCTATCCATACGCAGACCGAGCTTTTCAAGTTTGGTCACTTTGATGCCCGGTTTGCTCAT
ATCAACAAACCATTCGGTGTAGACAGGTTTGTCCGGAGAAGCCCCGTCGCGCGCCATCAC
CACGATGTACGGGGTGTAGGCGCTGCTGGTAATAAAACACTTACTACCATTAAGATAAAT
CTTACCATTTCTACGGGTATAAGTCGTTTTCAGGCTACCCACGTCGGAGCCCGCGCCCGG
TTCGGTAATCGCTGAGTTCCACATCTGCTTACCGGTGCCGCGGAAAGCCATAATTTTGTC
GATCTGCTCTTGTGTGCCTTCGCGCAGGAAGGTGTTGAACCCGCCCGGCAACTGGTACAG
CACATAGGTTGGTGCCCCCAGACGTCCCAGCTCCATCCACACGGCGGCGAGAGTAACAAA
CCCCGCGTCCAGACCACCGTGCTCTTCAGGGATCAGCAGACTGTCGATACCCATATCCGC
CAGTGCTTTGACAAAACGTTCCGGGTAGACGCTGTCACGGTCGCACTCGGCAAAATAGGC
CTCCCAGTTTTCGCTGGCCATCAGTTCGCGGATACCGGCGACAAACAGTTCCTGCTCATC
ATTTAAATTAAAATCCATCTTTCAACCTCTTGATATTTTGGGGGTTAATTAATCTTTCCA
GTTCTGTTTCGCGTCTTTAATAAAGGAGAGCGTCACCATAATGTTGACGAAGAACAGCGG
GCATCCTCCGGCGATAATGGCGGTTTGAATCGGTTTCAGGCCGCCGAGCGCCAGCAGAAC
AATACCGATAATGCCAACCAGAATTGACCAACCGATACGCACCAGCAGAGGTGGTTCTTC
ACCATCGCGTACTTCGCGGCAAGTGGACATCGCCAGGGTATAAGAGCAGGCGTTAACCAG
CGTAACGGTGGCAATAAAGCAGAGGATGAAGAAGCCCCACATGGTGGCGGTGCTGAGTGG
CAGAGCGGCCCAGGTTTCAATGATGGCGCGCGCCACACCGTACTGTTCGATCAGATTTGG
AATGTTGATGATGTTTTTATCTATCAACAGCAGAGTGTTACTACCGAGTACAGTCCACAG
GATCCAGGTTGACGCTGTCAGCCCCAGCACCATGCCGAAGCACAGTTCACGCACAGTACG
ACCACGGGAGATGCGGGCGAGGAAGATACTCATCTGGATAGCATAAATCACCCACCATGC
CCAGTAGAACACGGTCCAGCCCTGCGGGAAGCCGCCTTTAGCGATGGGATCGGTATAGAA
CAACATGCGCGGCAGATACATCAGCAACATCCCCACCGAATCGGTGAAGTAGTTCATGAT
GAAGCTGGCACCGCTGACAATGAACACCCAACCCAGCATCAGGAAGCTCAGGTAACTACG
CACGTCACTGGCGATACGTACCCCTTTTTGCAGACCGCAAGCGACGCAAATGGCGTTGAG
GATAATCCAGCAGGTAATGATGATAGCGTCCAGTTGCAGGGTATGCGGAATGCCAAACAA
CCATTGCATACACTCGGTCACCAGCGGCGTGGCAAGGCCCAGACTGGTACCCATCGCGAA
GATCAAGGCGACGAGATAGAAGTTGTCGACGATAGTGCCGAACAACCCTTTGGCGTGTTT
TTCACCTACCAGCGGCACCAGTGTCGAGCTGGGGCGAATCACTTCCATTTTGCGGACAAA
GAAGAAGTAAGCGAAGGCGACTGAAAGGAAGCTGTAAGTGGCCCACGGCAGAGGTCCCCA
GTGGAACAAGCTGTAAGCCAGCCCCAACTCTTTCGCCCCTGTCGAGTTCGGTTCTAAGCC
AAACGGCGGGGTGGAGATGTAGTAGTAGATCTCAATCGATCCCCAGAACAGTACGGCAGC
AGACGTACAGGAGGCGAACATCATAAAGATCCAACTGGCGGTGCTAAATTCTGGCGGTTC
GTTACCTAAACGCTTTTTGGCATACGGGCCAAACACCAGCCAGAACCAACCGAAAAGCAT
CACCACCATATACCATTCAAATGCCCATCCCCATACATTGGTGACGTAACTGAATACAGC
ATTAATAACGACATTCGCTGCATCCAGATCTCTGACTGTAAGCCAACAAAGTATGCCGAC
GATTATTAACGGCGGAAAGAAAACCTTCGGTTCTATTCCCGTTTTTCTCTTTTCATTCTT
CATGAGTTAATTCCACTGTGAAAACGAATATTTATTTTGCGTTCCCGTTTGTTTTATTTT
TGTTAACATTTAATATAATTATTATTAACCTCGTGGACGCGTTAATGGCTAACTCATAAT
GGGTATTCAATAAGCTGTATTCTGTGATTGGTATCACATTTTTGTTTCGGGTGAATAGAG
GGCGTTTTTTCGTTAATTTTGATTAATAATCAGTTTGTTATGCTCTGTTGTGAGTAAAAA
ATAACATCTGACTTTCAATATTGGTGATCCATAAAACAATATTGAAAATTTCTTTTTGCT
ACGCCGTGTTTTCAATATTGGTGAGGAACTTAACAATATTGAAAGTTGGATTTATCTGCG
TGTGACATTTTCAATATTGGTGATTAAAGTTTTATTTCAAAATTAAAGGGCGTGATATCT
GTAATTAACACCACCGATATGAACGACGTTTCCTTCATGATTTCTGGAGATGCAATGAAG
ATTATTACTTGCTATAAGTGCGTGCCTGATGAACAGGATATTGCGGTCAATAATGCTGAT
GGTTCATTAGACTTCAGCAAAGCCGATGCCAAAATAAGCCAATACGATCTCAACGCTATT
GAAGCGGCTTGCCAGCTAAAGCAACAGGCAGCAGAGGCGCAGGTGACAGCCTTAAGTGTG
GGCGGTAAAGCCCTGACCAACGCCAAAGGGCGTAAAGATGTGCTATCGCGCGGCCCGGAT
GAACTGATTGTGGTGATTGATGACCAGTTCGAGCAGGCACTGCCGCAACAAACGGCGAGC
GCACTGGCTGCAGCCGCCCAGAAAGCAGGCTTTGATCTGATCCTCTGTGGCGATGGTTCT
TCCGACCTTTATGCCCAGCAGGTTGGTCTGCTGGTGGGCGAAATCCTCAATATTCCGGCA
GTTAACGGCGTCAGCAAAATTATCTCCCTGACGGCAGATACCCTCACCGTTGAGCGCGAA
CTGGAAGATGAAACCGAAACCTTAAGCATTCCGCTGCCTGCGGTTGTTGCTGTTTCCACT
GATATCAACTCCCCACAAATTCCTTCGATGAAAGCCATTCTCGGCGCGGCGAAAAAGCCC
GTCCAGGTATGGTCGGCGGCGGATATTGGTTTTAACGCAGAGGCAGCCTGGTCAGAACAA
CAGGTTGCCGCGCCGAAACAGCGCGAACGTCAGCGCATCGTGATTGAAGGCGACGGCGAA
GAACAGATCGCCGCATTTGCTGAAAATCTTCGCAAAGTCATTTAATTACAGGGGATGCTA
TGAACACGTTTTCTCAAGTCTGGGTATTCAGCGATACCCCTTCTCGTCTGCCGGAACTGA
TGAACGGTGCGCAGGCTTTAGCTAATCAAATCAACACCTTTGTCCTCAATGATGCCGACG
GCGCACAGGCAATCCAGCTCGGCGCTAATCATGTCTGGAAATTAAACGGCAAACCGGACG
ATCGGATGATCGAAGATTACGCCGGTGTCATGGCTGACACTATTCGCCAGCACGGCGCAG
ACGGCCTGGTGCTGCTGCCAAACACCCGTCGCGGCAAATTACTGGCGGCAAAACTGGGTT
ATCGCCTTAAAGCGGCGGTGTCTAACGATGCCAGCACCGTCAGCGTACAGGACGGTAAAG
CGACAGTGAAACACATGGTTTACGGTGGTCTGGCGATTGGCGAAGAACGCATTGCCACGC
CGTATGCGGTACTGACCATCAGCAGCGGCACGTTCGATGCGGCTCAGCCAGACGCGTCAC
GCACTGGCGAAACGCACACCGTGGAGTGGCAGGCTCCGGCTGTGGCGATTACCCGCACGG
CAACCCAGGCGCGCCAGAGCAACAGCGTCGATCTCGACAAAGCCCGTCTGGTGGTCAGCG
TCGGTCGCGGTATTGGCAGCAAAGAGAACATTGCGCTGGCAGAACAGCTTTGCAAGGCGA
TAGGTGCGGAGTTGGCCTGTTCTCGTCCGGTGGCGGAAAACGAAAAATGGATGGAGCACG
AACGCTATGTCGGTATCTCCAACCTGATGCTGAAACCTGAACTGTACCTGGCGGTGGGGA
TCTCCGGGCAGATCCAGCACATGGTTGGCGCTAACGCGTCGCAAACCATTTTCGCCATCA
ATAAAGATAAAAATGCGCCGATCTTCCAGTACGCGGATTACGGCATTGTTGGCGACGCCG
TGAAGATCCTTCCGGCGCTGACCGCAGCTTTAGCGCGTTGATCCACTCTGGCAGGGCTGC
ATTTTGGCCCTGCCGCTGACAGGGAGCTCTTATGTCCGAAGATATCTTTGACGCCATCAT
CGTCGGTGCAGGGCTTGCCGGTTCGGTTGCCGCACTGGTGCTCGCCCGCGAAGGTGCGCA
AGTGTTAGTTATCGAGCGTGGCAATTCCGCAGGTGCCAAGAACGTCACCGGCGGGCGTCT
CTATGCCCACAGTCTGGAACACATTATTCCTGGTTTCGCCGACTCCGCCCCCGTAGAACG
CCTGATCACCCATGAAAAACTCGCGTTTATGACGGAAAAGTCAGCGATGACTATGGACTA
CTGCAATGGTGACGAAACCTCGCCATCCCAGCGTTCTTACTCCGTTTTGCGCAGTAAATT
TGATGCCTGGCTGATGGAGCAGGCCGAAGAAGCGGGCGCGCAGTTAATTACCGGGATCCG
CGTCGATAACCTCGTACAGCGCGATGGCAAAGTCGTCGGTGTAGAAGCCGATGGCGATGT
GATTGAAGCGAAAACGGTGATCCTTGCTGATGGGGTGAACTCCATCCTTGCCGAAAAATT
GGGGATGGCAAAACGCGTCAAACCGACGGATGTGGCGGTTGGCGTGAAGGAACTGATCGA
GTTACCGAAGTCGGTTATTGAAGACCGTTTTCAGTTGCAGGGTAATCAGGGGGCGGCTTG
CCTGTTTGCGGGATCACCCACCGATGGCCTGATGGGCGGCGGCTTCCTTTATACCAATGA
AAACACCCTGTCGCTGGGGCTGGTTTGTGGTTTGCATCATCTGCATGACGCGAAAAAATC
GGTGCCGCAAATGCTGGAAGATTTCAAACAGCATCCGGCCGTTGCACCGCTGATCGCGGG
CGGCAAGCTGGTGGAATATTCCGCTCACGTAGTGCCGGAAGCAGGCATCAACATGCTGCC
GGAGTTGGTTGGTGACGGCGTATTGATTGCCGGTGATGCCGCCGGAATGTGTATGAACCT
CGGTTTTACCATTCGCGGTATGGATCTGGCGATTGCCGCCGGGGAAGCCGCAGCAAAAAC
CGTGCTTTCAGCGATGAAAAGCGACGATTTCAGTAAGCAAAAACTGGCGGAATATCGTCA
GCATCTTGAGAGTGGTCCGCTGCGCGATATGCGTATGTACCAGAAACTACCGGCGTTCCT
TGATAACCCACGCATGTTTAGCGGCTACCCGGAGCTGGCGGTGGGTGTGGCGCGTGACCT
GTTCACCATTGATGGCAGCGCGCCGGAACTGATGCGCAAGAAAATCCTCCGCCACGGCAA
GAAAGTGGGCTTCATCAATCTAATCAAGGATGGCATGAAAGGAGTGACCGTTTTATGACT
TCTCCCGTCAATGTGGACGTCAAACTGGGCGTCAATAAATTCAATGTCGATGAAGAGCAT
CCGCACATTGTTGTGAAGGCCGATGCTGATAAACAGGCGCTGGAGCTGCTGGTGAAAGCG
TGCCCCGCAGGTCTGTACAAGAAGCAGGATGACGGCAGTGTGCGCTTCGATTACGCCGGA
TGTCTGGAGTGCGGCACCTGTCGCATTCTGGGGCTGGGGTCGGCGCTGGAACAGTGGGAA
TACCCGCGCGGCACCTTTGGTGTGGAGTTCCGTTACGGCTGATGTTGGTTTGATACGTAA
CGCCGCACTGACTCTCATTGCAAAAAACAGGAATAACCATGCAACCGTCCAGAAACTTTG
ACGATCTCAAATTCTCCTCTATTCACCGCCGCATTTTGCTGTGGGGAAGCGGTGGTCCGT
TTCTGGATGGTTATGTACTGGTAATGATTGGCGTGGCGCTGGAGCAACTGACGCCGGCGC
TGAAACTGGACGCTGACTGGATTGGCTTGCTGGGCGCGGGAACGCTCGCCGGGCTGTTCG
TTGGCACATCGCTGTTTGGTTATATTTCCGATAAAGTCGGACGGCGCAAAATGTTCCTCA
TTGATATCATCGCCATCGGCGTGATATCGGTGGCGACGATGTTTGTTTCATCCCCCGTCG
AACTGTTGGTGATGCGGGTACTTATCGGCATTGTCATCGGTGCAGATTATCCCATCGCCA
CCTCAATGATCACCGAGTTCTCCAGTACCCGTCAGCGGGCGTTTTCCATCAGCTTTATTG
CCGCGATGTGGTATGTCGGCGCGACCTGTGCCGATCTGGTCGGCTACTGGCTTTATGATG
TGGAAGGCGGCTGGCGCTGGATGCTGGGTAGCGCGGCGATCCCCTGTTTGTTGATTTTGA
TTGGTCGATTCGAACTGCCTGAATCTCCCCGCTGGTTATTACGCAAAGGGCGAGTAAAAG
AGTGCGAAGAGATGATGATCAAACTGTTTGGCGAACCGGTGGCTTTCGATGAAGAGCAGC
CGCAGCAAACCCGTTTTCGCGATCTGTTTAATCGCCGCCATTTTCCTTTTGTTCTGTTTG
TTGCCGCCATCTGGACCTGCCAGGTGATCCCAATGTTCGCCATTTACACCTTTGGCCCGC
AAATCGTTGGTTTGTTGGGATTGGGGGTTGGCAAAAACGCGGCACTAGGGAATGTGGTGA
TTAGCCTGTTCTTTATGCTCGGCTGTATTCCGCCGATGCTGTGGTTAAACACTGCCGGAC
GGCGTCCATTGTTGATTGGCAGCTTTGCCATGATGACGCTGGCGCTGGCGGTTTTGGGGC
TAATCCCGGATATGGGGATCTGGCTGGTAGTGATGGCCTTTGCGGTGTATGCCTTTTTCT
CTGGCGGGCCGGGTAATTTGCAGTGGCTCTATCCTAATGAACTCTTCCCGACAGATATCC
GCGCCTCTGCCGTGGGCGTGATTATGTCCTTAAGTCGTATTGGCACCATTGTTTCGACCT
GGGCACTACCGATCTTTATCAATAATTACGGTATCAGTAACACGATGCTAATGGGGGCGG
GTATCTCGCTGTTTGGCTTGTTGATTTCCGTAGCGTTTGCCCCGGAGACTCGAGGGATGT
CACTGGCGCAGACCAGCAATATGACGATCCGCGGGCAGAGAATGGGGTAAATTGTTCAGA
TTTCTCTCTTTTCTGAATCAATATTATTGACTATAAGCCGCGTGAATATATGACTACACT
TTGTGGGAAAACAAAGGCGTAATCACGCGGGCTACCTATGATTCTTATAATTTATGCGCA
TCCGTATCCGCATCATTCCCATGCGAATAAACGGATGCTTGAACAGGCAAGGACGCTGGA
AGGCGTCGAAATTCGCTCTCTTTATCAACTCTATCCTGACTTCAATATCGATATTGCCGC
CGAGCAGGAGGCGCTGTCTCGCGCCGATCTGATCGTCTGGCAGCATCCGATGCAGTGGTA
CAGCATTCCTCCGCTCCTCAAACTTTGGATCGATAAAGTTTTCTCCCACGGCTGGGCTTA
CGGTCATGGCGGCACGGCGCTGCATGGCAAACATTTGCTGTGGGCGGTGACGACCGGCGG
CGGGGAAAGCCATTTTGAAATTGGTGCGCATCCGGGCTTTGATGTGCTGTCGCAGCCGCT
ACAGGCGACGGCAATCTACTGCGGGCTGAACTGGCTGCCACCGTTTGCCATGCACTGCAC
CTTTATTTGTGACGACGAAACCCTCGAAGGGCAGGCGCGTCACTATAAGCAACGTCTGCT
GGAATGGCAGGAGGCCCATCATGGATAGCCATACGCTGATTCAGGCGCTGATTTATCTCG
GTTCGGCAGCGCTGATTGTACCCATTGCGGTACGTCTTGGTCTGGGATCGGTACTTGGCT
ACCTGATCGCCGGCTGCATTATTGGCCCGTGGGGGCTGCGACTGGTGACCGATGCCGAAT
CTATTCTGCACTTTGCCGAGATTGGGGTGGTGCTGATGCTGTTTATTATCGGCCTCGAAC
TCGATCCACAAAGGCTGTGGAAGCTGCGTGCGGCAGTGTTCGGCTGTGGCGCATTGCAGA
TGGTGATTTGCGGCGGCCTGCTGGGGCTGTTCTGCATGTTACTTGGGCTGCGCTGGCAGG
TCGCGGAATTGATCGGCATGACGCTGGCGCTCTCCTCTACGGCGATTGCCATGCAGGCGA
TGAATGAACGCAATCTGATGGTGACGCAAATGGGTCGCAGTGCCTTTGCGGTGCTGCTGT
TCCAGGATATCGCGGCGATCCCGCTGGTGGCGATGATTCCGCTACTGGCAACGAGCAGTG
CCTCGACGACGATGGGCGCATTTGCTCTCTCGGCGTTAAAAGTGGCGGGTGCGCTGGTGC
TGGTGGTATTGCTGGGGCGCTATGTCACGCGTCCGGCGCTGCGTTTTGTAGCCCGCTCTG
GCTTGCGGGAAGTGTTTAGTGCCGTGGCGTTATTCCTCGTGTTTGGCTTTGGTTTGCTGC
TGGAAGAGGTCGGCTTGTCGATGGCGATGGGCGCGTTTCTGGCGGGCGTACTGCTGGCAA
GCTCGGAATACCGTCATGCGCTGGAGAGCGATATCGAACCATTTAAAGGTTTGCTGTTGG
GGCTGTTTTTCATCGGTGTTGGCATGTCGATAGACTTTGGCACGCTGCTTGAAAACCCAT
TGCGCATTGTCATTTTGCTGCTCGGTTTCCTCATCATCAAAATCGCCATGCTGTGGCTGA
TTGCCCGACCGTTGCAAGTGCCAAATAAACAGCGTCGTTGGTTTGCGGTGTTGTTAGGGC
AGGGCAGTGAGTTTGCCTTTGTGGTATTTGGCGCGGCGCAGATGGCGAATGTGCTGGAGC
CGGAGTGGGCGAAATCGCTGACCCTGGCGGTGGCGCTGTCGATGGCAGCAACGCCGATTC
TGCTGGTGATCCTCAATCGCCTTGAGCAATCTTCTACTGAGGAAGCGCGTGAAGCCGATG
AGATCGACGAAGAACAGCCGCGCGTGATTATCGCCGGATTCGGTCGTTTTGGGCAGATTA
CCGGACGTTTACTGCTCTCCAGCGGGGTGAAAATGGTGGTACTCGATCACGATCCGGACC
ATATCGAAACCTTGCGTAAATTTGGTATGAAAGTGTTTTATGGCGATGCCACGCGGATGG
ATTTACTGGAATCTGCCGGAGCGGCGAAAGCGGAAGTGCTGATTAACGCCATCGACGATC
CGCAAACCAACCTGCAACTGACAGAGATGGTGAAAGAACATTTCCCGCATTTGCAGATTA
TTGCCCGCGCCCGCGATGTCGACCACTACATTCGTTTGCGTCAGGCAGGCGTTGAAAAGC
CGGAGCGTGAAACCTTCGAAGGTGCGCTGAAAACCGGGCGTCTGGCACTGGAAAGTTTAG
GTCTGGGGCCGTATGAAGCGCGAGAACGTGCCGATGTGTTCCGCCGCTTTAATATTCAGA
TGGTGGAAGAGATGGCAATGGTTGAGAACGACACCAAAGCCCGCGCGGCGGTCTATAAAC
GCACCAGCGCGATGTTAAGTGAGATCATTACCGAGGACCGCGAACATCTGTCATTAATTC
AACGACATGGCTGGCAGGGAACCGAAGAAGGTAAACATACCGGCAACATGGCGGATGAAC
CGGAAACGAAACCCTCATCCTAATAAAGAGTGACGTAAATCACACTTTACAGCTAACTGT
TTGTTTTTGTTTCATTGTAATGCGGCGAGTCCAGGGAGAGAGCGTGGACTCGCCAGCAGA
ATATAAAATTTTCCTCAACATCATCCTCGCACCAGTCGACGACGGTTTACGCTTTACGTA
TAGTGGCGACAATTTTTTTTATCGGGAAATCTCAATGATCAGTCTGATTGCGGCGTTAGC
GGTAGATCGCGTTATCGGCATGGAAAACGCCATGCCGTGGAACCTGCCTGCCGATCTCGC
CTGGTTTAAACGCAACACCTTAAATAAACCCGTGATTATGGGCCGCCATACCTGGGAATC
AATCGGTCGTCCGTTGCCAGGACGCAAAAATATTATCCTCAGCAGTCAACCGGGTACGGA
CGATCGCGTAACGTGGGTGAAGTCGGTGGATGAAGCCATCGCGGCGTGTGGTGACGTACC
AGAAATCATGGTGATTGGCGGCGGTCGCGTTTATGAACAGTTCTTGCCAAAAGCGCAAAA
ACTGTATCTGACGCATATCGACGCAGAAGTGGAAGGCGACACCCATTTCCCGGATTACGA
GCCGGATGACTGGGAATCGGTATTCAGCGAATTCCACGATGCTGATGCGCAGAACTCTCA
CAGCTATTGCTTTGAGATTCTGGAGCGGCGGTAATTTTGTATAGAATTTACGGCTAGCGC
CGGATGCGACGCCGGTCGCGTCTTATCCGGCCTTCCTATATCAGGCTGTGTTTAAGACGC
CGCCGCTTCGCCCAAATCCTTATGCCGGTTCGACGGCTGGACAAAATACTGTTTATCTTC
CCAGCGCAGGCAGGTTAATGTACCACCCCAGCAGCAGCCGGTATCCAGCGCGTATATACC
TTCCGGCGTACCTTTGCCCTCCAGCGATGCCCAGTGACCAAAGGCGATGCTGTATTCTTC
AGCGACAGGGCCAGGAATCGCAAACCACGGTTTCAGTGGGGCAGGGGCCTCTTCCGGCGA
TTCTTTGCTGTACATATCCAGTTGACCGTTCGGGAAGCAAAAACGCATACGGGTAAAAGC
GTTGGTGATAAAACGCAGTCTTCCCAGCCCCCGCAATTCCGGTGACCAGTTATTTGGCAT
ATCGCCGTACATGGCATCAAGAAAGAAGGGATAGGAGTCACTCGATAGCACCGCTTCTAC
ATCGCGTGCGCACTCTTTGGCGGTCTGCAGATCCCACTGCGGCGTGATCCCTGCGTGGGC
CATCACCAGCTTTTTCTCTTCGTCGATTTGCAGCAGAGGCTGGCGCCGCAGCCAGTTAAG
CAGCTCGTCGGCATCCGGCGCTTCCAGCAGCGGTGTCAGGCGATCTTTCGGTTTATTGCG
GCTGATCCCGGCAAATACCGCCAGCAGATGCAGATCGTGATTGCCCAGCACCAGACGTAC
GCTGTCGCCTAAGGATTTCACATAGCGCAGAACATCCAGCGAACCCGGCCCGCGCGCGAC
CAGATCGCCCGTCAGCCAGAGGGTATCTTTCCCAGGGGTAAATTCTACTTTATGCAGCAA
TGCGATCAGTTCATCGTAACAACCATGAACGTCGCCAATAAGGTATGTCGCCATATTCTT
TTAATGAATGAGTGTGGGAACGGCGAGTCGGAATACGGGAATGTCGATGCTGAAAGGGAC
GCCATTTTCATCGATCATTTCGTAGTGACCCTGCATGGTGCCCAGCGGGGTTTCAATGAT
TGCACCGCTGGTGTACTGGTACTCTTCGCCAGGCGCGATAAGTGGCTGGACGCCAACCAC
TCCTTCGCCCTGGACTTCGGTTTCACGGCCATTGCCATTGGTGATCAGCCAGTAACGCCC
CAACAACTGCACTGGCGCTCGCCCCAGATTGCGTATGGTTACGGTATAAGCAAAAACGTA
ACGTTCATTATCAGGTGAAGATTGAGCCTCAATGTAGACGCTTTGAACCTGAATACACAC
TCGGGGCGAATTGATCATCGTTAACTCTCCTGCAAAGGCGCGTTCTCCGCCAGATAGTTC
GCCATCTGGCAATATTGCGCGACAGAGATATTTTCCGCTCGCATCGCCGGGTCGATCCCC
ATTCCCGTTAACACCTCGACGCTAAACAGGTTGCCGAGGCTGTTACGAATGGTTTTACGA
CGCTGGTTAAAGGCTTCGGTGGTGATGCGGCTCAACACACGAACATCTTTAACCGGGTGA
GGCATCGTTGCATGAGGAACCAGGCGCACGACGGCGGAATCCACTTTGGGTGGTGGTGTA
AAGGCTGACGGCGGTACTTCCAGTACCGGGATCACATTGCAATAGTATTGCGCCATGACG
CTTAATCGACCATACGCTTTGCTGTTCGGTCCTGCAACCAGACGATTCACCACCTCTTTT
TGCAACATAAAGTGCATGTCGGCAATGGCATCAGTATAGCTAAACAGATGGAACATCAAC
GGCGTGGAGATGTTATAAGGCAGGTTGCCGAAAACACGCAGCGGCTGACCCATTTTCTCG
GCCAGTTCACCAAAGTTAAAGGTCATCGCATCCTGCTGATAAATCGTCAGTTTCGGGCCT
AAGAATGGATGCGTTTGCAGACGTGCCGCCAGATCGCGGTCAAGTTCGATGACCGTCAGC
TGGTCCAGACGTTCGCCGACCGGTTCGGTCAATGCCGCCAGACCGGGGCCGATTTCGACC
ATCGCCTGGCCCTTTTGCGGGTTAATGGCAGACACAATACTGTCGATCACGAACTGATCG
TTGAGAAAGTTTTGCCCGAAGCGTTTACGGGCTAAGTGGCCCTGGTGGACTCGATTATTC
ATTGGGTGTTAACAATCATTTTGATGGCGAGATTAAGCGCCGTAATAAAACTGCCGACAT
CGGCTTTGCCACGTCCCGCCAGTTCAAGCGCGGTGCCGTGGTCCACTGATGTGCGAATAA
AGGGCAGGCCCAGCGTAATGTTCACACCGCGCCCGAAGCCCTGGTATTTTAGCACGGGAA
GACCCTGATCGTGGTACATCGCCAGCACGGCGTCGGCGTTATCAAGATATTTCGGCTGAA
ACAGGGTATCGGCAGGCAGCGGCCCGTTGAGTTTCATCCCCTGCGCCCGCAGCTCATTGA
GCACCGGAATAATGGTGTCTATCTCTTCCGTACCCATATGACCGCCTTCGCCCGCGTGCG
GATTCAGCCCGCAGACCAGAATGCGCGGTTCGGCAATACCAAATTTGGTCCGCAAATCGT
GATGCAAAATAGCAATCACTTCGTGCAAAAGTGCAGGGGTGATAGCGTCTGCGATATCGC
GCAGCGGTAAATGCGTCGTTGCCAGCGCCACGCGAAGTTCTTCGGTCGCCAGCATCATCA
CCACCTTTTTCGCCTGCGAACGCTCTTCGAAAAACTCGGTATGACCGGTAAAAGGAATGC
CAGCGTCGTTAATAACGCCTTTATGCACCGGACCTGTGATCAGCGCGGCAAATTCGCCGT
TCAGACAACCATCGCACGCTCGCGCCAGCGTTTCCACCACATAATGCCCATTTTCAACCG
CTAACTGCCCCGCAGTGACAGGTGCACGTAGCGCGACAGGAAGTAGCGTTAATGTGCCCG
CAGTTTGCGGTTGTGCAGGGGAGTTGGGGGAATAAGGGCGGAGGGTGAGCGGCAAACCGA
GCATCGCTGCCCGGTTGGTAAGGAGAGTGGCATCGGCACAAACAACCAGTTCGACCGGCC
ACTCACGCTGTGCAAGCTGGACAACTAAGTCCGGGCCAATCCCGGCGGGCTCGCCGGGAG
TGATCACAACACGTTGGGTTTTAACCATTAGTTGCTCAGGATTTTAACGTAGGCGCTGGC
ACGTTGTTCCTGCATCCAGCTTGCTGCTTCTTCCGAGAACTTACGGTTCATCAGCATGCG
GTATGCACGATCTTTCTGCGCAGCGTCGGTTTTATCGACATTACGGGTATCCAGCAGTTC
GATTAAATGCCAGCCGAATGAAGAGTGAACCGGTGCACTCATTTGACCTTTGTTCAGGCG
AGTCAGGGCGTCACGGAAGGCCGGATCGAAAATATCTGGTGTAGCCCAGCCGAGATCGCC
GCCCTGGTTAGCAGAGCCTGGATCCTGAGAGAACTCTTTCGCTGCGGCAGCAAAAGTCGT
TTTACCACTCTTGATATCAGCAGCAATCTGTTCCAGTTTCACACGGGCCTGTTCGTCAGT
CATGATCGGCGACGGTTTCAGCAGAATATGGCGAGCATGAACTTCGGTCACCGAGATATT
TTTGCTTTCGCCGCGCAGGTCGTTAACTTTCAGAATATGGAAGCCAACGCCGGAACGAAT
CGGGCCAACAATGTCGCCTTTCTTCGCGGTGCTTAATGCCTGGGCGAAGATCCCGGGCAA
CTCCTGAATACGGCCCCAGCCCATCTGGCCGCCGTTCAGCGCCTGCTGGTCGGCAGAATG
AGCAATCGCCAGCTTACCGAAATCAGCGCCGTTACGCGCCTGATCGACAATGGCGCGCGC
CTGGCTTTCCGCTTCGTTCACCTGATCAGAGGTCGGGTTTTCCGGCAGCGGGATCAGGAT
GTGGCTCAGGTTCAGCTCAGTGCTGGCGTCGTTTTGGTTACCCACCTGCTGCGCCAGGGA
TTCGACTTCCTGCGGCAGGATGGTGATGCGACGACGCACCTCGTTGTTACGCACTTCAGA
GATAATCATCTCTTTGCGGATCTGGTTACGATAGGTGTTGTAGTTCAGTCCATCGTAAGC
CAGACGGCTGCGCATCTGATCCAGCGTCATGTTGTTCTGTTTCGCGATGTTAGCAATCGC
CTGATCCAGCTGCTCATCGGAGATTTTCACTCCCATTTTCTGCCCCATCTGCAGGATGAT
TTGATCCATGATCAAACGTTCCATGATTTGGTGGCGCAGCGTCGCGTCATCAGGAAGTTG
CTGCCTTGCCTGAGCAGCGTTCAGTTTTACCGACTGCATTAATCCATCAACGTCGCTTTC
CAGCACGACGCCGTTATTGACGACGGCTGCGACTTTATCGACTACCTGGGGGGCAGCGAA
ACTGGTATTCGCGATCATGGCGATACCGAGAAGCAGCGTTTTCCAGTTCTTCATACTTTT
TCCATTTCAATTAACCGCACTGCGGATTACGTGGTAAATCAACAAATCACAAAGTGTTTT
GATACGGCAGAATGTTCGAACGCAGCATCTCTTGCGTACCCAGACCGTAGTTGGAGCTCA
GGCCGCGAAGTTCGATGTTAAAGCCGATTGCGTTGTCATATACCGCATGTTGTTTATCGT
TATCCCAACCGTTCAGCTTCCGCTCGTAACCGACGCGAATTGCATAGCAGCAGGAGCTGT
ATTGCACACCTAACATAGAGTCGGCTTGCTTGTTAGCATTGGTGTCGTAGTAGTAGGCCC
CAACAATGGACCAACGATCGGCAATTGGCCAGCTGGCGACAGCACCTACCTGCGAAATAC
CATTCTTATATTGCTCAGCAGTGGAATAGTACTTAGGCAGCGTAGCCTGAATATATTCCG
GGCTGGCGTAACGGTAATTCAGCTGTACCAGACGGTCTTCATCCCGACGGTATTCAATGC
TGGAGTTACTGGTCGCTACGTTATCCAGACGTGTATCGTACTGAATCCCGCCACGCAATC
CCCAACGCTCGGAGATACGCCAGTAAGTATCGCCTGCCCACACCAGTGAACCCGTTTTGT
CGTCATTCTCCCATGTTATGTTGTCATCGCCAGTGCGAGACTCCGTGAAATAGTAGATTT
GACCAACGGAAATATTAAAACGTTCAACGGCAGCATCATCATATATGCGAGATGTGACAC
CGGTCGTCACCTGGTTAGCGGAGGCAATACGGTCAAGACCGCCGTAAGTCCGGTCCCGGA
ACAGGCCAGAGTAGTCAGATTGCAGCAGAGACGAGTCGTAGTTATAGATGTCGCTCTGAT
CGCGATACGGCACGTACAAATACTGCGCGCGCGGTTCCAGCGTTTGGGTATAACCCGGAG
CCAGCATTTCCATATCGCGTTCAAAGACCATTTTGCCGTCAACTTTGAATTGCGGCATTA
CGCGGTTAACGGATTCGTCCAGCTTGGTCGTGTTTCTGGAGTTATACCAGTCAAGATTGG
TTTGCTGATAATGGGTTGCCAGCAACTTCGCTTCGGTATTGATGCTGCCCCAGTTATTAG
AGAGCGGCAAATTGATGGTCGGTTCCAGGTGAACACGGGTTGCTTCAGGCATGTCGTCTC
TGGTGTTAACAAAGTGCACTGCCTGGCCGTAAATACGCGTATCAAACGGACCAACATCAT
TCTGGTAGTAATTAACGTCTAACTGCGGCTCTGCCGAGTAGCTACTGGTGTTCTGTTCGC
TGAAAACCTGGAACTGCTTGGTTGAAACGGTGGCATTGAAGTTTTGCACCGCATAGCCAA
CGCTGAATTTTTGCGTTGCGTAGCCGTCAGTACTGGAACCGTACTTGTTATCGAAATCAT
TGAAGTAGCTAGGATCGCTGACCTTGGTGTAGTCGACGTTGAAACGCCACACCTGATCCA
TGACCCCGGAGTGGTTCCAGTAGAATAACCAACGACGTGAACTGTCATCGTTCGGGTGTT
CATCTTCATAGACTTTATCTGAAGGCAGATAGTCCAGTTCCATCAAGCCAGCGCCCGCCT
GGGAGAGGTAGCGGAATTCGTTCTCCCACATGATGTTGCCACGACGATGCATATAATGCG
GCGTGATGGTGGCATCCATATTTGGCGCGATGTTCCAGTAATATGGCAGGTAGAACTCAA
AGTAGTTGGTGGTGGTGTACTTGGCGTTCGGGATCAAGAAACCAGAGCGACGTTTGTCAC
CCACCGGCAACTGCAAATAGGGGCTATAAAAGATCGGTACCGGACCCACCTTAAAGCGGG
CGTTCCAGATCTCCGCAACTTGTTCTTCGCGGTCATGAATAATTTCGCTACCTACCACGC
TCCAGGTGTCAGAACCCGGCAGACAGGAGGTAAAGCTACCGTTATCCAGAATGGTATAGC
GGTTTTCGCCACGTTGTTTCATCAGGTCCGCTTTACCGCGACCCTGGCGACCCACCATCT
GGTAATCACCTTCCCAGACGTTGGTATCTTTGGTGTTCAGATTCGCCCAGCCTTTCGGCC
CTTTGAGGATCACCTGGTTATCGTCGTAATGGACATTACCGAGCGCATCAACGGTACGTA
CCGGCTCCGGTTGTCCTGGTGCCTCTTTTTGATGGAGCTGCACTTCGTCGGCCTGCAGAC
GGCTGTTACCCTGCATGATATCCACGCTGCCAGTAAACACGGCGTCATCCGGGTAGTCCC
CTTTCGCGTGGTCAGCATTGATAGTCACGGGTAAGTCATTGGTATCGCCCTGTACCAGAG
GACGGTCATAGCTTGGCACGCCCAACATGCACTGTGAGGCGAGGTCGGCTGCCAGTCCCT
GTTGACTATAAAGGGCGGTGGCAATCATGGTGGCCAGGAGAGTGGGGATACGTTTTTTCA
TACGTTGATTTTATTGTTCCATCATCGGTAACGTTGCGCGTGACAAACGGTCAGAGACTA
ACGTACTCGTCATCTCTACGCTAGTGTTAATCCTGTCCGAATAGCGTCAGTGGTGTTAGG
CACGGCATTGAATGACAGGTATGATAATGCAAATTATAGGCGATGTCCCACAATTGACCG
CAGCCGGAAAACGGTAAAAGCACCTTTATATTGTGGGAGATAGCCCTGATATCCGTGTGT
CGATTTGGGGAATATATGCAGTATTGGGGAAAAATCATTGGCGTGGCCGTGGCCTTACTG
ATGGGCGGCGGCTTTTGGGGCGTAGTGTTAGGCCTGTTAATTGGCCATATGTTTGATAAA
GCCCGTAGCCGTAAAATGGCGTGGTTCGCCAACCAGCGTGAGCGTCAGGCGCTGTTTTTT
GCCACCACTTTTGAAGTGATGGGGCATTTAACCAAATCCAAAGGTCGCGTCACGGAGGCT
GATATTCATATCGCCAGCCAGTTGATGGACCGAATGAATCTTCATGGCGCTTCCCGTACT
GCGGCGCAAAATGCGTTCCGGGTGGGAAAATCAGACAATTACCCGCTGCGCGAAAAGATG
CGCCAGTTTCGCAGTGTCTGCTTTGGTCGTTTTGACTTAATTCGTATGTTTCTGGAGATC
CAGATTCAGGCGGCGTTTGCTGATGGTTCACTGCACCCGAATGAACGGGCGGTGCTGTAT
GTCATTGCAGAAGAATTAGGGATCTCCCGCGCTCAGTTTGACCAGTTTTTGCGCATGATG
CAGGGCGGTGCACAGTTTGGCGGCGGTTATCAGCAGCAAACTGGCGGTGGTAACTGGCAG
CAAGCGCAGCGTGGCCCAACGCTGGAAGATGCCTGTAATGTGCTGGGCGTGAAGCCGACG
GATGATGCGACCACCATCAAACGTGCCTACCGTAAGCTGATGAGTGAACACCATCCCGAT
AAGCTGGTGGCGAAAGGTTTGCCGCCTGAGATGATGGAGATGGCGAAGCAGAAAGCGCAG
GAAATTCAGCAGGCATATGAGCTGATAAAGCAGCAGAAAGGGTTTAAATGACCCTGTAAA
TGATGCTGAGTAACTGCCCACGATTAAAGGTGGCCGCCCTGGCGGTCACTTCTTTGAGAA
AAGGCGTTTACTCAGAATGGTGGACAGGCTCAATGCACGGTTTACGGGAGGGGTTCTGTA
GGTTTTATCGCGTTGACCCTGCTTAAGGTTGAGAGCTTTACGACGAGCGGAATTATATTT
TTACGTCTTAAAAATAAAAAACACATACCTGAATGAGCGATTTTTGAAAGTATATTTATT
CAGAACGCGCATCATGAGTTTTTAACTCAATGCGAGGCTATTACCATGAAAGTATCAGTT
CCAGGCATGCCGGTTACACTTTTAAATATGAGCAAGAACGATATTTATAAGATGGTGAGC
GGGGACAAGATGGACGTGAAGATGAATATCTTTCAACGCTTGTGGGAGACGTTACGCCAT
CTGTTCTGGTCAGATAAACAGACTGAGGCTTATAAACTTCTGTTCAATTTCGTGAATAAC
CAGACTGGCAACATCAACGCCTCAGAATACTTTACTGGGGCTATCAACGAGAATGAGAGA
GAAAAGTTTATCAATAGCCTGGAATTATTCAATAAACTTAAAACATGCGCAAAAAATCCG
GATGAGTTGGTCGCAAAGGGCAATATGCGCTGGGTCGCCCAGACCTTCGGGGATATCGAG
TTAAGTGTCACTTTTTTCATTGAAAAGAATAAGATATGTACTCAGACGTTGCAGCTGCAT
AAGGGCCAAGGTAACTTGGGCGTTGATCTTAGAAAGGCTTACCTTCCCGGCGTTGACATG
AGGGATTGTTACCTTGGTAAAAAAACAATGAAAGGTAGCAATGATATCCTTTATGAGAGA
CCTGGGTGGAATGCTAACCTGGGCGTGCTACCCCGGACGGTGCTACCCCGGACGGTGCTA
ACCCGGACGGTGCTAACCTGGACGGTGCTACCGTGAACGGTGCTACCTCCTTATATGATG
AGGTAATTATTATTAATAAAATCCCCCCCAAAAAAATTGATACTAAAGGAGTTGCTACTG
AAGAAGTTGCTACTAAAAAAGTACTGCTGAACAAATTACTGACAACGCAATTATTGAATG
AGCCAGAATAAGCTAAGGTTGAAGGGGCTGGAACGCCCCTTCAACCTTAGCAGTAGCGTG
GGATGATTTCACAATTAGAAAGACCTGCATGATGAGCTAGAGAAGAGGCTAGTGACGCAA
GGCGTCGTGCAGGACACGGATCACCGAGATGGGCATCGCCAACCAGACTGCTAATTAGCC
CATGAATAACAATCAGAAAGGACCATAACAGACCCGTTAAAATGAAATATAAGAGACGGT
CAACGGGTGAAGAAAAAGTTCAAAAATTCGCTGTGGAGCAGGAAGGGAATTACCGAATGG
AAAGCGTAGCCACACGCAACAACTGAAAGCAGTTTGGCAGAAACAAAAAATCCCCGGACT
CGGGGATTTATGTACAAGAGGCAGCCCTTAGGATGAGGGTATAAACGTACAGGAAAGGTT
AAAAATCCGCTGGCGCTTTAAACGTCATACTATTGCCATACGCCGGATGGGTAATCGTCA
ACATCTCTGCATGTAGCAACAAACGTGGTGCCATCGCTCTCGCTTCTGGTGATGCATAAA
AACGATCGCCGAGAATCGGATGACCCAGCGCCAGCATATGCACACGCAATTGATGCGAAC
GCCCGGTAATCGGTTTTAACACCACTCTTGCCGTGTTATCCGCCGCATACTCCACCACTT
CATATTCCGTCTGCGCAGGTTTACCCGTTTCGTAACAGACTTTCTGTTTCGGGCGGTTTG
GCCAGTCGCAAATCAGCGGCAGATCCACCAGACCTTCTGCGGGGGATGGATGCCCCCAGA
CGCGGGCCACATACTGCTTTTTCGGCTCGCGCTCGCGGAACTGGCGTTTTAACTCCCGCT
CCGCGGCTTTGGTCAGCGCCACTACAATCACGCCGCTGGTAGCCATATCCAGACGATGCA
CCGATTCTGCCTGCGGATAATCACGCTGAATGCGCGTCATCACGCTGTCTTTGTGCTCTT
CCAGACGACCCGGCACTGACAACAAACCGCTCGGCTTGTTGACCACCATAATATGGTCAT
CCTGATACAGGATAACCAACCAGGGTTCCTGCGGTGGATTGTAGTTTTCCATCCCCATTT
TCGGCTCCGTTACTGATGCGTTACAACGATCAAACGCAGGGCATCCAGACGCCAACCTGC
CTGATCCAGGCTTTCCATTACCTGCTGACGGTTGCTCTCAATGGCGGTCAGTTCGTCGTC
ACGAATGTTCGGGTTCACTGCACGCAGAGCTTCCAGACGAGACAGCTCGGCAGACAGTTT
TTCGTCGGCTTCGTTACGCGCTGCATCAATCAATGCACGGGCAGATTTCTCGATCTGCGC
TTCACCCAGTTGAAGGATAGCGTGAACATCCTGCTGCACGGCGTTAACCAGTTTGCTGCC
GGTGTGACGGTTAACCGCGTTAAGCTGGCGGTTAAAGGTTTCAAACTCTACCTGCGCCGC
CAGGTTGTTGCCGTTTTTATCCAGCAGCATACGTACCGGCGTCGGTGGCAGGAAGCGGTT
GAGCTGCAACTGCTTCGGAGCCTGGGCTTCAACCACATAAATCAGTTCCACCAACAGCGT
ACCTACCGGCAACGCTTTGTTTTTTAACAGTGAAATCGTGCTGCTACCGGTATCGCCAGA
AAGGATCAGATCCAGACCGTTGCGGATCAGCGGATGCTCCCAGGTAATAAACTGTGCATC
TTCACGCGCCAGCGCCACTTCACGATCAAAGGTGATGGTGATGCCATCTTCCGACAGGCC
AGGGAAGTCCGGCACCAGCATATGATCGGACGGCGTCAGCACGATCATGTTGTCGCCGCG
ATCGTCCTGATTGATACCGATAATATCGAACAGGTTCATGGCGAAGGCGATCAGGTTGGT
ATCGTCATCCTGCTCTTCAATGCTTTCTGCCAGTGCCTGGGCTTTTTCGCCACCGTTGGA
GTGGATTTCCAGCAGGCGGTCACGACCCTGTTCCAGCTGTGCTTTCAGCGCTTCATGTTG
CTCGCGGCAGTTTTTGATCAGATCGTCAAAGCCTTCGGTTTGATCCGGTGAAGCCAGATA
GTTAATCAGATCGTTGTATACGCTATCGTAAATAGTGCGTCCGGTCGGGCAGGTGTGCTC
AAATGCATCCAGACCTTCGTGATACCAGCGCACCAGCACCGACTGAGCGGTTTTCTCCAG
ATAAGGCACATGGATCTGAATATCGTGCGCCTGGCCGATACGATCCAGACGACCAATACG
CTGCTCCAGTAGATCCGGGTTGAATGGCAGGTCAAACATCACCATGTGGCTGGCGAACTG
GAAGTTACGTCCTTCAGAACCGATTTCTGAGCACAGCAGTACCTGTGCGCCGGTGTCTTC
TTCGGCAAACCAGGCGGCAGCGCGGTCACGTTCGATAATCGACATACCTTCGTGGAACAC
CGCAGCGCGAATACCTTCACGTTCGCGCAGTACCTGCTCCAGTTGCAGCGCAGTGGCAGC
TTTGGCGCAGATCACCAGCACTTTCTGAGAGCGATGGCTGGTCAGGTAGCCCATCAGCCA
CTCAACGCGCGGATCGAAGTTCCACCAGGTGGCGTTATCACCTTCAAATTCCTGATAAAT
ACGCTCCGGGTAGAGCATATCGCGAGCACGATCTTCCGCACTTTTACGTGCGCCCATAAT
GCCGGAGACTTTAATAGCCGTCTGATACTGCGTCGGTAGCGGCAGCTTAATGGTGTGCAG
CTCGCGTTTCGGGAATCCTTTCACACCGTTACGCGTGTTACGGAACAGCACGCGGCTGGT
GCCGTGGCGATCCATCAGCATCGAAACCAGCTCCTGACGGGCGCTCTGGGCATCTTCGCT
GTCGCTGTTTGCTGCCTGCAACAGCGGCTCGATATCCTGCTCGCCGATCATCTCGCCGAG
CATGTTCAGTTCGTCATTGCTCAGTTTGTTACCTGCCAGCAGCATGGCAACGGCGTCCGC
AACCGGACGATAATTTTTCTGCTCTTCAACGAACTGCGCAAAATCGTGGAAACGGTTCGG
GTCCAGCAGACGCAGACGGGCGAAGTGGCTTTCCATCCCCAGCTGTTCCGGGGTCGCGGT
CAGCAGCAGAACGCCCGGCACGTGCTCTGCCAGTTGTTCAATGGCCTGATATTCACGGCT
TGGCGCATCTTCGCTCCACACCAGGTGATGCGCTTCATCGACCACCAGCAGGTCCCATTC
GGCTTCACAGAGATGTTCCAGGCGCTGTTTGCTACGACGGGCAAAATCCAGCGAGCAAAT
CACCAGCTGTTCGGTGTCAAACGGGTTGTAAGCATCGTGCTGAGCTTCGGCATAACGCTC
ATCATCAAATAGCGCAAAGCGCAGGTTGAAACGGCGCAGCATTTCTACCAGCCACTGATG
CTGTAAGGTTTCCGGGACGATAATTAGCACACGTTCAGCAGCGCCAGAGAGCAGTTGCTG
ATGCAGGATCATCCCGGCTTCAATGGTTTTCCCTAAACCCACTTCGTCAGCCAGCAGGAC
GCGCGGCGCGTGGCGGCGACCAACATCATGAGCGATGTTGAGCTGATGCGGGATCAGGCT
GGTACGCTGACCGCGCAGGCCGCTGTACGGCATACGGAACTGTTCGCTGGAATATTTACG
CGCGCGATAACGCAGCGCAAAGCGGTCCATACGGTCAATCTGCCCGGCAAACAGACGGTC
CTGCGGTTTGCTGAACACCAGTTTGCTATCAAGGAAAACTTCACGCAGGGCTACGCCGGA
CTCTTCAGTATCCAGGCGAGTACCGATATAGGTCAGCAAGCCATTTTCTTCTTTTACTTC
TTCGACTTGCATCTGCCAGCCGTCATGGCTGGTAATGGTATCACCAGGGTTGAACATCAC
GCGGGTCACGGGGGAATCACTGCGTGCGTACAGACGGTTTTCACCAGTAGATGGGAAAAG
TAAAGTGACAGTTCGCGCATCCACCGCGACAACGGTTCCAAGTCCCAATTCGCTTTCTGT
ATCGCTGATCCAGCGTTGACCAAGTGTAAAAGGCATATGTGTTCGGCTCTATATCTTTAA
TTGCAGGCAATAACCACCCGCTACCGTGCTTATGAGGTAGTGGTGTTATTCAGGTCCAGG
AATGGAAAGGGCGCTATGGTACTGGATGGCAAAGCATTCGTCACGCATCAAAATGGTATC
TGGCGAACTCTTTTTTTTGCTCAAAATAGCCCAAGTTGCCCGGTCATAAGTGTAGCAAAA
TTATCCTCAATAAAAGGGAGTATTCCCTCCGCCACGGGTTGTAGCTGGCGGGTCAGATAG
TGTTCGTAATCCAGTGGTGAACGTTGGTAGTCCAGCGGCTCCGGGCCGTTGGTGGTCCAT
ACGTACTTAATGGTGCCGCGATTCTGATATTGCAAGGGGCGACCACGCTTTTGGTTTTCT
TCATCGGCAAGGCGAGCGGCGCGTACATGAGGCGGCACATTACGCTGATACTCGCTCAGC
GGACGGCGAAGGCGTTTACGGTAAACCAGTCGCGCATCCAGTTCACCCGCCATCAGTTTG
TCGATGGTTTCGCGTACATATTCCTGATATGGCTCGTTGCGGAAGATGCGCAGGTATAGC
TCCTGCTGAAACTGCTGGGCCAGCGGCGTCCAGTCGGTGCGCACGGTTTCCAGCCCTTTA
AACACCATCCGCTGCTTGTCGCCCTCCTGAATCAGTCCGGCATAACGCTTTTTACTGCCG
GTATCGGCTCCGCGAATGGTTGGCATCAGAAAACGGCAGAAATGGGTTTCATACTCCAGT
TCTAATGCGCTGGTCAGCCGTTGTTTTTGCAGCGTTTCCGCCCACCAGGCGTTAACGTGC
TGCACCAGTGCACGACCGATTTTCGCCGCTTCTTCTTCCGAATGTGCGCCTTTCAGCCAG
ACAAACGTTGAGTCGGTATCGCCGTAGATAACGTCGTAGCCCTGTGCTTCAATCAACGCT
TTGGTTTGCCGCATGATCTGATGACCACGCATGGTGATCGACGATGCCAGCCGCGGATCG
AAGAAGCGGCAGGCGGTGGTGCCGAGCACGCCATAAAAGGCATTCATGATGATTTTCAGC
GCCTGCGACAGCGGTTTGTTACCCTGGCGTTTGGCTTCATCGCGCCCGTGCCAGATGTTA
GTCACAATCTCCGGCAGGCAATGTTTTTCTCGCGAGAACCAGGCATCGAGAAAACCTTCG
GTACTGTGCTCTGGATCAGGCTGCGCCATGCCTTCCACCAGCCCGACGGGATCAATCAGA
AAGGTGCGGATGATCGACGGGTACAGGCTTTTATAGTCCAGCACCAGCACTGAATCATAA
AGCCCTGGCCGTGAATCCATCACGTAGCCGCCAGGGCTGGCGTGCGGCGGCACTTCGCCG
AGATTAGGCGCGACATAACCAGCGCGATGCATTCGCGGAAAATAGAGATGACCAAATGCC
GCCACCGAACCGCCGTGTCGGTCCACCGGCAGGCCGTTCACCGTTGCCCGTTCGAGTAAA
AATGGCATGATTTCAGTTTTGTGGAAGATCTGCGTCACCAGCTCGCAATCTTTCAGGTTA
TAAGTTGCCAGCGCAGGTTTATCTTCGGCGAAACGGCGGTCAATTTCGTCCATTCGATCC
CACGGGTTATCGATAGATTTTCCTTCGCCTAATAGCTCCTGAGCGACAGTTTCCAGCGAG
AATGAAGAGAAATTCCAGAACGCGGATTTCAGCGCCTCGATACCGTCGATAATTAGCCGA
CCTTTAGCCTGGGCAAAAAAGACGCCGTTTTTAAAGCCGTGCTCGCGCCACTCCAGCTCG
CTATTATCGCGCCCAAGACGCAGCGGAAGACGGTAACGCTCGGCATGTTTTTGCAGCATT
CGCAGATCGAACTGCACCACGTTCCAACCGATGATCACATCAGGATCGTAGTTGGCAAAC
CAGGCGTTGAGTTTTTCCAGCAACTGCGGGCGGCTGGCGACGTATTCCAGTTCGAAATCA
AGCGAGGAGGCGTCGCCATTCTCCGGCCCCAGCATATAAACGATGCGCTGCCCGCAGCCT
TCCAGGCCGATGCAGTACAGCTCACCGTGGCGGGTGGTTTCAATATCTATAGAAACCCAC
TTGAGCGGCGGACGATAGTCGGGATGCGGTTTCAGACGGGCATTAACGATAGTGCCATTG
TGCATATCACCCTCGACCCACACCGGTGAGGTGATAAACCGCTCCATCAGATAGCGTTCT
GGCGGACGCACATCGGCCTCGTAGACGGTAACGCCACCTTCACGCAGGCGCTTTTCGTAA
TTCATCAATTGGCGATGGGCGCGACAGTAAAGGCCATACACCGGCTGGCGGTGAAAATCC
TTTAACGCCAGCGGTGTCAGGCGAAAGCCTTGTTCACCCTGCAAAATATGCTGAGCGCGG
GGAACCTGATCGGCGGGAATAAACGCCACGGACTCTTGCGGTGCAAGCGTAACCTGCAAC
GGCCCGTTGTCCGTCGCCAGCCAGAAGGAGACTTCTGTCCCTTGCGGGGTGTCCCGCCAG
TGTCGGGTTAAGATAAAACCTGCCTGCGCCACGCTGAAAATCCATCAAAAAACCAGGCTT
GAGTATAGCCTGGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCATTACTGCCCGTAAT
ATGCCTTCGCGCCATGCTTACGCAGATAGTGTTTATCCAGCAGCGTTTGCTGCATATCCG
GTAACTGCGGCGCTAACTGACGGCAGAATATCCCCATATAAGCGACCTCTTCCAGCACGA
TGGCGTTATGCACCGCATCTTCGGCATTTTTGCCCCATGCAAACGGGCCGTGGGAATGGA
CCAGAACGCCGGGCATTTGCGCTGCATCGATACCCTGTTTTTCAAAGGTTTCTACGATGA
CGTTACCGGTTTCCCACTCATATTCGCCGTTGATTTCTGCGTCGGTCATTTTGCGGGTGC
AGGGAATGGTGCCGTAGAAATAGTCGGCGTGGGTGGTGCCGGTTGCTGGAATCGACTGAC
CCGCCTGCGCCCAGATGGTGGCGTGGCGCGAGTGCGTATGCACAATGCCGCCAATGGAGG
GGAATGCCTGATAGAGCAGCCGGTGAGTTGGCGTGTCGGAGGAGGGCTTTTTCGTACCTT
CAACCACTTCACCGGTTTCGATGCTAACCACGACCATATCGTCAGCGGTCATGACGCTGT
AATCGACGCCGGAAGGTTTGATCACAAAGACGCCGCGCTCGCGATCAACGGCGCTGACGT
TGCCCCATGTGAGCGTGACCAGGTTGTGTTTTGGCAGCGCCAGGTTGGCTTCTAATACCT
GGCGTTTGAGATCTTCTAACATGTTGACTCCTTCGTGCCGGATGCGCTTTGCTTATCCGG
CCTACAAAATCGCAGCGTGTAGGCCTGATAAGACGCGCCAGCGTCGCATCAGGCGTTGAA
TGCCGGATGCGCTTTGCTTATCCGGCCTACAAAATCGCAGCGCGTAGGCCTGATAAGACG
CGCCAGCGTCGCATCAGGCGTTGAATGCCGGATGCGCTTTGCTTATCCGGCCTACAAAAT
CGCAGCGTGTAGGCCAGATAAGACGCGTCAGCGTCGCATCAGGCGTTACATACCGGATGC
GGCTACTTAGCGACGAAACCCGTAATACACTTCGTTCCAGCGCAGCGCGTCTTTAAACGC
TGGCAGGCGTGTGTCGTTATCAATCACCGTGATTTCAATGTCGTGCATCTCGGCGAATTG
GCGCATATCGTTGAGGTTCAGTGCATGGCTGAAGACGGTATGGTGCGCGCCACCAGCGAG
GATCCACGCTTCGGAAGCAGTTGGCAGATCCGGTTGCGCTTTCCACAGCGCATTCGCCAC
CGGCAGTTTCGGCAGGGAGTGCGGTGTTTTCACCGTGTCGATGCAGTTAACCAGTAGACG
GTAACGATCGCCGAGATCAATCAAGCTGGCGACAATCGCTGGGCCGGTTTGGGTATTGAA
GATCAGGCGGGCAGGATCGTCCTTACCACCAATACCGAGATGCTGAACGTCGAGGATCGG
TTTCTCTTCTGCGGCGATCGACGGGCAGACTTCCAGCATATGGGAGCCGAGCACCAGGTC
ATTACCTTTCTCGAAGTGATAGGTGTAGTCCTCCATAAAGGAGGTGCCGCCCTGCAGACC
GGTTGACATCACCTTCATGATGCGAAGCAGGGCGGCAGTTTTCCAGTCGCCTTCGCCCGC
AAAGCCGTAACCCTGCTGCATCAGACGCTGTACGGCCAGACCAGGAAGCTGTTTCAGACC
GTGCAAATCTTCAAAGGTGGTGGTGAACGCGTGGAAGCCACCTTGTTCCAGGAAACGCTT
CATCCCCAGCTCAATACGCGCCGCTTCCAGCACGTTCTGTCGTTTTTTGCCGTGGATTTG
TGTGGCAGGCGTCATGGTGTAGCAGCTTTCGTACTCATCGACCAGCGCGTTAACATCGCC
GTCGCTGATGGAGTTCACCACCTGCACCAGATCGCCAACCGCCCAGGTATTGACGGAGAA
ACCGAACTTGATCTGTGCGGCAACTTTATCGCCATCGGTGACCGCCACTTCACGCATGTT
ATCGCCAAATCGGCAGACTTTCAGATGACGGGTATCCTGTTTAGAGACCGCCTGACGCAT
CCAGGAGCCGATACGCTCATGGGCTTGTTTATCCTGCCAGTGACCGGTAACCACGGCATG
TTGCTGACGCATACGCGCGCCAATGAAGCCGAACTCGCGACCGCCATGTGCAGTCTGGTT
CAGGTTCATAAAGTCCATATCGATACTGTCCCACGGCAGCGCCGCGTTGAACTGGGTGTG
GAATTGCAGCAACGGTTTGTTGAGCATGGTCAGGCCGTTGATCCACATTTTGGCCGGGGA
GAAGGTGTGCAGCCACACCACCAGACCAGCGCAACGATCGTCGTAATTCGCGTCGCGGCA
AATAGCGGTGATTTCATCCGGCGTGGTGCCCAGCGGTTTCAACACCAGTTTGCAGGGCAG
TTTCGCTTCCGTATTCAGCGCATTAACGACGTGCTCGGCATGTTGGGTGACCTGACGCAG
GGTTTCCGGGCCATACAGATGCTGGCTGCCAATGACAAACCACACTTCATAATTATCAAA
AATCGTCATTATCGTGTCCTTATAGAGTCGCAACGGCCTGGGCAGCCTGTGCCGGGGCGG
AAGTTGGAAGATAGTGTTGTTCGGCGCTCATCGCCCATTGCTGATAGCGGCGATAAAGCT
GTTCAAAGCGTTGTGCCTGCTCGCTGCACGGTTGCAGGGTTTTCTCTACCGCACTGGCCA
TTTTTTGCTGAGCTGATGGGATGTCTGCGTGCACTTTCGCGGCGACGGCAGCAAAAATCG
CCGCACCGAGCGCACAGCACTGGTCAGAGGCAACAATTTGCAGCGGGCGATTCAGCACGT
CGCAGCAGGCCTGCATAATGACCTGGTTTTTCCGCGCGATGCCGCCCAGTGCCATCACGT
TATTAACGGCGATCCCCTGATCGGTAAAGCACTCCATGATTGCGCGTGCGCCAAAGGCGG
TGGCAGCAATCAAACCGCCGAACAGCAGCGGAGCGTCGGTAGCGAGGTTAAGATCGGTAA
TCACCCCTTTCAGGCGTTGGTTAGCGTTCGGTGTGCGGCGGCCGTTAAACCAGTCGAGCA
CCACCGGCAGGTGATCCAGAGACGGATTTTTGGCCCATGCTTCGGTCAGCGCCGGAAGCA
GTTGTTTCTGGCTGGCGTTGATTTGCGTTTTCAGTTCCGGATGCTGGGCGGCAAGCTGTT
CCAGCGGCCAGCCGAGTACGCGACCAAACCAGGCGTAGATATCACCAAACGCCGATTGGC
CTGCTTCCAGACCGATAAATCCAGGCACCACGCTGCCATCAACCTGACCGCAAATACCTT
TAACTGCCCGCTCGCCAACGCTCTGTTTGTCGGCAATCAGAATGTCGCAGGTGGAAGTAC
CGATAACTTTTACCAGTGCGTTAGGCTGTGCGCCTGCGCCAACTGCGCCCATATGGCAGT
CAAACGCGCCGCCGGAAATCACCACGCTTTCAGGCAGGCCGAGACGCTGCGCCCATTCCG
GGCATAAGGTGCCCACCGGAATATCGGCAGTCCAAGTGTCAGTGAACAGCGGGGAAGGCA
AATGGCGATTGAGGATCGGGTCCAGCTCATCAAAGAAACTGGCTGGCGGCAGGCCGCCCC
AGCTTTCGTGCCACAGAGATTTATGCCCGGCGCTGCAACGTCCGCGACGAATATCCTGCG
GGCGGGTGGTACCGGAAAGCAGAGCTGGCACCCAGTCGCACAGCTCAATCCACGATGCGG
CAGATTGCGCCACGGCGCTGTCCTGGCGAGTCACATGCAGGATTTTTGCCCAGAACCATT
CGCTGGAATAAATACCACCAATGTAGCGGGAGTAGTCAACGTTGCCCGGCGCGTGGCACA
AACGGGTAATCTCTTCCGCTTCTTCAACCGCAGTGTGGTCTTTCCACAATACGAACATCG
CGTTCGGGTTTTCGGCAAACTCCGGGCGCAGCGCCAGCACGTTTCCGTCGGCATCAATCG
GTGCGGGCGTCGAGCCGGTACTGTCAACGCCAATCCCGACCACAGCTGCGCGCTGTTCGA
CGCTAAGCTCTGCAAGCACGGTTTTCAGTGCCGCTTCCATTGACTCAATGTAGTCACGCG
GATGATGACGGAACTGGTTATTCGGGGCATCACAAAATTGCCCTTTCTGCCAACGGGGAT
ACCACTCTACGCTGGTGGCGATCTCTTCACCGGTAGCGCAGTCCACCGCCAAAGCTCGCA
CAGAATCACTGCCAAAATCGAGGCCAATTGCAATCGCCATCGTTTCACTCCATCCAAAAA
AACGGGTATGGAGAAACAGTAGAGAGTTGCGATAAAAAGCGTCAGGTAGGATCCGCTAAT
CTTATGGATAAAAATGCTATGGCATAGCAAAGTGTGACGCCGTGCAAATAATCAATGTGG
ACTTTTCTGCCGTGATTATAGACACTTTTGTTACGCGTTTTTGTCATGGCTTTGGTCCCG
CTTTGTTACAGAATGCTTTTAATAAGCGGGGTTACCGGTTGGGTTAGCGAGAAGAGCCAG
TAAAAGACGCAGTGACGGCAATGTCTGATGCAATATGGACAATTGGTTTCTTCTCTGAAT
GGTGGGAGTATGAAAAGTATGGCTGAAGCGCAAAATGATCCCCTGCTGCCGGGATACTCG
TTTAACGCCCATCTGGTGGCGGGTTTAACGCCGATTGAGGCCAACGGTTATCTCGATTTT
TTTATCGACCGACCGCTGGGAATGAAAGGTTATATTCTCAATCTCACCATTCGCGGTCAG
GGGGTGGTGAAAAATCAGGGACGAGAATTTGTCTGCCGACCGGGTGATATTTTGCTGTTC
CCGCCAGGAGAGATTCATCACTACGGTCGTCATCCGGAGGCTCGCGAATGGTATCACCAG
TGGGTTTACTTTCGTCCGCGCGCCTACTGGCATGAATGGCTTAACTGGCCGTCAATATTT
GCCAATACGGGTTTCTTTCGCCCGGATGAAGCGCACCAGCCGCATTTCAGCGACCTGTTT
GGGCAAATCATTAACGCCGGGCAAGGGGAAGGGCGCTATTCGGAGCTGCTGGCGATAAAT
CTGCTTGAGCAATTGTTACTGCGGCGCATGGAAGCGATTAACGAGTCGCTCCATCCACCG
ATGGATAATCGGGTACGCGAGGCTTGTCAGTACATCAGCGATCACCTGGCAGACAGCAAT
TTTGATATCGCCAGCGTCGCACAGCATGTTTGCTTGTCGCCGTCGCGTCTGTCACATCTT
TTCCGCCAGCAGTTAGGGATTAGCGTCTTAAGCTGGCGCGAGGACCAACGCATTAGTCAG
GCGAAGCTGCTTTTGAGCACTACCCGGATGCCTATCGCCACCGTCGGTCGCAATGTTGGT
TTTGACGATCAACTCTATTTCTCGCGAGTATTTAAAAAATGCACCGGGGCCAGCCCGAGC
GAGTTTCGTGCCGGTTGTGAAGAAAAAGTGAATGATGTAGCCGTCAAGTTGTCATAATTG
GTAACGAATCAGACAATTGACGGCTTGACGGAGTAGCATAGGGTTTGCAGAATCCCTGCT
TCGTCCATTTGACAGGCACATTATGCAAGCATTGCTGGAACACTTTATTACCCAATCCAC
CGTGTATTCATTGATGGCGGTGGTGTTGGTGGCCTTTCTGGAGTCGCTGGCGCTGGTCGG
TTTGATTCTACCCGGTACGGTGCTGATGGCGGGGCTGGGAGCGCTGATTGGCAGCGGCGA
GTTAAGTTTCTGGCACGCCTGGCTGGCAGGGATTATTGGCTGCTTGATGGGCGACTGGAT
TTCTTTCTGGCTGGGTTGGCGTTTTAAAAAGCCGTTGCATCGCTGGTCATTTCTGAAGAA
AAACAAAGCACTACTTGATAAAACTGAACATGCGTTGCATCAACACAGCATGTTCACCAT
TCTGGTCGGTCGTTTTGTTGGCCCGACGCGTCCGCTGGTGCCAATGGTGGCGGGAATGCT
GGATCTGCCGGTGGCTAAATTTATTACGCCGAATATTATCGGCTGCCTGCTGTGGCCGCC
GTTTTACTTCCTGCCAGGGATTCTGGCGGGCGCGGCGATCGATATTCCTGCCGGAATGCA
GAGCGGTGAGTTTAAATGGTTGCTGCTGGCAACAGCGGTGTTTTTGTGGGTTGGTGGCTG
GCTGTGCTGGCGGTTATGGCGCAGCGGTAAAGCGACTGACCGTTTGAGTCATTATTTGTC
CCGCGGTCGTTTGTTGTGGCTGACGCCGTTGATTTCTGCCATCGGCGTGGTGGCGCTGGT
GGTGTTAATTCGCCACCCGTTGATGCCGGTGTATATCGATATTTTGCGTAAAGTGGTTGG
GGTTTAGGAGATAGTCTTGTGCGGGTTGCCTGATGCGACGCTTGCCGCGTCTTATCAGGC
CTACAAAACGCACTACCCGTAGGTCGGATAAGGCGTTCACGCCGCATCCGACAGTGCATA
CTAACCCGTAATCCCCAATAGTGCCGAAGCACTCGCCTTACCGCTCAACAACTCATTGGT
CATACCCTGCCAGGCGATGCGCCCGTCGGCGACTACTACCGAGCGCGTGGCGATCCGCGC
CGCATCTTCCACGCTGTGCGACACCATCAATAGCGTCATTTTTTGCTGCTGGCAGCTCGT
GCTCACCAGCGTCAACATCTCCTGACGTAACGCCGGATCGAGCGCAGAGAACGGTTCATC
GAGCAATAAAATCGGCTGTTCGCGTACCAGACAACGCGCTAACGCCACTCGCTGTCGCTG
ACCGCCGGAAAGCTCGCCCGGTAACCGCGCCATTAAATTATCAATCCCCATCTGGCGGGC
GATAGCGTGCATTTTCCCCTGCTGTACCGCGTTCAGTTTCAATCCCGGATTTAGCCCCAG
CCCGATGTTCTGTGCGACCGTCAGGTGGCTGAACAGGTTGTTCTCCTGAAACAGCATCGA
CACCGGACGGCGTGACGGCGGCATAGTTGTGTGATCTACGCCATCGATAGTCAGCGAACC
GCTGGCTGGCGTCAGAAAACCGGCGATCAAATTCAGCAGGGTACTTTTACCCGCGCCGCT
TGGCCCGAGGATCGCCACCTGCTCGCCGCGTTCCACCGTTAAGCTAAAACGCATCGGCAA
ATGGTGGTAAAGCCAGGTGATATCAGTCAGTTTTAACATTTCGCCCCGGTAGTTTTTCAA
TCACGGTAAACAGCAGAAAACAGAGCAGCAGCAGAATTAACGCGGTGACCGCACCGTCCT
GGCTGCGATAGGAGCCAATTTGCTGGTAGAGATAAAACGGCAGGGTGCGGAAATCATCGT
TACCGAACAACGCCACCACGCCAAAATCACCAATCGACAGCACGCATGCAAAGGCCAGCG
CCTGCGCCAGTGGACGTTTCAGGGCGCGCAGCTCCACCACTTTTAAGCGTGACCAGCCTT
CAATCCCCAGCGACTGACATAACATGCTGTAGCGGGCGGTGATATCGCGCATCGGGTTTT
CCAGCACTTTCAGCGCATAAGGGATCGCCATTAACGCATTGGTGAAAATCACAATGCCGT
CAGCAGATTGTGGCAGGCCGATAGTGTTGTTGAGCAGTAAAAAGAAGCCGGTAGCCAGCA
CAATCCCCGGCATGGCGAGGATCAACATGCCGCTCATCTCCAGCACCTGACCCGCCAGCA
TTTTCTGCCGCGCCCGCAGTTCGCGACTGCTCCATAGCAGCATCATGGTCAGCACTACGC
ACAATACACCTGCCGCCAGCGCAATACGCAACGAGGTCCACAGCGCCTGCCACAGCACCG
GTTGTGCCAGCACTTCCGGCAACTGGCGATTTACCCCATCGACGATCACCGCCAGTAACG
GTGGCAGCAACAGCAGCAGCGCCAGCACAATTAACACCGTGTCGCAAATGCGGCTATGCA
GACGATCGTCCGGGTCGCGCCAGCCTTGCAGCAGCGTGGTGCCGGGCGCAATGGCCTTAC
TCAATCGCTGACTCAACAGCACCAGCCCGAGGCAGCACACCATCTGGAGCAGCGCCAGCA
TTGCCGCGCGGGCAGGATCGTAGTCGTAACTCAGCGCCTGATAGATTGCCAGCTCGATAG
TGGTCGCCTGCGGACCGCCCCCCAGCGATAGCACGGTGGCGAAGCTGGCGAAACAGAGCA
TAAAGATAAGCGCAGCAACCGGCGGGATTTGTCGCCGTAACCACGGCCATTCGACGAAGC
GGAAAAAATGCCAGCTACGCATCCCAAGCTGGGCGGCAAGTTGACGCTGTTCGCCGGGGA
TGTTTTCCAGTGCCTGGAGTAATAAGCGGCTCGCCATCGGCAGATTAAAAAACACATGGG
CCAGCAAAATACCTTGCAGGCCGTAGGGCGAAAAGGTCCACTCCAGACCGAGCGATTGGC
AGAGTGTTGCCAGCCAGCCCTGGCGACCATAGACGCTAAGAATGCCGAAAACAGCGACCA
ACACCGGGAGGATCAAGGTCATTGCACACAGACGCAACAGCGCCAGCCGACCCGGAAAGC
GCCTGCGATAGAGCGCGCGGGCGAGGAATATCGCGGGTATGACAGAGAGCAGTGCCGAGA
GAAACGCCTGCCAGAAGGAGAAGCGCACCACATGCCACAGATAGCTGTCCTGCCAGACTG
CCACCCAGTCATCCTGCGGCGCGTTCCACCACAGGGCGAGAAACGCCGCCAGCGCAACCG
CTACCACCAGCGTGGTGGCGCTTACACCTGGAATTAACCAGCCGGGAATTAACGGCTGAC
GGCGCGTTGCCATTCGCTAATCCATGCCTGACGTTGTGCCGCCACTTCGGCTGGCGTGAA
CTCCAACGTGGTTGCGGGTTTGGTCAATTTTTCAAAACCGGCAGGCAGCGTGACGTTTGC
CACCGGATACATCCAGTTGCCGGTTGGGATCGCATTCTGGAAAGCCGGAGAAACCATAAA
CTGGAGGAATTTTTGCGCCAGCTCCGGCTGCTTGCTGGCAGCGGTGCGGGCGGCGACTTC
CACTTGCAGATAGTGACCTTCGCTGAAGTTCGCGGCGGCGTAGTTATCTTTCTTCTCTTC
GAGAATGTGATAAGCCGGAGAGGTGGTGTAACTCAGTACCAGATCGCTTTCACCTTTTAA
AAACAGGCCGTAGGCTTCGCTCCAGCCTTTGGTGACCGTGACCGTTTTCTTCGCCAGTTT
CTGCCAGGCTTGTGGGGCGTCATCGCCATAGACTTTTTGCATCCATAGCAACAGACCCAG
CCCCGGTGTACTGGTGCGCGGATCCTGATAAATCACCCGCCAGTTTTGATCGCTCTCAAC
CAGTTCTTTCAGGCTTTGTGGCGGGTTTTTCAGTTTGTTCTTGTCATAAACGAAGGCGAA
GTAGCCATAATCAAACGGTACGAAAGTGTCATTATTCCAGCCGCCGGGAACGTTAACGGC
ATCCGCTGCCACACCGCTTTTGGCAAACAGTCCGGTTTTACTGGCGGCGTCTAACAGGTT
GTTATCCAGCCCCAGCACCACATCGGCTTTACTGTTTTTGCCTTCCATCCGTAGACGGTT
GAGAAGCGAAACGCCATCTTCCAGCGCCACCAGTTTCAGTTCGCAATTACAGTCGGCTTC
AAAGGCTTTTTTAACCACCGGACCAGGCCCCCAGTCGGCGGCGAAGGAATCGTAGGTATA
AACAGTCAGAACGGGTTTAGCGAAAACGGGCGCTGTGCACAGCAACAGCAGGGGCAGACA
TTTTTTTAACACTTTGCACCTCAAAAAAGAGTGGCAAAGGACTTGAGAAGGAGCCTCAAA
TCCCTTCGCCGGCGTTATCCGGATCAGGTTCGACGGGTATTTTCTCAGCGCACGCGTACG
CGTGGCACCCCGTTGAGAACGGCGTTAGTGTAGTGATTTTGTTATCAACCAGCAATCATG
GATCCGGTGGCGCAAACCACGCTGATTTAAAATCGAACCAGCCGAGGGTATTCATGCGCA
GGCCGCGCATACTGCGTTGCCCCTGAATGATCAGCCAGTGGTGCAATAATGGCACCATCG
CTTTGCTGGCGACCAGTTGCTGGCACCAGTTCGCCAGATTCATCTCGCCATTGCGCCAGC
GAGCAGCGTCGGCTTGCCAGTCAATGGGAATGCAATGTTGTAGCAGTGGCACTTCGCATA
AATGTGCGAAAACAGAGAAGTCCAGCGGCAGGGTAAAGTTGGCGCTGTTTAGCCAGATAT
CACTTTCGATCTCTCCTGTATGCCACTGATCGTAGTCGATCTCTTTGATTTTCAGCGTGA
CCTGGTGACTTGCCAGAATCTGCTGCATGATCCCGGCAATCACCCGATGCTCACTGTGAT
CCTGATAAAAGGTTAGGGTGAGGCTTTCCAGGCCAGCCGGTTTTTCGCTCTTTATGGTGC
GGGCATGGTGCCAACGGGGGAGCAGTCCATAAGCCGGGAACCACAGTTGCTGGTACTGTT
CCTCAGCGAAATAGACCAGATTAGTTGGAGAAAGCACATAGCTTACCCAGTCCCTGACTT
GCTGATTCGCCCCGCGATGGGTGCGGCTGTCGAACAGTAAATAGTAGCAACCTTCCTCCA
GGCGGCTTTCAATCTCTTTTTCCTCGCCCTGTGGACCTTTTAGCATCAGCCCTCCGGCTG
GCTCGTCGGCAATTTCCGGCAGAACCCAGACGTTAACTTCGTCGATTAATGCCCGGTAAC
CGAAGAAGTCATCGAATGCCTGAATTTTCAGTTGATTGGTGCTGTTGCGAATCACCGCAT
ACGGACCGGTGCCGATGGGATGGCTGGCAAAGTTACTGAGGGTTTCCCATTCGCGCGGCA
GGATCATCGCCGGAACTTGCCCCAGCAGTAACGGTAACCAGCGGTCCGGTTGCGTGAGAT
GGATATCCAGCGTCCAGGGCGTCGGCGACACAATGTCAGCAATATGCGAATAGAGCGGCA
GCGTATTGATTCGTTTTAAAGAGGCGATCACATCGTCCATTTCCAGTTCACGACCATGGT
GAAAATGGACTCCTGGACGCAAAAAGAAACGCCAGTGAAGCGGTGAAATTTGCTGCCAGT
GGTGGGCGATGTCTGCTTCCAGTTCCCCATTTTCCTCATTTATGCGCGTTAGCGAACTGA
AGATTTGCCGGGCGATATGGGTTTCGGAACGGCGCAATGCGCTGCCAGGTAGCAGATTAC
GCAACGGACGATAGTAGAGCACGCGCAGGATGTGCCGCCCCTGGCGGAAGCTGCGGCCCA
GATGAGAAACCAGCATTTGCCGCACAGTCGCTTTGTCGCCAACCAACTGCACCAGTTGAT
CGATACGATCCTGCTCCAGCAGGTCTTCCGCCCGCTGTTGCTGAAGCGCCAGCCCGGTAT
AGAGGAATGTCAGACGCGAGCGTTTACCGCGCCCGACTTCCGCTTCCCACGTCAGCCAGC
CGCGATCCTGCATGGTGTTGAGCAGGGTGCGCATATGACGACGCGAGCAGCTCAATAACG
CTGCCAGTTCGTTGAGCGTTGTGTCCTGCGATTTACCCTCGCAGCATTGCCACAGGCGGA
TGAACTGTTGTTGCAGACGAGCAGATGGCATAAAAGGGGAACTCCTGTGCAAAAGACAGC
AATTTTATTTTCCCTATATTAAGTCAATAATTCCTAACGATGAAGCAAGGGGGTGCCCCA
TGCGTCAGTTTTATCAGCACTATTTTACCGCGACAGCGAAGTTGTGCTGGTTGCGTTGGT
TAAGCGTCCCACAACGATTAACCATGCTTGAAGGACTGATGCAGTGGGATGACCGCAATT
CTGAAAGTTGACTTGCCTGCATCATGTGTGACTGAGTATTGGTGTAAAATCACCCGCCAG
CAGATTATACCTGCTGGTTTTTTTTATTCTCGCCGCGCTAAAAAGGGAACGTATGATCTG
GATAATGACGATGGCTCGCCGTATGAACGGTGTTTACGCGGCATTTATGCTGGTCGCTTT
TATGATGGGGGTGGCCGGGGCGCTACAGGCTCCTACATTGAGCTTATTTCTGAGTCGTGA
GGTTGGCGCGCAACCTTTCTGGATCGGCCTCTTTTATACGGTGAATGCTATTGCTGGGAT
CGGCGTAAGCCTCTGGTTGGCAAAACGTTCTGACAGTCAGGGCGATCGGCGAAAACTGAT
TATATTTTGCTGTTTGATGGCTATCGGCAATGCGCTATTGTTTGCATTTAATCGTCATTA
TCTGACGCTTATCACCTGTGGTGTGCTTCTGGCATCTCTGGCCAATACGGCAATGCCACA
GTTATTTGCTCTGGCGCGGGAATATGCGGATAACTCGGCGCGAGAAGTGGTGATGTTTAG
CTCGGTGATGCGTGCGCAGCTTTCTCTGGCATGGGTTATCGGTCCACCGTTGGCCTTTAT
GCTGGCGTTGAATTACGGCTTTACGGTGATGTTTTCGATTGCCGCCGGGATATTCACACT
CAGTCTGGTATTGATTGCATTTATGCTTCCGTCTGTGGCGCGGGTAGAACTGCCGTCGGA
AAATGCTTTATCAATGCAAGGTGGCTGGCAGGATAGTAACGTACGGATGTTATTTGTCGC
CTCGACGTTAATGTGGACCTGCAACACCATGTACATTATTGATATGCCGTTGTGGATCAG
TAGCGAGTTAGGATTGCCAGACAAACTGGCGGGTTTCCTGATGGGGACGGCAGCTGGACT
GGAAATACCAGCAATGATTCTGGCTGGCTACTATGTCAAACGTTATGGTAAGCGGCGAAT
GATGGTCATAGCAGTGGCGGCAGGAGTACTGTTTTACACCGGATTGATTTTCTTTAATAG
CCGTATGGCGTTGATGACGCTGCAACTTTTTAACGCTGTATTTATCGGCATTGTTGCGGG
TATTGGGATGCTATGGTTTCAGGATTTAATGCCTGGAAGAGCGGGGGCAGCTACCACCTT
ATTTACTAACAGTATTTCTACCGGGGTAATTCTGGCTGGCGTTATTCAGGGAGCAATTGC
ACAAAGTTGGGGGCACTTTGCTGTCTACTGGGTAATTGCGGTTATTTCTGTTGTCGCATT
ATTTTTAACCGCAAAGGTTAAAGACGTTTGATGACGTGGACGATAGCGGAAAGCCCGGTC
ATTTGACCGGGCAAGGGGATTAATTCATAAACGCAGGTTGTTTTGCTTCATAAGCGGCAA
TGGCGTCGTCGTGCTGCAAGGTAAGCCCAATACTGTCCAGACCGTTCATCATGCAGTGGC
GGCGGAAGGCATCGATGGTAAAGCGATAGGTTTTCTCTCCCGCTTTCACCTCTTGCGCTT
CCAGATCCACGTCGAAATGGATCCCCGGATTAGCTTTCACCAGCGCAAACAGTTCGTCCA
CTTCTGCATCGCTTAATTTCACCGGCAGCAGCTGGTTGTTAAAGCTATTGCCGTAGAAGA
TGTCAGCAAAACTCGGCGCAATCACCACTTTAAAACCGTAGTCGGTCAATGCCCAGGGCG
CGTGCTCACGCGAAGAGCCACAGCCGAAGTTTTCTCGTGCCAGCAAAATGGAAGCGCCCT
GATACTGCGGGAAGTTCAGCACGAAGTCCGGGTTTGGCTGTTGGCCTTTTTCATCCAGAA
AACGCCAGTCGTTAAACAGATGCGCGCCAAAACCCGTACGGGTCACTTTCTGCAAAAACT
GTTTCGGGATGATTGCATCGGTATCGACATTGGCGGCATCCAGCGGAACCACCAGGCCTG
TGTGTTTGATAAATTTCTCTGCCATGGTGTGCTCCTTATTTAATGTTGCGAATGTCGGCG
AAATGTCCGGTCACAGCAGCAGCGGCAGCCATTGCCGGGCTGACCAGATGCGTGCGCCCG
CCGCGCCCCTGGCGGCCTTCAAAGTTACGGTTGCTGGTGGAGGCACAACGTTCGCCCGGA
TTCAGACGGTCGTTGTTCATCGCCAGACACATTGAGCAGCCAGGCAAGCGCCATTCAAAA
CCGGCTTCAATAAAGATTTTATCCAGACCTTCCGCTTCCGCCTGGGCTTTTACCGGGCCA
GAGCCGGGAACCACCAGTGCCTGCACGCCTGGCGCGACTTTTCGCCCTTTGGCGATCTCC
GCTGCCGCGCGTAAATCTTCAATGCGCGAGTTGGTACAGGAACCGATAAACACTTTGTCG
ATAGCCACTTCGGTCAGCGGAATACCCGGTTTCAGCCCCATATAGGCCAGCGCTTTTTCT
GCCGACGCGCGTTCAACCGGATCGGCAAACGAAGCCGGATCGGGAATATTGTCGTTCACG
GAAATCACCTGGCCGGGATTGGTGCCCCAGGTGACCTGCGGTGAAATTTCTTCTGCTTGC
AGAGTGACAACGGTATCGAAAGTTGCGCCTTCGTCGGTTTGCAGGGTTTTCCAGTAGGCA
ACGGCGTCGTCGAAATCTTTGCCTTTCGGCGCATGCAGACGGCCTTTGACATAGTTAAAG
GTGGTTTCGTCCGGTGCAACCAGACCGGCTTTTGCGCCCATTTCGATTGCCATATTGCAC
AGGGTCATACGACCTTCCATGCTTAAATCACGGATTGCTTCGCCGCAAAACTCCACCACA
TGCCCGGTGCCGCCTGCGCTACCGGTTTTACCGATAATTGCCAGCACGATATCTTTTGCG
GTAATGCCCGGCGCGGCTTTGCCCTGGACTTCAATTTTCATGGTTTTTGCGCGGCCCTGT
TTCAGGGTTTGCGTTGCCAGTACGTGTTCAACTTCGGAAGTGCCGATACCAAAGGCCAGT
GCGCCAAACGCGCCGTGGGTGGCGGTATGCGAGTCGCCGCAGACAATGGTCATCCCCGGC
AAGGTGACGCCCTGTTCCGGCCCCATTACGTGGACGATCCCCTGATACGGGTGATTCAGG
TCATACAGTTCGACGCCAAATTCTTTGCAGTTTTTGATCAGTTCCTGCATCTGGATACGC
GCCATTTCACCGCAGGCATTAATGTCTTTGGTCTGGGTAGAGACGTTGTGATCCATGGTA
GCGAAGGTTTTGCCCGGCTGACGTACCGGGCGACCGTGGGCGCGCAGACCATCGAACGCC
TGCGGTGAGGTCACTTCATGCACCAGGTGGCGGTCGATATATAACAGTGGGGTTTCGTTT
TCGGCTTCGTACACAACGTGAGCGTCGAACAATTTTTCGTATAACGTCTTAGCCATGATT
ACACCCCTTCTGCTACATAGCGGGCAATGATATCGCCCATTTCATCGGTACTAACGGCGG
CAGCGCCACGGGCTAAATCCCCGGTGCGAATGCCTTCTTCTAATGCGCGGTTAATGGCGC
GTTCAATGGCGCAAGCCGCATCATCGGCATCCAGGCTGTAACGCAGCAGCAGTGCCAGCG
AAAGGATTTGTGCAATCGGGTTGGCGATGTTTTTGCCTGCGATATCTGGTGCCGAGCCGC
CCGCCGGTTCATACAGTCCAAAACCTTGCTCGTTCAGGCTGGCGGAAGGCAACATCCCCA
TCGAGCCAGTGATCATTGCGCACTCGTCAGACAGAATGTCGCCAAACAGGTTGGAGCACA
GCAGAACGTCAAACTGTGATGGATCTTTAATCAGCTGCATGGTGGCGTTGTCGATGTACA
TATGCGCCAGTTCGACATCCGGGTATTCCGTGGCGATCTCGTTAACGATCTCCCGCCATA
AAATAGAGGATTGCAGCACGTTGGCTTTATCGATCGACGTCACTTTGTGGCGACGCTTGC
GAGCAGATTCAAACGCGATGCGGGCGATACGTTCGATCTCAAAACGGTGATACACCTCGG
TATCAAAGGCTTTTTCATATTGTCCGCTACCTTCGCGGCCTTTTGGCTGACCGAAATAGA
TGCCGCCGGTCAGTTCGCGCACACACAGGATGTCGAAGCCGTTTGCGGCAATGTCTGCAC
GCAGCGGACAGAATGCTTCCAGCCCCTGATACAGTTTTGCCGGGCGCAGGTTGCTGAATA
ATTTGAAGTGCTTACGCAGAGGCAGCAGCGCGCCGCGTTCTGGTTGCTGGTCTGGTGGTA
AATGTTCCCACTTCGGGCCGCCTACCGAGCCAAACAGCACGGCATCGGCTTGCTCACAAC
CTTCAACCGTCGCAGGCGGCAGTGGTTGCCCGTGGTTATCAATGGCTGCGCCGCCTACAT
CGTAATGGCTGGTGGTGATGCGCATCGCAAAGCGGTTGCGCACGGCATCCAGCACTTTCA
GCGCCTGGGTCATCACTTCCGGACCAATACCGTCCCCCGGCAATACGGCAATATGGTAAT
TCTTCGACATCACACGGTTTCCTTGTTGTTTTCGTTGTGTTGAGCTTTGCGTTGCAACTC
TTTTTCGACTTCTGCGGCACGCCAGATATTGTTCAGAACGTGCACCATGGCTTTGGCAGA
TGACTCGACAATATCGGTAGCCAGGCCGACGCCGTGGAAGCGGCGACCGTTGTAGTTAGC
GACGATATCCACCTGACCCAGCGCATCTTTACCGTGGCCTTTGGCGGTCAGGCTGTATTT
CACCAGTTCGACGTTATATTCAGTGATGCGGTTAATTGCCTGATAGACGGCATCGACCGG
ACCGTTACCGTTGGCGGCTTCTGCTTTGACTTCTTCGCCACAGGCCAGTTTGACGGCGGC
GGTGGCGATATCGTTAGAGCCAGACTGCACGCTGAAGTAATCCAGACGGAAATGCTCCGG
CTCTTCTTGCTGCTTACCGATGAAGGCCAGCGCCTCCAGATCGTAATCAAACACCTGACC
TTTTTTGTCCGCCAGCTTCAGGAAAGCATCGTACAAATTGTCTAAATTATATTCACTTTC
TTTATACCCCATCTCATCCATGCGATGTTTCACCGCCGCACGCCCCGAACGAGAGGTCAG
ATTCAGCTGGATTTGGTTCAGACCAATAGATTCTGGTGTCATGATTTCGTAGTTTTCGCG
GTTTTTCAGCACGCCATCCTGGTGTATACCGGAGGAGTGTGCGAATGCGCCGCTGCCAAC
AATGGCTTTGTTTGCCGGGATCGGCATATTACAAATCTGGCTAACTAACTGGCTGGTGCG
CCATATCTCCTGGTGATTAATGGCGGTGTGGACGTTGAGAATATCCTTACGAACTTTGAT
CGCCATGATGACTTCTTCCAGGGAACAGTTTCCGGCACGCTCGCCGATCCCGTTCATTGC
GCCTTCCACCTGGCGTGCACCGGCATGTACCGCCGCCAGTGAGTTTCCGACCGCCAGGCC
CAAATCGTCGTGGGTATGTACGGAGATAATGGCTTTGTCGATGTTAGGCACGCGTTCATA
CAGGCCGCTGATGATTCCGGCGAACTCAAACGGCATGGTGTAGCCCACGGTGTCCGGAAT
GTTGATGGTGGTGGCACCGGCATTAATCGCCGCTTCGACCACTCGCGCCAGATCGGCAAT
GGGTGTACGCCCGGCATCTTCGCAAGAAAATTCAACATCATCGGTGTAATTACGGGCGCG
TTTCACCATATAGATAGCGCGTTCGATCACCTCGTCCAGCGTGCTGCGCAGCTTGGTGGC
GATGTGCATTGGCGAAGTGGCAATAAAGGTATGAATACGGAAGGCTTCGGCGACTTTCAG
GGATTCGGCCGCCACGTCGATATCTTTTTCCACGCAGCGAGCTAACGCACATACGCGGCT
GTTTTTAACCTGGCGGGCGATGGTTTGCACCGATTCAAAATCGCCCGGCGAAGAGACGGG
GAAACCGACTTCCATCACGTCAACACCCATACGCTCAAGGGCCAGCGCAATTTGCAGTTT
TTCTTTCACACTCAAGCTTGCCTGTAACGCCTGTTCACCGTCGCGCAATGTGGTATCGAA
AATAATGACTTGCTGGCTCATGGTTTGGGTCCTTGTCTCTTTTAGAGCGCCTCGCTTCGG
GCATAAAAAAACCCGCGCAATGGCGCGGGTTTTTTGTTTGACTGCGTGCTGGCTTAATGC
TGGATGCCGCTCACTCGTCTACCGCGCAAAGAAGATGCGTTTAGTAGTAGTAGACCGATA
AAGCGAACGATGTGAGTCATTAAATCAGCTCCAGATGAATGCGATATGCTTTTAGAGTTA
CTGGATACAAAAACGGATGTCAACCCTGACGCAATAAAAACGTCCCGCCAGCGTGAGTTC
TGCATCCGTAAAATTAGCTAATTGTGCTGCGGTGGTTAAAGTAAGCGATATTAATTTCTG
CTTAACTACCGACGCTTTTCATCGGTTGACATATTTCAGCATAAATTTTTGCATCTAATC
AACGAGGAAAAAGGGGACAAAATGCACGCGTTGCAAAACCTATCCTGATGATTTGTATTG
AATTATATGTTTTGCGATTTTTTTTGATATTGATTTGGTGAATATTATTGATCAATTAAT
GTTAAGAATTAATGCATTAAATATATAAATTAATTATTAAATAAGCACATTTAATCCATT
TTGTAGATGATTGAGTATTCGCGGTAGTTATGATTAGATTGTTTTCGCAACAAAAACATT
ATGGATTATTATGCTGTGGTAAATGACTCATTCCACGGCAATGGATTCTGTTTTTATCAG
AACCCGTATCTTTATGTTTTCCGAATTTTACTCATTTTGCTTTTTCTTATTTTATATGCA
TGATAAATCATATTCTTCAGGATTATTTCTCTGCATTCCAATAAGGGAAAGGGAGTTAAG
TGTGACAGTGGAGTTAAGTATGCCAGAGGTACAAACAGATCATCCAGAGACGGCGGAGTT
AAGCAAACCACAGCTACGCATGGTCGATCTCAACTTATTAACCGTTTTCGATGCCGTGAT
GCAGGAGCAAAACATTACTCGTGCCGCTCATGTTCTGGGAATGTCGCAACCTGCGGTCAG
TAACGCTGTTGCACGCCTGAAGGTGATGTTTAATGACGAGCTTTTTGTTCGTTATGGCCG
TGGTATTCAACCGACTGCTCGCGCATTTCAACTTTTTGGTTCAGTTCGTCAGGCATTGCA
ACTAGTACAAAATGAATTGCCTGGTTCAGGTTTTGAACCCGCGAGCAGTGAACGTGTATT
TCATCTTTGTGTTTGCAGCCCGTTAGACAGCATTCTGACCTCGCAGATTTATAATCACAT
TGAGCAGATTGCGCCAAATATACATGTTATGTTCAAGTCTTCATTAAATCAGAACACTGA
ACATCAGCTGCGTTATCAGGAAACGGAGTTTGTGATTAGTTATGAAGACTTCCATCGTCC
TGAATTTACCAGCGTACCATTATTTAAAGATGAAATGGTGCTGGTAGCCAGCAAAAATCA
TCCAACAATTAAGGGCCCGTTACTGAAACATGATGTTTATAACGAACAACATGCGGCGGT
TTCGCTCGATCGTTTCGCGTCATTTAGTCAACCTTGGTATGACACGGTAGATAAGCAAGC
CAGTATCGCGTATCAGGGCATGGCAATGATGAGCGTACTTAGCGTGGTGTCGCAAACGCA
TTTGGTCGCTATTGCGCCGCGTTGGCTGGCTGAAGAGTTCGCTGAATCCTTAGAATTACA
GGTATTACCGCTGCCGTTAAAACAAAACAGCAGAACCTGTTATCTCTCCTGGCATGAAGC
TGCCGGGCGCGATAAAGGCCATCAGTGGATGGAAGAGCAATTAGTCTCAATTTGCAAACG
CTAACTGATTGCAGAATAGGTCAGACATGAATGTCTGGTTTATTCTGCATTTTTTATTGA
ATGTAGAATTTTATTCTGAATGTGTGGGCTCTCTATTTTAGGATTAATTAAAAAAATAGA
GAAATTGCTGTAAGTTGTGGGATTCAGCCGATTTATTATCAATTTAATCCTCTGTAATGG
AGGATTTTATCGTTTCTTTTCACCTTTCCTCCTGTTTATTCTTATTACCCCGTGTTTATG
TCTCTGGCTGCCAATTGCTTAAGCAAGATCGGACGGTTAATGTGTTTTACACATTTTTTC
CGTCAAACAGTGAGGCAGGCCATGGAGATGTTGTCTGGAGCCGAGATGGTCGTCCGATCG
CTTATCGATCAGGGCGTTAAACAAGTATTCGGTTATCCCGGAGGCGCAGTCCTTGATATT
TATGATGCATTGCATACCGTGGGTGGTATTGATCATGTATTAGTTCGTCATGAGCAGGCG
GCGGTGCATATGGCCGATGGCCTGGCGCGCGCGACCGGGGAAGTCGGCGTCGTGCTGGTA
ACGTCGGGTCCAGGGGCGACCAATGCGATTACTGGCATCGCCACCGCTTATATGGATTCC
ATTCCATTAGTTGTCCTTTCCGGGCAGGTAGCGACCTCGTTGATAGGTTACGATGCCTTT
CAGGAGTGCGACATGGTGGGGATTTCGCGACCGGTGGTTAAACACAGTTTTCTGGTTAAG
CAAACGGAAGACATTCCGCAGGTGCTGAAAAAGGCTTTCTGGCTGGCGGCAAGTGGTCGC
CCAGGACCAGTAGTCGTTGATTTACCGAAAGATATTCTTAATCCGGCGAACAAATTACCC
TATGTCTGGCCGGAGTCGGTCAGTATGCGTTCTTACAATCCCACTACTACCGGACATAAA
GGGCAAATTAAGCGTGCTCTGCAAACGCTGGTAGCGGCAAAAAAACCGGTTGTCTACGTA
GGCGGTGGGGCAATCACGGCGGGCTGCCATCAGCAGTTGAAAGAAACGGTGGAGGCGTTG
AATCTGCCCGTTGTTTGCTCATTGATGGGGCTGGGGGCGTTTCCGGCAACGCATCGTCAG
GCACTGGGCATGCTGGGAATGCACGGTACCTACGAAGCCAATATGACGATGCATAACGCG
GATGTGATTTTCGCCGTCGGGGTACGATTTGATGACCGAACGACGAACAATCTGGCAAAG
TACTGCCCAAATGCCACTGTTCTGCATATCGATATTGATCCTACTTCCATTTCTAAAACC
GTGACTGCGGATATCCCGATTGTGGGGGATGCTCGCCAGGTCCTCGAACAAATGCTTGAA
CTCTTGTCGCAAGAATCCGCCCATCAACCACTGGATGAGATCCGCGACTGGTGGCAGCAA
ATTGAACAGTGGCGCGCTCGTCAGTGCCTGAAATATGACACTCACAGTGAAAAGATTAAA
CCGCAGGCGGTGATCGAGACTCTTTGGCGGTTGACGAAGGGAGACGCTTACGTGACGTCC
GATGTCGGGCAGCACCAGATGTTTGCTGCACTTTATTATCCATTCGACAAACCGCGTCGC
TGGATCAATTCCGGTGGCCTCGGCACGATGGGTTTTGGTTTACCTGCGGCACTGGGCGTC
AAAATGGCGTTGCCAGAAGAAACCGTGGTTTGCGTCACTGGCGACGGCAGTATTCAGATG
AACATCCAGGAACTGTCTACCGCGTTGCAATACGAGTTGCCCGTACTGGTGGTGAATCTC
AATAACCGCTATCTGGGGATGGTGAAGCAGTGGCAGGACATGATCTATTCCGGCCGTCAT
TCACAATCTTATATGCAATCGCTACCCGATTTCGTCCGTCTGGCGGAAGCCTATGGGCAT
GTCGGGATCCAGATTTCTCATCCGCATGAGCTGGAAAGCAAACTTAGCGAGGCGCTGGAA
CAGGTGCGCAATAATCGCCTGGTGTTTGTTGATGTTACCGTCGATGGCAGCGAGCACGTC
TACCCGATGCAGATTCGCGGGGGCGGAATGGATGAAATGTGGTTAAGCAAAACGGAGAGA
ACCTGATTATGCGCCGGATATTATCAGTCTTACTCGAAAATGAATCAGGCGCGTTATCCC
GCGTGATTGGCCTTTTTTCCCAGCGTGGCTACAACATTGAAAGCCTGACCGTTGCGCCAA
CCGACGATCCGACATTATCGCGTATGACCATCCAGACCGTGGGCGATGAAAAAGTACTTG
AGCAGATCGAAAAGCAATTACACAAACTGGTCGATGTCTTGCGCGTGAGTGAGTTGGGGC
AGGGCGCGCATGTTGAGCGGGAAATCATGCTGGTGAAAATTCAGGCCAGCGGTTACGGGC
GTGACGAAGTGAAACGTAATACGGAAATATTCCGTGGGCAAATTATCGATGTCACACCCT
CGCTTTATACCGTTCAATTAGCAGGCACCAGCGGTAAGCTTGATGCATTTTTAGCATCGA
TTCGCGATGTGGCGAAAATTGTGGAGGTTGCTCGCTCTGGTGTGGTCGGACTTTCGCGCG
GCGATAAAATAATGCGTTGAGAATGATCTCAATGCGCAATTTACAGCCCAACATGTCACG
TTGGGCTTTTTTTGCGAAATCAGTGGGAACCTGGAATAAAAGCAGTTGCCGCAGTTAATT
TTCTGCGCTTAGATGTTAATGAATTTAACCCATACCAGTACAATGGCTATGGTTTTTACA
TTTTACGCAAGGGGCAATTGTGAAACTGGATGAAATCGCTCGGCTGGCGGGAGTGTCGCG
GACCACTGCAAGCTATGTTATTAACGGCAAAGCGAAGCAATACCGTGTGAGCGACAAAAC
CGTTGAAAAAGTCATGGCTGTGGTGCGTGAGCACAATTACCACCCGAACGCCGTGGCAGC
TGGGCTTCGTGCTGGACGCACACGTTCTATTGGTCTTGTGATCCCCGATCTGGAGAACAC
CAGCTATACCCGCATCGCTAACTATCTTGAACGCCAGGCGCGGCAACGGGGTTATCAACT
GCTGATTGCCTGCTCAGAAGATCAGCCAGACAACGAAATGCGGTGCATTGAGCACCTTTT
ACAGCGTCAGGTTGATGCCATTATTGTTTCGACGTCGTTGCCTCCTGAGCATCCTTTTTA
TCAACGCTGGGCTAACGACCCGTTCCCGATTGTCGCGCTGGACCGCGCCCTCGATCGTGA
ACACTTCACCAGCGTGGTTGGTGCCGATCAGGATGATGCCGAAATGCTGGCGGAAGAGTT
ACGTAAGTTTCCCGCCGAGACGGTGCTTTATCTTGGTGCGCTACCGGAGCTTTCTGTCAG
CTTCCTGCGTGAACAAGGTTTCCGTACTGCCTGGAAAGATGATCCGCGCGAAGTGCATTT
CCTGTATGCCAACAGCTATGAGCGGGAGGCGGCTGCCCAGTTATTCGAAAAATGGCTGGA
AACGCATCCGATGCCGCAGGCGCTGTTCACAACGTCGTTTGCGTTGTTGCAAGGAGTGAT
GGATGTCACGCTGCGTCGCGACGGCAAACTGCCTTCTGACCTGGCAATTGCCACCTTTGG
CGATAACGAACTGCTCGACTTCTTACAGTGTCCGGTGCTGGCAGTGGCTCAACGTCACCG
CGATGTCGCAGAGCGTGTGCTGGAGATTGTCCTGGCAAGCCTGGACGAACCGCGTAAGCC
AAAACCTGGTTTAACGCGCATTAAACGTAATCTCTATCGCCGCGGCGTGCTCAGCCGTAG
CTAAGCCGCGAACAAAAATACGCGCCAGGTGAATTTCCCTCTGGCGCGTAGAGTACGGGA
CTGGACATCAATATGCTTAAAGTAAATAAGACTATTCCTGACTATTATTGATAAATGCTT
TTAAACCCGCCCGTTAATTAACTCACCAGCTGAAATTCACAATAATTAAGTGATATCGAC
AGCGCGTTTTTGCATTATTTTGTTACATGCGGCGATGAATTGCCGATTTAACAAACACTT
TTCTTTGCTTTTGCGCAAACCCGCTGGCATCAAGCGCCACACAGACGTAACAAGGACTGT
TAACCGGGGAAGATATGTCCTAAAATGCCGCTCGCGTCGCAAACTGACACTTTATATTTG
CTGTGGAAAATAGTGAGTCATTTTAAAACGGTGATGACGATGAGGGATTTTTTCTTACAG
CTATTCATAACGTTAATTTGCTTCGCACGTTGGACGTAAAATAAACAACGCTGATATTAG
CCGTAAACATCGGGTTTTTTACCTCGGTATGCCTTGTGACTGGCTTGACAAGCTTTTCCT
CAGCTCCGTAAACTCCTTTCAGTGGGAAATTGTGGGGCAAAGTGGGAATAAGGGGTGAGG
CTGGCATGTTCCGGGGAGCAACGTTAGTCAATCTCGACAGCAAAGGGCGCTTATCAGTGC
CTACCCGTTATCGGGAACAGCTGCTTGAGAACGCTGCCGGTCAAATGGTTTGCACCATTG
ACATTTATCACCCGTGCCTGCTGCTTTACCCCCTGCCTGAATGGGAAATTATCGAGCAAA
AATTATCGCGTCTGTCGAGCATGAACCCGGTTGAGCGCCGTGTGCAGCGCCTACTGTTAG
GTCATGCCAGCGAATGTCAGATGGATGGCGCAGGTCGATTGTTAATCGCGCCAGTACTGC
GGCAACATGCCGGGCTGACAAAAGAAGTGATGCTGGTTGGACAGTTCAACAAGTTTGAGC
TGTGGGATGAAACAACCTGGCATCAACAGGTCAAGGAAGATATCGACGCAGAGCAGTTGG
CTACCGGAGACTTATCGGAGCGACTGCAGGACTTGTCTCTATAAAATGATGGAAAACTAT
AAACATACTACGGTGCTGCTGGATGAAGCCGTTAATGGCCTCAATATCCGTCCTGATGGC
ATCTACATTGATGGGACTTTTGGTCGCGGTGGTCACTCACGTCTGATCCTCTCGCAGCTT
GGCGAAGAGGGGCGTTTGCTGGCGATCGATCGCGACCCGCAGGCTATCGCCGTTGCGAAG
ACTATTGATGATCCGCGCTTCTCCATCATCCACGGACCTTTCTCCGCGCTGGGCGAATAC
GTTGCCGAGCGCGATCTTATCGGCAAGATCGACGGCATTCTCCTCGATCTTGGCGTCTCT
TCACCGCAACTTGATGATGCTGAACGTGGCTTTTCCTTTATGCGCGATGGTCCGCTGGAC
ATGCGTATGGACCCAACCCGTGGGCAGTCAGCCGCTGAATGGCTACAAACCGCAGAAGAA
GCCGATATCGCCTGGGTATTGAAAACCTATGGTGAAGAGCGTTTTGCCAAACGCATTGCC
CGCGCCATTGTCGAGCGTAACCGCGAACAGCCGATGACCCGCACCAAAGAACTGGCGGAA
GTCGTGGCTGCTGCAACGCCGGTGAAAGATAAGTTTAAACATCCCGCGACCCGTACCTTC
CAGGCGGTGCGCATTTGGGTAAACAGTGAACTGGAGGAGATAGAGCAGGCGCTAAAAAGC
TCGCTCAACGTGCTGGCCCCGGGTGGGCGGCTTTCGATCATCAGCTTCCACTCGCTGGAA
GACCGTATTGTGAAACGTTTTATGCGTGAAAACAGCCGCGGTCCGCAAGTTCCGGCAGGG
TTACCGATGACTGAAGAGCAGCTCAAAAAACTGGGTGGCCGTCAGCTGCGAGCACTAGGC
AAGTTAATGCCGGGCGAAGAAGAGGTGGCTGAGAACCCTCGTGCCCGTAGTTCAGTTCTG
CGTATTGCAGAGAGGACGAATGCATGATCAGCAGAGTGACAGAAGCTCTAAGCAAAGTTA
AAGGATCGATGGGAAGCCACGAGCGCCATGCATTGCCTGGTGTTATCGGTGACGATCTTT
TGCGATTTGGGAAGCTGCCACTCTGCCTGTTCATTTGCATTATTTTGACGGCGGTGACTG
TGGTAACCACGGCGCACCATACCCGTTTACTGACCGCTCAGCGCGAACAACTGGTGCTGG
AGCGAGATGCTTTAGACATTGAATGGCGCAACCTGATCCTTGAAGAGAATGCGCTCGGCG
ACCATAGCCGGGTGGAAAGGATCGCCACGGAAAAGCTGCAAATGCAGCATGTTGATCCGT
CACAAGAAAATATCGTAGTGCAAAAATAAGGATAAACGCGACGCATGAAAGCAGCGGCGA
AAACGCAGAAACCAAAACGTCAGGAAGAACATGCCAACTTTATCAGTTGGCGTTTTGCGT
TGTTATGCGGCTGTATTCTCCTGGCGCTGGCTTTTCTGCTCGGACGCGTAGCGTGGTTAC
AAGTTATCTCCCCGGATATGCTGGTGAAAGAGGGCGACATGCGTTCTCTTCGCGTTCAGC
AAGTTTCCACCTCCCGCGGCATGATTACTGACCGTTCTGGTCGCCCGTTAGCGGTGAGCG
TGCCGGTAAAAGCGATTTGGGCTGACCCGAAAGAAGTGCATGACGCTGGCGGTATCAGCG
TCGGTGACCGCTGGAAGGCGCTGGCTAACGCGCTCAATATTCCGCTGGATCAGCTTTCAG
CCCGCATTAACGCCAACCCGAAAGGGCGCTTTATTTATCTGGCGCGTCAGGTGAACCCTG
ACATGGCGGACTACATCAAAAAACTGAAACTGCCGGGGATTCATCTGCGTGAAGAGTCTC
GCCGTTACTATCCGTCCGGCGAAGTGACTGCTCACCTCATCGGCTTTACTAACGTCGATA
GTCAAGGGATTGAGGGCGTTGAGAAGAGTTTCGATAAATGGCTTACCGGGCAGCCGGGTG
AGCGCATTGTGCGTAAAGACCGCTATGGTCGCGTAATTGAAGATATTTCTTCTACTGACA
GCCAGGCAGCGCACAACCTGGCGCTGAGTATTGATGAACGCCTGCAGGCGCTGGTTTATC
GCGAACTGAACAACGCGGTGGCCTTTAACAAGGCTGAATCTGGTAGCGCCGTGCTGGTGG
ATGTCAACACCGGTGAAGTGCTGGCGATGGCTAACAGCCCGTCATACAACCCTAACAATC
TGAGCGGCACGCCGAAAGAGGCGATGCGTAACCGTACCATCACCGACGTGTTTGAACCGG
GCTCAACGGTTAAACCGATGGTGGTAATGACCGCGTTGCAACGTGGCGTGGTGCGGGAAA
ACTCGGTACTCAATACCATTCCTTATCGAATTAACGGCCACGAAATCAAAGACGTGGCAC
GCTACAGCGAATTAACCCTGACCGGGGTATTACAGAAGTCGAGTAACGTCGGTGTTTCCA
AGCTGGCGTTAGCGATGCCGTCCTCAGCGTTAGTAGATACTTACTCACGTTTTGGACTGG
GAAAAGCGACCAATTTGGGGTTGGTCGGAGAACGCAGTGGCTTATATCCTCAAAAACAAC
GGTGGTCTGACATAGAGAGGGCCACCTTCTCTTTCGGCTACGGGCTAATGGTAACACCAT
TACAGTTAGCGCGAGTCTACGCAACTATCGGCAGCTACGGCATTTATCGCCCACTGTCGA
TTACCAAAGTTGACCCCCCGGTTCCCGGTGAACGTGTCTTCCCGGAATCCATTGTCCGCA
CTGTGGTGCATATGATGGAAAGCGTGGCGCTACCAGGCGGCGGCGGCGTGAAGGCGGCGA
TTAAAGGCTATCGTATCGCCATTAAAACCGGTACCGCGAAAAAGGTCGGGCCGGACGGTC
GCTACATCAATAAATATATTGCTTATACCGCAGGCGTTGCGCCTGCGAGTCAGCCGCGCT
TCGCGCTGGTTGTTGTTATCAACGATCCGCAGGCGGGTAAATACTACGGCGGCGCCGTTT
CCGCGCCGGTCTTTGGTGCCATCATGGGCGGCGTATTGCGTACCATGAACATCGAGCCGG
ATGCGCTGACAACGGGCGATAAAAATGAATTTGTGATTAATCAAGGCGAGGGGACAGGTG
GCAGATCGTAATTTGCGCGACCTTCTTGCTCCGTGGGTGCCAGACGCACCTTCGCGAGCA
CTGCGAGAGATGACACTCGACAGCCGTGTGGCTGCGGCGGGCGATCTCTTTGTAGCTGTA
GTAGGTCATCAGGCGGACGGGCGTCGATATATCCCGCAGGCGATAGCGCAAGGTGTGGCT
GCCATTATTGCAGAGGCGAAAGATGAGGCGACCGATGGTGAAATCCGTGAAATGCACGGC
GTACCGGTCATCTATCTCAGCCAGCTCAACGAGCGTTTATCTGCACTGGCGGGCCGCTTT
TACCATGAACCCTCTGACAATTTACGTCTCGTGGGCGTAACGGGCACCAACGGCAAAACC
ACGACTACCCAGCTGTTGGCGCAGTGGAGCCAACTGCTTGGCGAAATCAGCGCGGTAATG
GGCACCGTTGGTAACGGCCTGCTGGGGAAAGTGATCCCGACAGAAAATACAACCGGTTCG
GCAGTCGATGTTCAGCATGAGCTGGCGGGGCTGGTGGATCAGGGCGCGACGTTTTGCGCA
ATGGAAGTTTCCTCCCACGGGCTGGTACAGCACCGTGTGGCGGCATTGAAATTTGCGGCG
TCGGTCTTTACCAACTTAAGCCGCGATCACCTTGATTATCATGGTGATATGGAACACTAC
GAAGCCGCGAAATGGCTGCTTTATTCTGAGCATCATTGCGGTCAGGCGATTATTAACGCC
GACGATGAAGTGGGCCGCCGCTGGCTGGCAAAACTGCCGGACGCGGTTGCGGTATCAATG
GAAGATCATATTAATCCGAACTGTCACGGACGCTGGTTGAAAGCGACCGAAGTGAACTAT
CACGACAGCGGTGCGACGATTCGCTTTAGCTCAAGTTGGGGCGATGGCGAAATTGAAAGC
CATCTGATGGGCGCTTTTAACGTCAGCAACCTGCTGCTCGCGCTGGCGACACTGTTGGCA
CTCGGCTATCCACTGGCTGATCTGCTGAAAACCGCCGCGCGTCTGCAACCGGTTTGCGGA
CGTATGGAAGTGTTCACTGCGCCAGGCAAACCGACGGTGGTGGTGGATTACGCGCATACG
CCGGATGCACTGGAAAAAGCCTTACAGGCGGCGCGTCTGCACTGTGCGGGCAAGCTGTGG
TGTGTCTTTGGCTGTGGTGGCGATCGCGATAAAGGTAAGCGTCCACTGATGGGCGCAATT
GCCGAAGAGTTTGCTGACGTGGCGGTGGTGACGGACGATAACCCGCGTACCGAAGAACCG
CGTGCCATCATCAACGATATTCTGGCGGGAATGTTAGATGCCGGACATGCCAAAGTGATG
GAAGGCCGTGCTGAAGCGGTGACTTGCGCCGTTATGCAGGCTAAAGAGAATGATGTGGTA
CTGGTCGCGGGCAAAGGCCATGAAGATTACCAGATTGTTGGCAATCAGCGTCTGGACTAC
TCCGATCGCGTCACGGTGGCGCGTCTGCTGGGGGTGATTGCATGATTAGCGTAACCCTTA
GCCAACTTACCGACATTCTCAACGGTGAACTGCAAGGTGCAGATATCACCCTTGATGCTG
TAACCACTGATACCCGAAAACTGACGCCGGGCTGCCTGTTTGTTGCCCTGAAAGGCGAAC
GTTTTGATGCCCACGATTTTGCCGACCAGGCGAAAGCTGGCGGCGCAGGCGCACTACTGG
TTAGCCGTCCGCTGGACATCGACCTGCCGCAGTTAATCGTCAAGGATACGCGTCTGGCGT
TTGGTGAACTGGCTGCATGGGTTCGCCAGCAAGTTCCGGCGCGCGTGGTTGCTCTGACGG
GGTCCTCCGGCAAAACCTCCGTTAAAGAGATGACGGCGGCGATTTTAAGCCAGTGCGGCA
ACACGCTTTATACGGCAGGCAATCTCAACAACGACATCGGTGTACCGATGACGCTGTTGC
GCTTAACGCCGGAATACGATTACGCAGTTATTGAACTTGGCGCGAACCATCAGGGCGAAA
TAGCCTGGACTGTGAGTCTGACTCGCCCGGAAGCTGCGCTGGTCAACAACCTGGCAGCGG
CGCATCTGGAAGGTTTTGGCTCGCTTGCGGGTGTCGCGAAAGCGAAAGGTGAAATCTTTA
GCGGCCTGCCGGAAAACGGTATCGCCATTATGAACGCCGACAACAACGACTGGCTGAACT
GGCAGAGCGTAATTGGCTCACGCAAAGTGTGGCGTTTCTCACCCAATGCCGCCAACAGCG
ATTTCACCGCCACCAATATCCATGTGACCTCGCACGGTACGGAATTTACCCTACAAACCC
CAACCGGTAGCGTCGATGTTCTGCTGCCGTTGCCGGGGCGTCACAATATTGCGAATGCGC
TGGCAGCCGCTGCGCTCTCCATGTCCGTGGGCGCAACGCTTGATGCTATCAAAGCGGGGC
TGGCAAATCTGAAAGCTGTTCCAGGCCGTCTGTTCCCCATCCAACTGGCAGAAAACCAGT
TGCTGCTCGACGACTCCTACAACGCCAATGTCGGTTCAATGACTGCAGCAGTCCAGGTAC
TGGCTGAAATGCCGGGCTACCGCGTGCTGGTGGTGGGCGATATGGCGGAACTGGGCGCTG
AAAGCGAAGCCTGCCATGTACAGGTGGGCGAGGCGGCAAAAGCTGCTGGTATTGACCGCG
TGTTAAGCGTGGGTAAACAAAGCCATGCTATCAGCACCGCCAGCGGCGTTGGCGAACATT
TTGCTGATAAAACTGCGTTAATTACGCGTCTTAAATTACTGATTGCTGAGCAACAGGTAA
TTACGATTTTAGTTAAGGGTTCACGTAGTGCCGCCATGGAAGAGGTAGTACGCGCTTTAC
AGGAGAATGGGACATGTTAGTTTGGCTGGCCGAACATTTGGTCAAATATTATTCCGGCTT
TAACGTCTTTTCCTATCTGACGTTTCGCGCCATCGTCAGCCTGCTGACCGCGCTGTTCAT
CTCATTGTGGATGGGCCCGCGTATGATTGCTCATTTGCAAAAACTTTCCTTTGGTCAGGT
GGTGCGTAACGACGGTCCTGAATCACACTTCAGCAAGCGCGGTACGCCGACCATGGGCGG
GATTATGATCCTGACGGCGATTGTGATCTCCGTACTGCTGTGGGCTTACCCGTCCAATCC
GTACGTCTGGTGCGTGTTGGTGGTGCTGGTAGGTTACGGTGTTATTGGCTTTGTTGATGA
TTATCGCAAAGTGGTGCGTAAAGACACCAAAGGGTTGATCGCTCGTTGGAAGTATTTCTG
GATGTCGGTCATTGCGCTGGGTGTCGCCTTCGCCCTGTACCTTGCCGGCAAAGACACGCC
CGCAACGCAGCTGGTGGTCCCATTCTTTAAAGATGTGATGCCGCAGCTGGGGCTGTTCTA
CATTCTGCTGGCTTACTTCGTCATTGTGGGTACTGGCAACGCGGTAAACCTGACCGATGG
TCTCGACGGCCTGGCAATTATGCCGACCGTATTTGTCGCCGGTGGTTTTGCGCTGGTGGC
GTGGGCGACCGGCAATATGAACTTTGCCAGCTACTTGCATATACCGTATCTGCGACACGC
CGGGGAACTGGTTATTGTCTGTACCGCGATAGTCGGGGCAGGACTGGGCTTCCTGTGGTT
TAACACCTATCCGGCGCAGGTCTTTATGGGCGATGTAGGTTCGCTGGCGTTAGGTGGTGC
GTTAGGCATTATCGCCGTACTGCTACGTCAGGAATTCCTGCTGGTGATTATGGGGGGCGT
GTTCGTGGTAGAAACGCTTTCTGTCATCCTGCAGGTCGGCTCCTTTAAACTGCGCGGACA
ACGTATTTTCCGCATGGCACCGATTCATCACCACTATGAACTGAAAGGCTGGCCGGAACC
GCGCGTCATTGTGCGTTTCTGGATTATTTCGCTGATGCTGGTTCTGATTGGTCTGGCAAC
GCTGAAGGTACGTTAATCATGGCTGATTATCAGGGTAAAAATGTCGTCATTATCGGCCTG
GGCCTCACCGGGCTTTCCTGCGTGGACTTTTTCCTCGCTCGCGGTGTGACGCCGCGCGTT
ATGGATACGCGTATGACACCGCCTGGCCTGGATAAATTACCCGAAGCCGTAGAACGCCAC
ACGGGCAGTCTGAATGATGAATGGCTGATGGCGGCAGATCTGATTGTCGCCAGTCCCGGT
ATTGCACTGGCGCATCCATCCTTAAGCGCTGCCGCTGATGCCGGAATCGAAATCGTTGGC
GATATCGAGCTGTTCTGTCGCGAAGCACAAGCACCGATTGTGGCGATTACCGGTTCTAAC
GGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGAAAGCGGCGGGGGTTAACGTT
GGTGTGGGTGGCAATATTGGCCTGCCTGCGTTGATGCTACTGGATGATGAGTGTGAACTG
TACGTGCTGGAACTGTCGAGCTTCCAGCTGGAAACCACCTCCAGCTTACAGGCGGTAGCA
GCGACCATTCTGAACGTGACTGAAGATCATATGGATCGCTATCCGTTTGGTTTACAACAG
TATCGTGCAGCAAAACTGCGCATTTACGAAAACGCGAAAGTTTGCGTGGTTAATGCTGAT
GATGCCTTAACAATGCCGATTCGCGGTGCGGATGAACGCTGCGTCAGCTTTGGCGTCAAC
ATGGGTGACTATCACCTGAATCATCAGCAGGGCGAAACCTGGCTGCGGGTTAAAGGCGAG
AAAGTGCTGAATGTGAAAGAGATGAAACTTTCCGGGCAGCATAACTACACCAATGCGCTG
GCGGCGCTGGCGCTGGCAGATGCTGCAGGGTTACCGCGTGCCAGCAGCCTGAAAGCGTTA
ACCACATTCACTGGTCTGCCGCATCGCTTTGAAGTTGTGCTGGAGCATAACGGCGTACGT
TGGATTAACGATTCGAAAGCGACCAACGTCGGCAGTACGGAAGCGGCGCTGAATGGCCTG
CACGTAGACGGCACACTGCATTTGTTGCTGGGTGGCGATGGTAAATCGGCGGACTTTAGC
CCACTGGCGCGTTACCTGAATGGCGATAACGTACGTCTGTATTGTTTCGGTCGTGACGGC
GCGCAGCTGGCGGCGCTACGCCCGGAAGTGGCAGAACAAACCGAAACTATGGAACAGGCG
ATGCGCTTGCTGGCTCCGCGTGTTCAGCCGGGCGATATGGTTCTGCTCTCCCCAGCCTGT
GCCAGCCTTGATCAGTTCAAGAACTTTGAACAACGAGGCAATGAGTTTGCCCGTCTGGCG
AAGGAGTTAGGTTGATGCGTTTATCTCTCCCTCGCCTGAAAATGCCGCGCCTGCCAGGAT
TCAGTATCCTGGTCTGGATCTCCACGGCGCTAAAGGGCTGGGTGATGGGCTCGCGGGAAA
AAGATACCGACAGCCTGATCATGTACGATCGCACCTTACTGTGGCTGACCTTCGGCCTCG
CGGCGATTGGCTTTATCATGGTGACCTCGGCGTCAATGCCCATAGGGCAACGCTTAACCA
ACGATCCGTTCTTCTTCGCGAAGCGTGATGGTGTCTATCTGATTTTGGCGTTTATTCTGG
CGATCATTACGCTGCGTCTGCCGATGGAGTTCTGGCAACGCTACAGTGCCACGATGCTGC
TCGGATCTATCATCCTGCTGATGATCGTCCTGGTAGTGGGTAGCTCGGTTAAAGGGGCAT
CGCGTTGGATCGATCTCGGTTTGCTGCGTATCCAGCCTGCGGAGCTGACAAAACTGTCGC
TGTTTTGCTATATCGCCAACTATCTGGTGCGTAAAGGCGACGAAGTACGTAATAACCTGC
GCGGCTTCCTGAAACCGATGGGCGTGATTCTGGTGTTGGCAGTGTTACTGCTGGCACAGC
CAGACCTTGGTACGGTGGTGGTGTTGTTTGTGACTACGCTGGCGATGTTGTTCCTGGCGG
GAGCGAAATTGTGGCAGTTCATTGCCATTATCGGTATGGGCATTTCAGCGGTTGTGTTGC
TGATACTCGCCGAACCGTACCGTATCCGCCGTGTTACCGCATTCTGGAACCCGTGGGAAG
ATCCCTTTGGCAGCGGCTATCAGTTAACGCAATCGCTGATGGCGTTTGGTCGCGGCGAAC
TTTGGGGGCAAGGTTTAGGTAACTCGGTACAAAAACTGGAGTATCTGCCGGAAGCGCACA
CTGACTTTATTTTCGCCATTATCGGCGAAGAACTGGGGTATGTCGGTGTGGTGCTGGCAC
TTTTAATGGTATTCTTCGTCGCTTTTCGCGCGATGTCGATTGGCCGTAAAGCATTAGAAA
TTGACCACCGTTTTTCCGGTTTTCTCGCCTGTTCTATTGGCATCTGGTTTAGCTTCCAGG
CGCTGGTTAACGTAGGCGCGGCGGCGGGGATGTTACCGACCAAAGGTCTGACATTGCCGC
TGATCAGTTACGGTGGTTCGAGCTTACTGATTATGTCGACAGCCATCATGATGCTGTTGC
GTATTGATTATGAAACGCGTCTGGAGAAAGCGCAGGCGTTTGTACGAGGTTCACGATGAG
TGGTCAAGGAAAGCGATTAATGGTGATGGCAGGCGGAACCGGTGGACATGTATTCCCGGG
ACTGGCGGTTGCGCACCATCTAATGGCTCAGGGTTGGCAAGTTCGCTGGCTGGGGACTGC
CGACCGTATGGAAGCGGACTTAGTGCCAAAACATGGCATCGAAATTGATTTCATTCGTAT
CTCTGGTCTGCGTGGAAAAGGTATAAAAGCACTGATAGCTGCCCCGCTGCGTATCTTCAA
CGCCTGGCGTCAGGCGCGGGCGATTATGAAAGCGTACAAACCTGACGTGGTGCTCGGTAT
GGGAGGCTACGTGTCAGGTCCAGGTGGTCTGGCCGCGTGGTCGTTAGGCATTCCGGTTGT
ACTTCATGAACAAAACGGTATTGCGGGCTTAACCAATAAATGGCTGGCGAAGATTGCCAC
CAAAGTGATGCAGGCGTTTCCAGGTGCTTTCCCTAATGCGGAAGTAGTGGGTAACCCGGT
GCGTACCGATGTGTTGGCGCTGCCGTTGCCGCAGCAACGTTTGGCTGGACGTGAAGGTCC
GGTTCGTGTGCTGGTAGTGGGTGGTTCTCAGGGCGCACGCATTCTTAACCAGACAATGCC
GCAGGTTGCTGCGAAACTGGGTGATTCAGTCACTATCTGGCATCAGAGCGGCAAAGGTTC
GCAACAATCCGTTGAACAGGCGTATGCCGAAGCGGGGCAACCGCAGCATAAAGTGACGGA
ATTTATTGATGATATGGCGGCGGCGTATGCGTGGGCGGATGTCGTCGTTTGCCGCTCCGG
TGCGTTAACGGTGAGTGAAATCGCCGCGGCAGGACTACCGGCGTTGTTTGTGCCGTTTCA
ACATAAAGACCGCCAGCAATACTGGAATGCGCTACCGCTGGAAAAAGCGGGCGCAGCCAA
AATTATCGAGCAGCCACAGCTTAGCGTGGATGCTGTCGCCAACACCCTGGCCGGGTGGTC
GCGAGAAACCTTATTAACCATGGCAGAACGCGCCCGCGCTGCATCCATTCCGGATGCCAC
CGAGCGAGTGGCAAATGAAGTGAGCCGGGTTGCCCGGGCGTAATTGTAGCGATGCCTTTT
GCATCGTATGAATTTAAGAAGTTAATGGCGTAAAGAATGAATACACAACAATTGGCAAAA
CTGCGTTCCATCGTGCCCGAAATGCGTCGCGTTCGGCACATACATTTTGTCGGCATTGGT
GGTGCCGGTATGGGCGGTATTGCCGAAGTTCTGGCCAATGAAGGTTATCAGATCAGTGGT
TCCGATTTAGCGCCAAATCCGGTCACGCAGCAGTTAATGAATCTGGGTGCGACGATTTAT
TTCAACCATCGCCCGGAAAACGTACGTGATGCCAGCGTGGTCGTTGTTTCCAGCGCGATT
TCTGCCGATAACCCGGAAATTGTCGCCGCTCATGAAGCGCGTATTCCGGTGATCCGTCGT
GCCGAAATGCTGGCTGAGTTAATGCGTTTTCGTCATGGCATCGCCATTGCCGGAACGCAC
GGCAAAACGACAACCACCGCGATGGTTTCCAGCATCTACGCAGAAGCGGGGCTCGACCCA
ACCTTCGTTAACGGCGGGCTGGTAAAAGCGGCGGGGGTTCATGCGCGTTTGGGGCATGGT
CGGTACCTGATTGCCGAAGCAGATGAGAGTGATGCATCGTTCCTGCATCTGCAACCGATG
GTGGCGATTGTCACCAATATCGAAGCCGACCACATGGATACCTACCAGGGCGACTTTGAG
AATTTAAAACAGACTTTTATTAATTTTCTGCACAACCTGCCGTTTTACGGTCGTGCGGTG
ATGTGTGTTGATGATCCGGTGATCCGCGAATTGTTACCGCGAGTGGGGCGTCAGACCACG
ACTTACGGCTTCAGCGAAGATGCCGACGTGCGTGTAGAAGATTATCAGCAGATTGGCCCG
CAGGGGCACTTTACGCTGCTGCGCCAGGACAAAGAGCCGATGCGCGTCACCCTGAATGCG
CCAGGTCGTCATAACGCGCTGAACGCCGCAGCTGCGGTTGCGGTTGCTACGGAAGAGGGC
ATTGACGACGAGGCTATTTTGCGGGCGCTTGAAAGCTTCCAGGGGACTGGTCGCCGTTTT
GATTTCCTCGGTGAATTCCCGCTGGAGCCAGTGAATGGTAAAAGCGGTACGGCAATGCTG
GTCGATGACTACGGCCACCACCCGACGGAAGTGGACGCCACCATTAAAGCGGCGCGCGCA
GGCTGGCCGGATAAAAACCTGGTAATGCTGTTTCAGCCGCACCGTTTTACCCGTACGCGC
GACCTGTATGATGATTTCGCCAATGTGCTGACGCAGGTTGATACCCTGTTGATGCTGGAA
GTGTATCCGGCTGGCGAAGCGCCAATTCCGGGAGCGGACAGCCGTTCGCTGTGTCGCACA
ATTCGTGGACGTGGGAAAATTGATCCCATTCTGGTGCCGGATCCGGCGCGGGTAGCCGAG
ATGCTGGCACCGGTATTAACCGGTAACGACCTGATTCTCGTTCAGGGGGCTGGTAATATT
GGAAAAATTGCCCGTTCTTTAGCTGAAATCAAACTGAAGCCGCAAACTCCGGAGGAAGAA
CAACATGACTGATAAAATCGCGGTCCTGTTGGGTGGGACCTCCGCTGAGCGGGAAGTTTC
TCTGAATTCTGGCGCAGCGGTGTTAGCCGGACTGCGTGAAGGCGGTATTGACGCGTATCC
TGTCGACCCGAAAGAAGTCGACGTGACGCAACTGAAGTCGATGGGCTTTCAGAAAGTGTT
TATCGCGCTACACGGTCGCGGCGGTGAAGATGGTACGCTGCAGGGGATGCTCGAGCTGAT
GGGCTTGCCTTATACCGGAAGCGGAGTGATGGCATCTGCGCTTTCAATGGATAAACTACG
CAGCAAACTTCTATGGCAAGGTGCCGGTTTACCGGTCGCGCCGTGGGTAGCGTTAACCCG
CGCAGAGTTTGAAAAAGGCCTGAGCGATAAGCAGTTAGCAGAAATTTCTGCTCTGGGTTT
GCCGGTTATCGTTAAGCCGAGCCGCGAAGGTTCCAGTGTGGGAATGTCAAAAGTAGTAGC
AGAAAATGCTCTACAAGATGCATTAAGATTGGCATTTCAGCACGATGAAGAAGTATTGAT
TGAAAAATGGCTAAGTGGGCCGGAGTTCACGGTTGCGATACTCGGTGAAGAAATTTTACC
GTCAATACGTATTCAACCGTCCGGAACCTTCTATGATTATGAGGCGAAGTATCTCTCTGA
TGAGACACAGTATTTCTGCCCCGCAGGTCTGGAAGCGTCACAAGAGGCCAATTTGCAGGC
ATTAGTGCTGAAAGCATGGACGACGTTAGGTTGCAAAGGATGGGGACGTATTGACGTTAT
GCTGGACAGCGATGGACAGTTTTATCTGCTGGAAGCCAATACCTCACCGGGTATGACCAG
CCACAGCCTGGTGCCGATGGCGGCACGTCAGGCAGGTATGAGCTTCTCGCAGTTGGTAGT
ACGAATTCTGGAACTGGCGGACTAATATGTCGCAGGCTGCTCTGAACACGCGAAACAGCG
AAGAAGAGGTTTCTTCTCGCCGCAATAATGGAACGCGTCTGGCGGGGATCCTTTTCCTGC
TGACCGTTTTAACGACAGTGTTGGTGAGCGGCTGGGTCGTGTTGGGCTGGATGGAAGATG
CGCAACGCCTGCCGCTCTCAAAGCTGGTGTTGACCGGTGAACGCCATTACACACGTAATG
ACGATATCCGGCAGTCGATCCTGGCATTGGGTGAGCCGGGTACCTTTATGACCCAGGATG
TCAACATCATCCAGACGCAAATAGAACAACGCCTGCCGTGGATTAAGCAGGTGAGCGTCA
GAAAGCAGTGGCCTGATGAATTGAAGATTCATCTGGTTGAATATGTGCCGATTGCGCGGT
GGAATGATCAACATATGGTAGACGCGGAAGGAAATACCTTCAGCGTGCCGCCAGAACGCA
CCAGCAAGCAGGTGCTTCCAATGCTGTATGGCCCGGAAGGCAGCGCCAATGAAGTGTTGC
AGGGCTATCGCGAAATGGGGCAGATGCTGGCAAAGGACAGATTTACTCTGAAGGAAGCGG
CGATGACCGCGCGGCGTTCCTGGCAGTTGACGCTGAATAACGATATTAAGCTCAATCTTG
GCCGGGGCGATACGATGAAACGTTTGGCTCGCTTTGTAGAACTTTATCCGGTTTTACAGC
AGCAGGCGCAAACCGATGGCAAACGGATTAGCTACGTTGATTTGCGTTATGACTCTGGAG
CGGCAGTAGGCTGGGCGCCCTTGCCGCCAGAGGAATCTACTCAGCAACAAAATCAGGCAC
AGGCAGAACAACAATGATCAAGGCGACGGACAGAAAACTGGTAGTAGGACTGGAGATTGG
TACCGCGAAGGTTGCCGCTTTAGTAGGGGAAGTTCTGCCCGACGGTATGGTCAATATCAT
TGGCGTGGGCAGCTGCCCGTCGCGTGGTATGGATAAAGGCGGGGTGAACGACCTCGAATC
CGTGGTCAAGTGCGTACAACGCGCCATTGACCAGGCAGAATTGATGGCAGATTGTCAGAT
CTCTTCGGTATATCTGGCGCTTTCTGGTAAGCACATCAGCTGCCAGAATGAAATTGGTAT
GGTGCCTATTTCTGAAGAAGAAGTGACGCAAGAAGATGTGGAAAACGTCGTCCATACCGC
GAAATCGGTGCGTGTGCGCGATGAGCATCGTGTGCTGCATGTGATCCCGCAAGAGTATGC
GATTGACTATCAGGAAGGGATCAAGAATCCGGTAGGACTTTCGGGCGTGCGGATGCAGGC
AAAAGTGCACCTGATCACATGTCACAACGATATGGCGAAAAACATCGTCAAAGCGGTTGA
ACGTTGTGGGCTGAAAGTTGACCAACTGATATTTGCCGGACTGGCATCAAGTTATTCGGT
ATTGACGGAAGATGAACGTGAACTGGGTGTCTGCGTCGTCGATATCGGTGGTGGTACAAT
GGATATCGCCGTTTATACCGGTGGGGCATTGCGCCACACTAAGGTAATTCCTTATGCTGG
CAATGTCGTGACCAGTGATATCGCTTACGCCTTTGGCACGCCGCCAAGCGACGCCGAAGC
GATTAAAGTTCGCCACGGTTGTGCGCTGGGTTCCATCGTTGGAAAAGATGAGAGCGTGGA
AGTGCCGAGCGTAGGTGGTCGTCCGCCACGGAGTCTGCAACGTCAGACACTGGCAGAGGT
GATCGAGCCGCGCTATACCGAGCTGCTCAACCTGGTCAACGAAGAGATATTGCAGTTGCA
GGAAAAGCTTCGCCAACAAGGGGTTAAACATCACCTGGCGGCAGGCATTGTATTAACCGG
TGGCGCAGCGCAGATCGAAGGTCTTGCAGCCTGTGCTCAGCGCGTGTTTCATACGCAAGT
GCGTATCGGCGCGCCGCTGAACATTACCGGTTTAACGGATTATGCTCAGGAGCCGTATTA
TTCGACGGCGGTGGGATTGCTTCACTATGGGAAAGAGTCACATCTTAACGGTGAAGCTGA
AGTAGAAAAACGTGTTACAGCATCAGTTGGCTCGTGGATCAAGCGACTCAATAGTTGGCT
GCGAAAAGAGTTTTAATTTTTATGAGGCCGACGATGATTACGGCCTCAGGCGACAGGCAC
AAATCGGAGAGAAACTATGTTTGAACCAATGGAACTTACCAATGACGCGGTGATTAAAGT
CATCGGCGTCGGCGGCGGCGGCGGTAATGCTGTTGAACACATGGTGCGCGAGCGCATTGA
AGGTGTTGAATTCTTCGCGGTAAATACCGATGCACAAGCGCTGCGTAAAACAGCGGTTGG
ACAGACGATTCAAATCGGTAGCGGTATCACCAAAGGACTGGGCGCTGGCGCTAATCCAGA
AGTTGGCCGCAATGCGGCTGATGAGGATCGCGATGCATTGCGTGCGGCGCTGGAAGGTGC
AGACATGGTCTTTATTGCTGCGGGTATGGGTGGTGGTACCGGTACAGGTGCAGCACCAGT
CGTCGCTGAAGTGGCAAAAGATTTGGGTATCCTGACCGTTGCTGTCGTCACTAAGCCTTT
CAACTTTGAAGGCAAGAAGCGTATGGCATTCGCGGAGCAGGGGATCACTGAACTGTCCAA
GCATGTGGACTCTCTGATCACTATCCCGAACGACAAACTGCTGAAAGTTCTGGGCCGCGG
TATCTCCCTGCTGGATGCGTTTGGCGCAGCGAACGATGTACTGAAAGGCGCTGTGCAAGG
TATCGCTGAACTGATTACTCGTCCGGGTTTGATGAACGTGGACTTTGCAGACGTACGCAC
CGTAATGTCTGAGATGGGCTACGCAATGATGGGTTCTGGCGTGGCGAGCGGTGAAGACCG
TGCGGAAGAAGCTGCTGAAATGGCTATCTCTTCTCCGCTGCTGGAAGATATCGACCTGTC
TGGCGCGCGCGGCGTGCTGGTTAACATCACGGCGGGCTTCGACCTGCGTCTGGATGAGTT
CGAAACGGTAGGTAACACCATCCGTGCATTTGCTTCCGACAACGCGACTGTGGTTATCGG
TACTTCTCTTGACCCGGATATGAATGACGAGCTGCGCGTAACCGTTGTTGCGACAGGTAT
CGGCATGGACAAACGTCCTGAAATCACTCTGGTGACCAATAAGCAGGTTCAGCAGCCAGT
GATGGATCGCTACCAGCAGCATGGGATGGCTCCGCTGACCCAGGAGCAGAAGCCGGTTGC
TAAAGTCGTGAATGACAATGCGCCGCAAACTGCGAAAGAGCCGGATTATCTGGATATCCC
AGCATTCCTGCGTAAGCAAGCTGATTAAGAATTGACTGGAATTTGGGTTTCGAGGCTCTT
TGTGCTAAACTGGCCCGCCGAATGTATAGTACACTTCGGTTGGATAGGTAATTTGGCGAG
ATAATACGATGATCAAACAAAGGACACTTAAACGTATCGTTCAGGCGACGGGTGTCGGTT
TACATACCGGCAAGAAAGTCACCCTGACGTTACGCCCTGCGCCGGCCAACACCGGGGTCA
TCTATCGTCGCACCGACTTGAATCCACCGGTAGATTTCCCGGCCGATGCCAAATCTGTGC
GTGATACCATGCTCTGTACGTGTCTGGTCAACGAGCATGATGTACGGATTTCAACCGTAG
AGCACCTCAATGCTGCTCTCGCGGGCTTGGGCATCGATAACATTGTTATCGAAGTTAACG
CGCCGGAAATCCCGATCATGGACGGCAGCGCCGCTCCGTTTGTATACCTGCTGCTTGACG
CCGGTATCGACGAGTTGAACTGCGCCAAAAAATTTGTTCGCATCAAAGAGACTGTTCGTG
TCGAAGATGGCGATAAGTGGGCTGAATTTAAGCCGTACAATGGTTTTTCGCTGGATTTCA
CCATCGATTTTAACCATCCGGCTATTGATTCCAGCAACCAGCGCTATGCGATGAACTTCT
CCGCTGATGCGTTTATGCGCCAGATCAGCCGTGCGCGTACGTTCGGTTTCATGCGTGATA
TCGAATATCTGCAGTCCCGTGGTTTGTGCCTGGGCGGCAGCTTCGATTGTGCCATCGTTG
TTGACGATTATCGCGTACTGAACGAAGACGGCCTGCGTTTTGAAGACGAATTTGTGCGTC
ACAAAATGCTCGATGCGATCGGTGACTTGTTCATGTGTGGTCACAATATTATTGGTGCAT
TTACCGCTTATAAATCCGGTCATGCACTGAATAACAAACTGCTGCAGGCTGTCCTGGCGA
AACAGGAAGCCTGGGAATATGTGACCTTCCAGGACGACGCAGAACTGCCGTTGGCCTTCA
AAGCGCCTTCAGCTGTACTGGCATAACGACATTTATACTGTCGTATAAAATTCGACTGGC
AAATCTGGCACTCTCTCCGGCCAGGTGAACCAGTCGTTTTTTTTTGAATTTTATAAGAGC
TATAAAAAACGGTGCGAACGCTGTTTTCTTAAGCACTTTTCCGCACAACTTATCTTCATT
CGTGCTGTGGACTGCAGGCTTTAATGATAAGATTTGTGCGCTAAATACGTTTGAATATGA
TCGGGATGGCAATAACGTGAGTGGAATACTGACGCGCTGGCGACAGTTTGGTAAACGCTA
CTTCTGGCCGCATCTCTTATTAGGGATGGTTGCGGCGAGTTTAGGTTTGCCTGCGCTCAG
CAACGCCGCCGAACCAAACGCGCCCGCAAAAGCGACAACCCGCAACCACGAGCCTTCAGC
CAAAGTTAACTTTGGTCAATTGGCCTTGCTGGAAGCGAACACACGCCGCCCGAATTCGAA
CTATTCCGTTGATTACTGGCATCAACATGCCATTCGCACGGTAATCCGTCATCTTTCTTT
CGCAATGGCACCGCAAACACTGCCCGTTGCTGAAGAATCTTTGCCTCTTCAGGCGCAACA
TCTTGCATTACTGGATACGCTCAGCGCGCTGCTGACCCAGGAAGGCACGCCGTCTGAAAA
GGGTTATCGCATTGATTATGCGCATTTTACCCCACAAGCAAAATTCAGCACGCCCGTCTG
GATAAGCCAGGCGCAAGGCATCCGTGCTGGCCCTCAACGCCTCACCTAACAACAATAAAC
CTTTACTTCATTTTATTAACTCCGCAACGCGGGGCGTTTGAGATTTTATTATGCTAATCA
AATTGTTAACTAAAGTTTTCGGTAGTCGTAACGATCGCACCCTGCGCCGGATGCGCAAAG
TGGTCAACATCATCAATGCCATGGAACCGGAGATGGAAAAACTCTCCGACGAAGAACTGA
AAGGGAAAACCGCAGAGTTTCGTGCACGTCTGGAAAAAGGCGAAGTGCTGGAAAATCTGA
TCCCGGAAGCTTTCGCCGTGGTACGTGAGGCAAGTAAGCGCGTCTTTGGTATGCGTCACT
TCGACGTTCAGTTACTCGGCGGTATGGTTCTTAACGAACGCTGCATCGCCGAAATGCGTA
CCGGTGAAGGAAAAACCCTGACCGCAACGCTGCCTGCTTACCTGAACGCACTAACCGGTA
AAGGCGTGCACGTAGTTACCGTCAACGACTACCTGGCGCAACGTGACGCCGAAAACAACC
GTCCGCTGTTTGAATTCCTTGGCCTGACTGTCGGTATCAACCTGCCGGGCATGCCAGCAC
CGGCAAAGCGCGAAGCTTACGCAGCTGACATCACTTACGGTACGAACAACGAATACGGCT
TTGACTACCTGCGCGACAACATGGCGTTCAGCCCTGAAGAACGTGTACAGCGTAAACTGC
ACTATGCGCTGGTGGACGAAGTGGACTCCATCCTGATCGATGAAGCGCGTACACCGCTGA
TCATTTCCGGCCCGGCAGAAGACAGCTCGGAAATGTATAAACGCGTGAATAAAATTATTC
CGCACCTGATCCGTCAGGAAAAAGAAGACTCCGAAACCTTCCAGGGCGAAGGCCACTTCT
CGGTGGACGAAAAATCTCGCCAGGTGAACCTGACCGAACGTGGTCTGGTGCTGATTGAAG
AACTGCTGGTGAAAGAGGGCATCATGGATGAAGGGGAGTCTCTGTACTCTCCGGCCAACA
TCATGCTGATGCACCACGTAACGGCGGCGCTGCGCGCTCATGCGCTGTTTACCCGTGACG
TCGACTACATCGTTAAAGATGGTGAAGTTATCATCGTTGACGAACACACCGGTCGTACCA
TGCAGGGCCGTCGCTGGTCCGATGGTCTGCACCAGGCTGTGGAAGCGAAAGAAGGTGTGC
AGATCCAGAACGAAAACCAAACGCTGGCTTCGATCACCTTCCAGAACTACTTCCGTCTGT
ATGAAAAACTGGCGGGGATGACCGGTACTGCTGATACCGAAGCTTTCGAATTTAGCTCAA
TCTACAAGCTGGATACCGTCGTTGTTCCGACCAACCGTCCAATGATTCGTAAAGATCTGC
CGGACCTGGTCTACATGACTGAAGCGGAAAAAATTCAGGCGATCATTGAAGATATCAAAG
AACGTACTGCGAAAGGCCAGCCGGTGCTGGTGGGTACTATCTCCATCGAAAAATCGGAGC
TGGTGTCAAACGAACTGACCAAAGCCGGTATTAAGCACAACGTCCTGAACGCCAAATTCC
ACGCCAACGAAGCGGCGATTGTTGCTCAGGCAGGTTATCCGGCTGCGGTGACTATCGCGA
CCAATATGGCGGGTCGTGGTACAGATATTGTGCTCGGTGGTAGCTGGCAGGCAGAAGTTG
CCGCGCTGGAAAATCCGACCGCAGAGCAAATTGAAAAAATTAAAGCCGACTGGCAGGTAC
GTCACGATGCGGTACTGGAAGCAGGTGGCCTGCATATCATCGGTACCGAGCGTCACGAAT
CCCGTCGTATCGATAACCAGTTGCGCGGTCGTTCTGGTCGTCAGGGGGATGCTGGTTCTT
CCCGTTTCTACCTGTCGATGGAAGATGCGCTGATGCGTATTTTTGCTTCCGACCGAGTAT
CCGGCATGATGCGTAAACTGGGTATGAAGCCAGGCGAAGCCATTGAACACCCGTGGGTGA
CTAAAGCGATTGCCAACGCCCAGCGTAAAGTTGAAAGCCGTAACTTCGACATTCGTAAGC
AACTGCTGGAATATGATGACGTGGCTAACGATCAGCGTCGCGCCATTTACTCCCAGCGTA
ACGAACTGTTGGATGTCAGCGATGTGAGCGAAACCATTAACAGCATTCGTGAAGATGTGT
TCAAAGCGACCATTGATGCCTACATTCCACCACAGTCGCTGGAAGAAATGTGGGATATTC
CGGGGCTGCAGGAACGTCTGAAGAACGATTTCGACCTCGATTTGCCAATTGCCGAGTGGC
TGGATAAAGAACCAGAACTGCATGAAGAGACGCTGCGTGAGCGCATTCTGGCGCAGTCCA
TCGAAGTGTATCAGCGTAAAGAAGAAGTGGTTGGTGCTGAGATGATGCGTCACTTCGAGA
AAGGCGTCATGCTGCAAACGCTTGACTCCCTGTGGAAAGAGCACCTGGCAGCGATGGACT
ATCTGCGTCAGGGTATCCACCTGCGTGGCTACGCACAGAAAGATCCGAAGCAGGAATACA
AACGTGAATCGTTCTCCATGTTTGCAGCGATGCTGGAGTCGTTGAAATATGAAGTTATCA
GTACGCTGAGCAAAGTTCAGGTACGTATGCCTGAAGAGGTTGAGGAGCTGGAACAACAGC
GTCGTATGGAAGCCGAGCGTTTAGCGCAAATGCAGCAGCTTAGCCATCAGGATGACGACT
CTGCAGCCGCAGCTGCACTGGCGGCGCAAACCGGAGAGCGCAAAGTAGGACGTAACGATC
CTTGCCCGTGCGGTTCTGGTAAAAAATACAAGCAGTGCCATGGCCGCCTGCAATAAAAGC
TAACTGTTGAAGTAAAAGGCGCAGGATTCTGCGCCTTTTTTATAGGTTTAAGACAATGAA
AAAGCTGCAAATTGCGGTAGGTATTATTCGCAACGAGAACAATGAAATCTTTATAACGCG
TCGCGCAGCAGATGCGCACATGGCGAATAAACTGGAGTTTCCCGGCGGTAAAATTGAAAT
GGGTGAAACGCCGGAACAGGCGGTGGTGCGTGAACTTCAGGAAGAAGTCGGGATTACCCC
CCAACATTTTTCGCTATTTGAAAAACTGGAATATGAATTCCCGGACAGGCATATAACACT
GTGGTTTTGGCTGGTCGAACGCTGGGAAGGGGAGCCGTGGGGTAAAGAAGGGCAACCCGG
TGAGTGGATGTCGCTGGTCGGTCTTAATGCCGATGATTTTCCGCCAGCCAATGAACCGGT
AATTGCGAAGCTTAAACGTCTGTAGGTCAGATAAGGCGTTTTCGCCGCATCCGACATTCG
CACACGATGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTAAAGGGATTTCTAACTCA
TTGATAAATTTGTTTTTGTAGGTCGGATAAGGCGTTCACGCCGCATCCGACATTTGCACA
AGATGCCTGATGCGACGCTGTCCGCGTCTTATCAGGCCTACGTGCGGCATCAGACAAATG
TCACTGCTTTGGTTCTTCGCTCCAGTCATCGCTTTCGGAAAGATCGCCACTGCTGGGGAT
TCGTTTTTCTTCAGCAGCCCATTCTCCGAGGTCGATCAGCTGACAACGTTTGGAGCAAAA
TGGCCGAAACGGGCTGATTTCACCCCACACCACCGTTTTCCCGCAGGTTGGGCAATTCAC
CGTAATAGTTTCTGACATTTTTACTCCTTAGCAACAGGCCAGTTCGAAATCCAGACGTTC
CGGTACCTGTCCGTTTTCAGTGTCCAGCGGCATAAAACGAATGGCAAAACGGCTCTTATG
TCCGGAAATTTGCGGATAAAGCTGTGAATCGAGCGACAGATTCAGGCGCAGCAAGTCGGC
ATCGCCACCGTTATCCTGATAAAAACCATTCAGGCTGGTTTGTTTACGGAAGGGGGCCGA
CTGGCGAATTAAATCCAGCACCATGGTAAGTGCCTGGGTGAGCGGGTTCAGGCTGGCAAT
CCAGGTTTCTACCTGGCTGTCGCGCTGCGCCTGGGGTAGATGCAGCCAAATGTGCAATGT
AGGTAAATCAAAGCTGCAACAGCCGCCTGGGATGCTCAGTCGCTGACGCACCAGAGCAAT
CAAACGATCTTCACGCAGAAATTGCCCGATACGCGGCGCGGAAATTAATACGCTCCCCGC
CGCTTTTAACTGCTGAATTAATGCTTCAATACGGCTCTGGTCCACGCCAGGCACGCCAAT
CCAGGTCTGGAGTTTACGTTGCTGCCGGTCAAGTTCTTTCAACAGCTCAGTGCGGACTTC
GCCGCGCTCGAAAACATCCAGTAATTCACTGACATTACGGAAGAAATGCAGCGCGCCAGC
GTGGTCAACGATGGGTAAATTAACGGTGAGTTGCTGAATCAAAAACTCAATGCGCAGCCA
TGTACGCATTTTTTCATTTAGTGGATGTTCAAAAAGGACCTGGGTCTGCATTACGGTTTT
TCCTGTGAGACAAACTGCGACGCAAGCTGCAAATAGTGTGCGTGCAGGCGGGCAACATCC
GATGCGATAGCATCCGGTGCGCCGTTATTATCAATGACGTCATCTGCCACGGCAAGGCGG
GCTTCGCGCGTTGCCTGAGCAGCAAGGATTTGTTCGACATGCTCGCGAGTTACATCATCG
CGCTGCATGGTGCGCTTAAGTTGCGTTTCTGGGCTGACATCCACCACAAGCACTCGATTC
GCTTTTTTATACAGTGAGTTTTCTACCAGCAATGGCACAACCCACAGTACATAGGGGGAA
GTAGCTTGCTGGATCTGGTGTTGCGTCTCTTGCTGAATCAGCGGATGCAGCAGGGCGTTA
AGCCAGTTTTTCTCTTCCGGGTTGGCGAAGATCCGCTCGCGCAAGGCCCGGCGCTGCAAT
GTTCCATCAGCAGCAATCATGTTAGCGCCAAAGTGATCAGCAATGGCATGTAGCGCAGGT
GCACCTGGTTCAACCACCTGACGCGCAATAATATCGGCATCAATGACGTTAATTCCGAGA
TCAGCAAACGCATTGGCAACGGTACTCTTGCCACTGCCAATGCCTCCCGTTAAGGCAACT
ATATACCTCATAATTTATATTCCCGGGAATTCATCATGATTATCAAAACGTTAAAAATGA
GTGCACGAAAGCGAAATTGATGAAACGTTCGCTCACTATTTACCAGGTAAATTTATGGGA
TTGTAGCGTAAAAAAAGACAATTTCGCAGTCTTGCGCCGCATTGATTAGTGCGTATGATA
GCGTCACTGGAGTTGCGCTCTTACCCTTATAGCCATTAACCCCAGGAATCCGCACATGCG
TATTGAAGAAGATCTGAAGTTAGGTTTTAAAGACGTTCTCATCCGCCCTAAACGCTCCAC
TCTTAAAAGCCGTTCCGATGTTGAACTGGAACGTCAATTCACCTTCAAACATTCAGGTCA
GAGCTGGTCCGGCGTGCCGATTATCGCCGCAAATATGGACACCGTAGGCACATTTTCTAT
GGCCTCTGCGCTGGCTTCTTTTGATATTTTGACTGCTGTGCATAAACACTATTCTGTCGA
AGAGTGGCAAGCGTTTATCAACAATTCTTCCGCTGATGTGCTGAAACATGTGATGGTTTC
TACCGGTACGTCTGATGCGGATTTCGAAAAAACTAAACAGATTCTCGACCTGAACCCGGC
ATTAAACTTCGTTTGTATTGACGTGGCGAATGGTTATTCCGAACACTTCGTGCAGTTCGT
TGCGAAAGCGCGTGAAGCGTGGCCGACCAAAACCATTTGTGCTGGTAACGTAGTGACTGG
TGAAATGTGTGAGGAGCTTATCCTCTCAGGTGCCGATATCGTTAAAGTTGGCATTGGCCC
AGGTTCTGTTTGTACAACTCGCGTCAAAACAGGCGTCGGTTATCCGCAACTTTCTGCGGT
AATCGAATGTGCCGATGCTGCGCACGGTCTGGGCGGAATGATCGTCAGCGATGGTGGCTG
CACCACGCCGGGCGATGTGGCGAAAGCCTTTGGCGGCGGTGCCGATTTCGTCATGCTTGG
CGGCATGCTGGCGGGCCACGAAGAGAGCGGCGGTCGCATCGTTGAGGAGAACGGCGAGAA
ATTTATGCTGTTCTACGGCATGAGCTCCGAGTCTGCGATGAAACGTCACGTTGGCGGCGT
TGCGGAATATCGCGCAGCAGAAGGTAAAACCGTTAAGCTGCCGCTGCGAGGCCCGGTTGA
AAATACCGCGCGAGATATTTTGGGCGGCCTGCGTTCAGCTTGTACATACGTTGGGGCTTC
ACGCCTGAAAGAGCTGACCAAGCGCACCACGTTTATTCGTGTGCAGGAACAAGAAAACCG
CATCTTCAACAACCTGTAATCTCCCAACGCTGGCGTGGAGCAACACGCCAGCGTTATCCC
ATCCCACTCATCGCATCGCCTAAATGGAAAATTGGCAGATACATTGCCACCACCAGCGTA
CCAATAATTCCTCCCGTTATGATCAGCAACGCCGGTTCCAGTAAGGCTGCGAGGTTATCC
GCCAGCGCCATTGTGTTTTCCCGATGATGATGGGCGAGGTTGTCTAACATGAGATCCAGA
GAGCCGGATGCCTCTCCTGTTCTCACTAATTGCAAACAGAGCGGGCTAAACTCACCGGTA
TTTTTTAGCGCCAGCCAGATGGGTTGACCGTTACTGATATCGTGCTGGATTTGTGTCAGA
AGTTGCACCCAGTACGGGCAGCGCATTGTTTCTCTGACGCTCTCTACGCCCTGTAAAAAA
GTAATGCCTGCACTTTGTGTCAGCGCCAGAATCGTAAAGATCTGCGTGAGTTTTTGTCCC
CGCATCAGTGAACCCATAATCGGGATGCGTAACAGCAATTTCTGCCGCACTATAAGCCAG
GTCGGTCGGCGCATCAGCAACTTATTGGCTATCGCCAGCAGAAAGCCGAACAACACCAGC
AGCCAGCTCCATTCGCCACTAAAGTCTGCCAGCGTCATGATCCCCTGCGTTAGTGCCGGT
AGTGGGGTGTTGAAGGTCTTATAGATAGCGGCAAACTCCGGCAGAACAAAATGCAGCATT
GCCACAACCACCATGATTGCCATCGCTAAAATGATGATGGGATAACGTAACGCTGATTTC
ACTTTGTCGGTCAACTGACGCTGGGCTTTTTGCTGACGCGCCAGTTCAAAGCAGCATTCA
TCCAGCTTACCGGTCAGTTCACCCGTGCGGATCATCGCCTGATAGAGCGGCGGAAATACC
TCTGACCAGGGTAATAAGGCATTGGAAAAAGCAATGCCCTGTTCGAGATCGTGCGCCAGC
GATTGCAGCAACGCTTGCCATTGCTTACTGGGATGCTGTTCCGCCAGCAGAGCCAGCCCT
TCAGAAAGCGTTAACCCTGCTTTGAGTAGCGTCGCCAGTTGATGAATGACTTCCGCGCTT
TTATCTCCTCGCCACTGCGCAGAATTGATGGCGATTCGCTTCAGGCTTAGTGGGGTAACC
ATCTGTTGCTGTAGTGCCATAAGCAGTAAAGTACGGCTCTCTGCCCATAGCATCCCATCT
TGCGCATTGCCGTCGCCGGTTATGCCATGCCAGCGCCAGAGTTGCTTACTCGCCATGCGG
CATCCCCAGTACGCGGATTAACTCTTCAAAGGTGGTTAAGCCTTGCTCTACGGCCAGGCA
GCCGTTTTCAAAAAGCGTACGCATACCCGCCTGTCGTGCGTGCGTTTCCAGCGATTCAAC
GTCGGTATTAGCGGAAATAAGCTGACGAATGACCGGCGTTATGGGCAGAACTTCAAATAA
GGCCGTACGACCATAAAAACCGTGGTAGCAATGTACACAACCGGGTGCCTGCCAGTGGGG
CAGCGGCGATGGCCATACATTGTCTGGAATGTGGATGGGCTCCCCTTGCTGCCGGCGACA
ATGTGGGCAAAGTTTGCGTACCAGACGCTGGGCTATTACCAGCGTAAGCGCCGATGATAG
CATCCAGCGGGCGACCCCCATTTGCTGTAAACGTACCAGCGTTTCGCAGGTGGAATTAGT
GTGTAGGGTAGACAACACCAGGTGACCAGTTTGCGCCGCTTTAATAGCGATCTCTGCTGT
TTCGCCATCGCGGATCTCTCCGATCATGATGACGTCAGGATCCTGGCGCAATAACGCACG
CAAAACGCCCTGAAAGGTGAGTCCGGCACGCGGATGGATTTGCGTCTGGTTTAGTCCGGC
TATGGGGATCTCAACTGGATCTTCGACGCTACAAATATTAATGTCAGCGGTATTCAGCTT
TTGCAGGGCACTATAAAGCGTGACCGTTTTGCCGCTGCCGGTAGGGCCAGTTACCAGCAC
CAGTCCCTGTGGTTGTTGCAAGGCATGAGCAAAGTCCGCCAGTTGTAACGGCTGCATTCC
AAGCGTGTTGACATCCAGTGCCTGACCCACCTGCTGTAACAACCTTAATACCACCTTTTC
ACCACCCCGACATGGTAAGGTCGCAATACGAAATGAGACGGCGTTTCCTGCCAGTTCGAC
AGTGAATTGCCCGTCCTGCGGCAGGCGATGTTCCGCAATATCCAGGTTTCCCAGCACTTT
TAATCTGGCGGTTAATGCGACTCCGGCATCCGGTGAAACATCCGGTAAAGGATGCAATAC
GCCGTCGATACGCAAGCGGATGCGGTAGGCATTGTCCGCTGGTTCGATATGAATATCAGA
CGCGCGTTGTTCCAGCGCAGATTGTAACGTTCGAGTTAGCAACTCTGCTTTGGGCTGATG
CTTCTCCTGAACAGCTACGGGCAATGTCTGTTGTGTGCGACTGGCGTGACCTTCCATTTG
TTGGCGCGTCCAGCAGGTGATCTCAATACGTTTGGTGGTAGCGAAATGCAATGCGTCCAG
TAGCTCATGCGAAGGTGCATCGACTACCGCAACATGAACCACCTCTTCGCTGGCATCCAG
CAAGACTCCATGATAACGCAGACACAGGGCAGTGAGCTGTGGAATATTCATTGCCGCTCC
TTAGTTGGCGTCATCAAAGCGGAAGACATCTTCGCAGGCTTGCTGCAATGCGCTGTCACT
TTGAATATTGCAGTTGCGCGTCCAGCCGGTGACGCCGTTTGCGTTATCCCAACCCGGTGT
CATGACGACGCTTAGCCCATTGAGACTTTCTTGCCCGGTCAGCGACACCACGCCCTTTGC
CACACTCATGGCTGAAACATAGCGGGTGGTGGTAGGCGAGGGAATGCCATTGCTGCCACC
GTCGCAGGTATCTAATCCACCATGTTCCAGCGCGCACAACTCTACGGCGGTACGGTAAGG
CACAAAGGTTTGTAGCATGTCGGTGAGTGCGGCTTTGCGCAGGTAGTTTTGATAAGCGGG
AATACCAATGGCGCTTAAAATGGCAATGATGCCAATAACCACCATCAGTTCGATAAGTGT
AAAACCGCGTTGCTTGTCCATCTGTTTCGCTCCTTGATTTGGTTGGCGCTACTTTGGCAA
ACGCCATCAGCACAGGCGAGGGGCAAAAAACGAAACGGGAAAGCAGATTCCGAGGTTTTT
TATTTCGTTGCAGCGAAAGACAAGAAATTTGCGAGGCGTTACGAAGAAAGTTGGGGAAGG
GGAGATTATCCGCCCGCGATGGAGCGGATAAATCTGTCAACTATTAGCGAAAACGCATTG
AAAGGTCGAGTGCTTGTACGTGTTTAGTTAGCGCACCGACGGAGATAAAGTCCACGCCCG
TTTCGGCAAATTCACGCAGTGTTTTGTCAGTGACGTTGCCAGACACTTCCAGTAGCGCCT
TGCCGTTGGTGCGTTTGACGGCTTCGCGCATCTGTTCTGTTTCGAAGTTATCCAGCATGA
TGATATCGGCTCCTGCTTTCAGGGCTTCATCAAGTTCTTCCAGATTCTCTACTTCGACTT
CTACTGGCGCATCCGGGTGCAGCCAGGACGCTTTTTCGACCGCCTGGCGCACTGAGCCGG
AGGCAATAATATGGTTTTCTTTGATCAGGAAGGCATCAGAAAGCCCCAGACGGTGATTCG
CTCCGCCGCCGCAAAGTACCGCGTATTTCAGAGCTGAACGCAGGCCGGGTAAGGTTTTGC
GCGTATCCAACAACTGCGTGTTGGTGCCTTCCAGCAATTCGACATAGTGGCGTACCTTAC
TGGCAACTCCTGAAAGGGTTTGCACAAAATTAAGCGCAGTGCGTTCGCCCGTTAACAGCA
CGCGGGATGGGCCTTCAAGTTCGAACAAGGATTGATTGGCATTGATGACATCGCCGTCAT
CCACATGCCAGATTATGGTGACATCGTCGCCTGCCAGTTGAATAAACACCTCTTCAACCC
AGCGTTTGCCGCAAAAGACGCCATTCTCGCGGGTGATCACCGTGGCATGAGAGCGAGAAT
TTTCCGGTAAAAGTTTTGCCGTAATATCATTGTTGGCATCGACTGTTCCGCCTAAATCTT
CCCGCAGCGCCTGGGCCACCGCGCCGGGGATATCGAGATTAATGCGTTCCAGCAGCTCGT
CACGTCGGGTGTCAGGGTTATAGCGGCGAGGCGGCATGTTAAAACTCCAGATAGCTAACG
AATCATAAGGTAGAAACATGCTACTCTGAACCGGGTATTAGCACCACATATAAGGAGATC
CTGCATGTTGTTAGAACAGGGGTGGCTGGTTGGCGCGCGCCGCGTTCCCTCACCACATTA
CGATTGCCGCCCGGATGACGAAACACCCACCCTGCTGGTGGTGCACAATATTAGCCTGCC
GCCAGGCGAGTTTGGCGGTCCGTGGATCGACGCATTATTCACTGGAACTATTGATCCGCA
GGCACATCCTTTCTTTGCTGAGATCGCCCATTTGCGCGTCTCCGCTCACTGTTTGATTCG
CCGTGATGGTGAAATAGTCCAGTATGTTCCTTTCGATAAACGTGCATGGCATGCGGGAGT
CTCTCAGTATCAGGGGCGCGAACGCTGCAATGATTTTTCTATTGGGATTGAGCTTGAAGG
CACCGATACGCTGGCGTATACCGATGCGCAGTATCAACAGCTTGCGGCGGTTACGCGGGC
ACTGATTGATTGCTATCCGGATATCGCTAAAAACATGACGGGCCATTGTGATATTGCGCC
GGATCGGAAAACCGATCCCGGTCCTGCATTTGATTGGGCACGGTTTCGTGTGCTGGTCAG
CAAGGAGACAACATGACGCTATTTACAACCTTACTGGTGTTAATTTTCGAGCGCCTGTTT
AAGTTGGGCGAGCACTGGCAGCTTGATCATCGTCTTGAAGCGTTCTTTCGGCGGGTGAAA
CATTTTTCTCTCGGGCGCACGTTAGGCATGACCATTATTGCGATGGGCGTGACTTTTTTA
CTGTTACGCGCATTGCAGGGAGTATTGTTCAACGTTCCCACGCTACTGGTGTGGCTGCTG
ATTGGTTTGCTGTGTATTGGCGCAGGTAAAGTTCGTCTTCATTATCATGCTTATCTGACA
GCTGCTTCACGTAATGATAGCCATGCCCGTGCCACGATGGCTGGCGAACTCACCATGATT
CACGGCGTCCCGGCAGGCTGCGACGAACGTGAGTATTTGCGTGAGCTGCAAAATGCATTG
CTGTGGATTAACTTTCGTTTTTATCTTGCACCGCTGTTCTGGCTGATTGTGGGGGGAACC
TGGGGACCCGTTACGCTGATGGGGTATGCGTTTTTGCGTGCATGGCAATACTGGCTGGCG
CGATATCAGACGCCGCATCATCGTTTACAGTCCGGCATTGATGCCGTGCTTCATGTACTG
GATTGGGTGCCGGTTCGTCTTGCGGGTGTGGTATATGCCTTGATCGGTCATGGTGAGAAA
GCGTTACCGGCCTGGTTTGCTTCGCTGGGTGATTTCCATACTTCGCAGTATCAGGTGTTA
ACGCGTCTGGCGCAGTTCTCTCTGGCGCGTGAACCGCATGTCGATAAGGTGGAGACGCCG
AAGGCAGCGGTTTCAATGGCGAAGAAAACCTCGTTCGTGGTCGTGGTGGTGATTGCACTA
CTGACGATTTACGGGGCGTTGGTGTAAAGATTATTGCCCTCACCCTGTACGGGTGAGGGC
GTAGAGAGATTAATGCGCTTTTACGGCTTTGGCGGTTTTCTCTTTAAACAGATAGCCGAT
ACCTAACACGATCAGCCATACCGGGATCAGGTATACCGAAATCGCCATTCCTGGGGTCAT
CAGCATAATCACCAGTACCGCCGCCATAAACAGCAGGCAGATCCAGTTACCCAGCGGATA
AAGCAGAGCAGGGAAGCGAGTTACCACGCCTTGTTCCTGCTTGGCGCGACGGAATTTCAT
ATGCGCCAGGCTAATCATCGCCCAGTTGATTACCAGTGCAGATACCACCAGCGCCATTAA
CAGTCCGAAAGCGGACTCTGGGGCAAGGTAGTTAATCAGTACGCACAACGCCGTTACCAG
TGCAGACACCAGAATGGTATTTACTGGTACACCACGTTTATCGACAGACGCCAGCGCTTT
TGGCGCATTACCCTGTTGTGCCAGACCAAACAGCATACGGCTGTTGCAATATACGCAGCT
GTTGTACACGGAGAGCGCCGCAGTCAGTACCACGATGTTCAGCGCATTCGCCACAAAGGT
ATCGCCTAACTCGTGGAAGATCAGCACAAACGGACTGGTATCGGCGGTAACGCGGGTCCA
CGGCATCAGTGAGAGCAGAACGGCTAACGAACCAATATAGAAAATCAGGATGCGGTAGAT
AACCTGGTTAGTTGCTTTCGGTATACTTTGCTCCGGGTTATCAGCTTCTGCTGCGGTGAT
CCCCACCAGTTCCAGACCACCGAACGAGAACATGATAATCGCCATCATCATCACCAGCCC
GGTGAAGCCGTGCGGCAGGAAACCACCCTGATCCCACAGGTTGCTAACGGTCGCCTGCGG
GCCGCCGTTGCCACTGAATAGCAGCCAGCCGCCGAAGATGATCATCGCTACCACCGCGAT
AACTTTGATAATGGCAAACCAGAACTCCATCTCGCCAAACACTTTAACGTTGGTCAGGTT
GATGGCGTTAATCACCACAAAGAATACGGCGGCAGAAACCCAGGTGGGGATTTCCGGATA
CCAGAACTGAATGTATTTACCCACGGCAGTCAGCTCAGCCATGGCAACTAAAACGTACAG
TACCCAGTAGTTCCAGCCAGAGGCGAAACCGGCAAAACTGCCCCAGTATTTATAAGCAAA
GTGGCTAAAGGAGCCTGCGACAGGTTCTTCGACCACCATTTCACCCAGCTGACGCATGAT
CAGAAAGGCGATAAAACCAGCAATGGCGTAACCCAGGATAATCCCTGGCCCTGCGGACTG
TATTACGGAGGCGCTACCCAGGAATAACCCGGTCCCTATCGCGCCACCCAGCGCGATAAG
CTGAATATGGCGGTTTTTAAGGCCGCGCTTTAGCTGCTCGCCGTGCTGTTGACCTTCCAT
CATGAAACCTCGTGCGGTGGTTGTTTTTTTGATCTACGCAGTGATGCGTGTGTAAGTTTG
CAATTCCGTTTGTTGTATTAATTTGTTTACATCAAAGAAGTTTGAATTGTTACAAAAAGA
CTTCCGTCAGATCAAGAATAATGGTATGCGGCAGCGAATGCACCCGCTTTATGCATGGTT
GAAGATGAGTTGCTTAAAAAGAAACCGTTTGTAAAGCTCAGCCTCAACCCCTCTCAATAT
GTAGAATGAATTTAAATTCGTTTTAATTGAATTAAAAATCACAAAATTGGTAAGTGAATC
GGTTCAATTCGGATTTTTATAGTTTAATAATCGTTAAAAAACTCCTTTCCTACGTAAAGT
CTACATTTGTGCATAGTTACAACTTTGAAACGTTATATATGTCAAGTTGTTAAAATGTGC
ACAGTTTCATGATTTCAATCAAAACCTGTATGGACATAAGGTGAATACTTTGTTACTTTA
GCGTCACAGACATGAAATTGGTAAGACCAATTGACTTCGGCAAGTGGCTTAAGACAGGAA
CTCATGGCCTACAGCAAAATCCGCCAACCAAAACTCTCCGATGTGATTGAGCAGCAACTG
GAGTTTTTGATCCTCGAAGGCACTCTCCGCCCGGGCGAAAAACTCCCACCGGAACGCGAA
CTGGCAAAACAGTTTGACGTCTCCCGTCCCTCCTTGCGTGAGGCGATTCAACGTCTCGAA
GCGAAGGGCTTGTTGCTTCGTCGCCAGGGTGGCGGCACTTTTGTCCAGAGCAGCCTATGG
CAAAGCTTCAGCGATCCGCTGGTGGAGCTGCTCTCCGACCATCCTGAGTCACAGTATGAC
TTGCTCGAAACACGACACGCCCTGGAAGGTATCGCCGCTTATTACGCCGCGCTGCGTAGT
ACCGATGAAGACAAGGAACGCATCCGTGAACTCCACCACGCCATAGAGCTGGCGCAGCAG
TCTGGCGATCTGGACGCGGAATCAAACGCCGTACTCCAGTATCAGATTGCCGTCACCGAA
GCGGCCCACAATGTGGTTCTGCTTCATCTGCTAAGGTGTATGGAGCCGATGTTGGCCCAG
AATGTCCGCCAGAACTTCGAATTGCTCTATTCGCGTCGCGAGATGCTGCCGCTGGTGAGT
AGTCACCGCACCCGCATATTTGAAGCGATTATGGCCGGTAAGCCGGAAGAAGCGCGCGAA
GCATCGCATCGCCATCTGGCCTTTATCGAAGAAATTTTGCTCGACAGAAGTCGTGAAGAG
AGCCGCCGTGAGCGTTCTCTGCGTCGTCTGGAGCAACGAAAGAATTAGTGATTTTTCTGG
TAAAAATTATCCAGAAGATGTTGTAAATCAAGCGCATATAAAAGCGCGGCAACTAAACGT
AGAACCTGTCTTATTGAGCTTTCCGGCGAGAGTTCAATGGGACAGGTTCCAGAAAACTCA
ACGTTATTAGATAGATAAGGAATAACCCATGTCAGAACGTTTCCCAAATGACGTGGATCC
GATCGAAACTCGCGACTGGCTCCAGGCGATCGAATCGGTCATCCGTGAAGAAGGTGTTGA
GCGTGCTCAGTATCTGATCGACCAACTGCTTGCTGAAGCCCGCAAAGGCGGTGTAAACGT
AGCCGCAGGCACAGGTATCAGCAACTACATCAACACCATCCCCGTTGAAGAACAACCGGA
GTATCCGGGTAATCTGGAACTGGAACGCCGTATTCGTTCAGCTATCCGCTGGAACGCCAT
CATGACGGTGCTGCGTGCGTCGAAAAAAGACCTCGAACTGGGCGGCCATATGGCGTCCTT
CCAGTCTTCCGCAACCATTTATGATGTGTGCTTTAACCACTTCTTCCGTGCACGCAACGA
GCAGGATGGCGGCGACCTGGTTTACTTCCAGGGCCACATCTCCCCGGGCGTGTACGCTCG
TGCTTTCCTGGAAGGTCGTCTGACTCAGGAGCAGCTGGATAACTTCCGTCAGGAAGTTCA
CGGCAATGGCCTCTCTTCCTATCCGCACCCGAAACTGATGCCGGAATTCTGGCAGTTCCC
GACCGTATCTATGGGTCTGGGTCCGATTGGTGCTATTTACCAGGCTAAATTCCTGAAATA
TCTGGAACACCGTGGCCTGAAAGATACCTCTAAACAAACCGTTTACGCGTTCCTCGGTGA
CGGTGAAATGGACGAACCGGAATCCAAAGGTGCGATCACCATCGCTACCCGTGAAAAACT
GGATAACCTGGTCTTCGTTATCAACTGTAACCTGCAGCGTCTTGACGGCCCGGTCACCGG
TAACGGCAAGATCATCAACGAACTGGAAGGCATCTTCGAAGGTGCTGGCTGGAACGTGAT
CAAAGTGATGTGGGGTAGCCGTTGGGATGAACTGCTGCGTAAGGATACCAGCGGTAAACT
GATCCAGCTGATGAACGAAACCGTTGACGGCGACTACCAGACCTTCAAATCGAAAGATGG
TGCGTACGTTCGTGAACACTTCTTCGGTAAATATCCTGAAACCGCAGCACTGGTTGCAGA
CTGGACTGACGAGCAGATCTGGGCACTGAACCGTGGTGGTCACGATCCGAAGAAAATCTA
CGCTGCATTCAAGAAAGCGCAGGAAACCAAAGGCAAAGCGACAGTAATCCTTGCTCATAC
CATTAAAGGTTACGGCATGGGCGACGCGGCTGAAGGTAAAAACATCGCGCACCAGGTTAA
GAAAATGAACATGGACGGTGTGCGTCATATCCGCGACCGTTTCAATGTGCCGGTGTCTGA
TGCAGATATCGAAAAACTGCCGTACATCACCTTCCCGGAAGGTTCTGAAGAGCATACCTA
TCTGCACGCTCAGCGTCAGAAACTGCACGGTTATCTGCCAAGCCGTCAGCCGAACTTCAC
CGAGAAGCTTGAGCTGCCGAGCCTGCAAGACTTCGGCGCGCTGTTGGAAGAGCAGAGCAA
AGAGATCTCTACCACTATCGCTTTCGTTCGTGCTCTGAACGTGATGCTGAAGAACAAGTC
GATCAAAGATCGTCTGGTACCGATCATCGCCGACGAAGCGCGTACTTTCGGTATGGAAGG
TCTGTTCCGTCAGATTGGTATTTACAGCCCGAACGGTCAGCAGTACACCCCGCAGGACCG
CGAGCAGGTTGCTTACTATAAAGAAGACGAGAAAGGTCAGATTCTGCAGGAAGGGATCAA
CGAGCTGGGCGCAGGTTGTTCCTGGCTGGCAGCGGCGACCTCTTACAGCACCAACAATCT
GCCGATGATCCCGTTCTACATCTATTACTCGATGTTCGGCTTCCAGCGTATTGGCGATCT
GTGCTGGGCGGCTGGCGACCAGCAAGCGCGTGGCTTCCTGATCGGCGGTACTTCCGGTCG
TACCACCCTGAACGGCGAAGGTCTGCAGCACGAAGATGGTCACAGCCACATTCAGTCGCT
GACTATCCCGAACTGTATCTCTTACGACCCGGCTTACGCTTACGAAGTTGCTGTCATCAT
GCATGACGGTCTGGAGCGTATGTACGGTGAAAAACAAGAGAACGTTTACTACTACATCAC
TACGCTGAACGAAAACTACCACATGCCGGCAATGCCGGAAGGTGCTGAGGAAGGTATCCG
TAAAGGTATCTACAAACTCGAAACTATTGAAGGTAGCAAAGGTAAAGTTCAGCTGCTCGG
CTCCGGTTCTATCCTGCGTCACGTCCGTGAAGCAGCTGAGATCCTGGCGAAAGATTACGG
CGTAGGTTCTGACGTTTATAGCGTGACCTCCTTCACCGAGCTGGCGCGTGATGGTCAGGA
TTGTGAACGCTGGAACATGCTGCACCCGCTGGAAACTCCGCGCGTTCCGTATATCGCTCA
GGTGATGAACGACGCTCCGGCAGTGGCATCTACCGACTATATGAAACTGTTCGCTGAGCA
GGTCCGTACTTACGTACCGGCTGACGACTACCGCGTACTGGGTACTGATGGCTTCGGTCG
TTCCGACAGCCGTGAGAACCTGCGTCACCACTTCGAAGTTGATGCTTCTTATGTCGTGGT
TGCGGCGCTGGGCGAACTGGCTAAACGTGGCGAAATCGATAAGAAAGTGGTTGCTGACGC
AATCGCCAAATTCAACATCGATGCAGATAAAGTTAACCCGCGTCTGGCGTAAGAGGTAAA
AGAATAATGGCTATCGAAATCAAAGTACCGGACATCGGGGCTGATGAAGTTGAAATCACC
GAGATCCTGGTCAAAGTGGGCGACAAAGTTGAAGCCGAACAGTCGCTGATCACCGTAGAA
GGCGACAAAGCCTCTATGGAAGTTCCGTCTCCGCAGGCGGGTATCGTTAAAGAGATCAAA
GTCTCTGTTGGCGATAAAACCCAGACCGGCGCACTGATTATGATTTTCGATTCCGCCGAC
GGTGCAGCAGACGCTGCACCTGCTCAGGCAGAAGAGAAGAAAGAAGCAGCTCCGGCAGCA
GCACCAGCGGCTGCGGCGGCAAAAGACGTTAACGTTCCGGATATCGGCAGCGACGAAGTT
GAAGTGACCGAAATCCTGGTGAAAGTTGGCGATAAAGTTGAAGCTGAACAGTCGCTGATC
ACCGTAGAAGGCGACAAGGCTTCTATGGAAGTTCCGGCTCCGTTTGCTGGCACCGTGAAA
GAGATCAAAGTGAACGTGGGTGACAAAGTGTCTACCGGCTCGCTGATTATGGTCTTCGAA
GTCGCGGGTGAAGCAGGCGCGGCAGCTCCGGCCGCTAAACAGGAAGCAGCTCCGGCAGCG
GCCCCTGCACCAGCGGCTGGCGTGAAAGAAGTTAACGTTCCGGATATCGGCGGTGACGAA
GTTGAAGTGACTGAAGTGATGGTGAAAGTGGGCGACAAAGTTGCCGCTGAACAGTCACTG
ATCACCGTAGAAGGCGACAAAGCTTCTATGGAAGTTCCGGCGCCGTTTGCAGGCGTCGTG
AAGGAACTGAAAGTCAACGTTGGCGATAAAGTGAAAACTGGCTCGCTGATTATGATCTTC
GAAGTTGAAGGCGCAGCGCCTGCGGCAGCTCCTGCGAAACAGGAAGCGGCAGCGCCGGCA
CCGGCAGCAAAAGCTGAAGCCCCGGCAGCAGCACCAGCTGCGAAAGCGGAAGGCAAATCT
GAATTTGCTGAAAACGACGCTTATGTTCACGCGACTCCGCTGATCCGCCGTCTGGCACGC
GAGTTTGGTGTTAACCTTGCGAAAGTGAAGGGCACTGGCCGTAAAGGTCGTATCCTGCGC
GAAGACGTTCAGGCTTACGTGAAAGAAGCTATCAAACGTGCAGAAGCAGCTCCGGCAGCG
ACTGGCGGTGGTATCCCTGGCATGCTGCCGTGGCCGAAGGTGGACTTCAGCAAGTTTGGT
GAAATCGAAGAAGTGGAACTGGGCCGCATCCAGAAAATCTCTGGTGCGAACCTGAGCCGT
AACTGGGTAATGATCCCGCATGTTACTCACTTCGACAAAACCGATATCACCGAGTTGGAA
GCGTTCCGTAAACAGCAGAACGAAGAAGCGGCGAAACGTAAGCTGGATGTGAAGATCACC
CCGGTTGTCTTCATCATGAAAGCCGTTGCTGCAGCTCTTGAGCAGATGCCTCGCTTCAAT
AGTTCGCTGTCGGAAGACGGTCAGCGTCTGACCCTGAAGAAATACATCAACATCGGTGTG
GCGGTGGATACCCCGAACGGTCTGGTTGTTCCGGTATTCAAAGACGTCAACAAGAAAGGC
ATCATCGAGCTGTCTCGCGAGCTGATGACTATTTCTAAGAAAGCGCGTGACGGTAAGCTG
ACTGCGGGCGAAATGCAGGGCGGTTGCTTCACCATCTCCAGCATCGGCGGCCTGGGTACT
ACCCACTTCGCGCCGATTGTGAACGCGCCGGAAGTGGCTATCCTCGGCGTTTCCAAGTCC
GCGATGGAGCCGGTGTGGAATGGTAAAGAGTTCGTGCCGCGTCTGATGCTGCCGATTTCT
CTCTCCTTCGACCACCGCGTGATCGACGGTGCTGATGGTGCCCGTTTCATTACCATCATT
AACAACACGCTGTCTGACATTCGCCGTCTGGTGATGTAAGTAAAAGAGCCGGCCCAACGG
CCGGCTTTTTTCTGGTAATCTCATGAATGTATTGAGGTTATTAGCGAATAGACAAATCGG
TTGCCGTTTGTTGTTTAAAAATTGTTAACAATTTTGTAAAATACCGACGGATAGAACGAC
CCGGTGGTGGTTAGGGTATTACTTCACATACCCTATGGATTTCTGGGTGCAGCAAGGTAG
CAAGCGCCAGAATCCCCAGGAGCTTACATAAGTAAGTGACTGGGGTGAGGGCGTGAAGCT
AACGCCGCTGCGGCCTGAAAGACGACGGGTATGACCGCCGGAGATAAATATATAGAGGTC
ATGATGAGTACTGAAATCAAAACTCAGGTCGTGGTACTTGGGGCAGGCCCCGCAGGTTAC
TCCGCTGCCTTCCGTTGCGCTGATTTAGGTCTGGAAACCGTAATCGTAGAACGTTACAAC
ACCCTTGGCGGTGTTTGCCTGAACGTCGGCTGTATCCCTTCTAAAGCACTGCTGCACGTA
GCAAAAGTTATCGAAGAAGCCAAAGCGCTGGCTGAACACGGTATCGTCTTCGGCGAACCG
AAAACCGATATCGACAAGATTCGTACCTGGAAAGAGAAAGTGATCAATCAGCTGACCGGT
GGTCTGGCTGGTATGGCGAAAGGCCGCAAAGTCAAAGTGGTCAACGGTCTGGGTAAATTC
ACCGGGGCTAACACCCTGGAAGTTGAAGGTGAGAACGGCAAAACCGTGATCAACTTCGAC
AACGCGATCATTGCAGCGGGTTCTCGCCCGATCCAACTGCCGTTTATTCCGCATGAAGAT
CCGCGTATCTGGGACTCCACTGACGCGCTGGAACTGAAAGAAGTACCAGAACGCCTGCTG
GTAATGGGTGGCGGTATCATCGGTCTGGAAATGGGCACCGTTTACCACGCGCTGGGTTCA
CAGATTGACGTGGTTGAAATGTTCGACCAGGTTATCCCGGCAGCTGACAAAGACATCGTT
AAAGTCTTCACCAAGCGTATCAGCAAGAAATTCAACCTGATGCTGGAAACCAAAGTTACC
GCCGTTGAAGCGAAAGAAGACGGCATTTATGTGACGATGGAAGGCAAAAAAGCACCCGCT
GAACCGCAGCGTTACGACGCCGTGCTGGTAGCGATTGGTCGTGTGCCGAACGGTAAAAAC
CTCGACGCAGGCAAAGCAGGCGTGGAAGTTGACGACCGTGGTTTCATCCGCGTTGACAAA
CAGCTGCGTACCAACGTACCGCACATCTTTGCTATCGGCGATATCGTCGGTCAACCGATG
CTGGCACACAAAGGTGTTCACGAAGGTCACGTTGCCGCTGAAGTTATCGCCGGTAAGAAA
CACTACTTCGATCCGAAAGTTATCCCGTCCATCGCCTATACCGAACCAGAAGTTGCATGG
GTGGGTCTGACTGAGAAAGAAGCGAAAGAGAAAGGCATCAGCTATGAAACCGCCACCTTC
CCGTGGGCTGCTTCTGGTCGTGCTATCGCTTCCGACTGCGCAGACGGTATGACCAAGCTG
ATTTTCGACAAAGAATCTCACCGTGTGATCGGTGGTGCGATTGTCGGTACTAACGGCGGC
GAGCTGCTGGGTGAAATCGGCCTGGCAATCGAAATGGGTTGTGATGCTGAAGACATCGCA
CTGACCATCCACGCGCACCCGACTCTGCACGAGTCTGTGGGCCTGGCGGCAGAAGTGTTC
GAAGGTAGCATTACCGACCTGCCGAACCCGAAAGCGAAGAAGAAGTAATTTTTCGTTTGC
CGGAACATCCGGCAATTAAAAAAGCGGCTAACCACGCCGCTTTTTTTACGTCTGCAATTT
ACCTTTCCAGTCTTCTTGCTCCACGTTCAGAGAGACGTTCGCATACTGCTGACCGTTGCT
CGTTATTCAGCCTGACAGTATGGTTACTGTCGTTTAGACGTTGTGGGCGGCTCTCCTGAA
CTTTCTCCCGAAAAACCTGACGTTGTTCAGGTGATGCCGATTGAACACGCTGGCGGGCGT
TATCACGTTGCTGTTGATTCAGTGGGCGCTGCTGTACTTTTTCCTTAAACACCTGGCGCT
GCTCTGGTGATGCGGACTGAATACGCTCACGCGCTGCGTCTCTTCGCTGCTGGTTCTGCG
GGTTAGTCTGCATTTTCTCGCGAACCGCCTGGCGCTGCTCAGGCGAGGCGGACTGAATGC
GCTCACGCGCTGCCTCTCTTCGCTGCTGGATCTTCGGGTTAGTCTGCATTCTCTCGCGAA
CTGCCTGGCGCTGCTCAGGCGAGGCGGACTGATAACGCTGACGAGCGGCGTCCTTTTGTT
GCTGGGTCAGTGGTTGGCGACGGCTGAAGTCGTGGAAGTCGTCATAGCTCCCATAGTGTT
CAGCTTCATTAAACCGCTGTGCCGCTGCCTGACGTTGGGTATCTCGTGTAATGACTGGTG
CGGCGTGTGTTCGTTGCTGAAACTGATTTGCTGCCGCCTGACGCTGGCTGTCGCGCGTTG
GGGCAGGTAATTGCGTGGCGCTCATTCCGCCGTTGACATCGGTTTGATGAAACCGCTTTG
CCATATCCTGATCATGATAGGGCACACCATTACGGTAGTTTGGATTGTGCCGCCATGCCA
TATTCTTATCAGTAAGATGCTCACCGGTGATACGGTTGAAATTGTTGACGTCGATATTGA
TGTTGTCGCCGTTGTGTTGCCAGCCATTACCGTCACGATGACCGCCATCGTGGTGATGAT
AATCATCATTGTCATGATGATGATGGTCATGATCGTCGTCGTCCCAGTCGATGCTGCTGA
ATAGTGCGTACGTGGTAGCAACGCCCATGCTATAGCCGAATCCGCGTACAAAGCTGTCAA
CAAACGGTTCTCCGGCTGGTGGTGGCAGATAAACCGGCGGATACGCAGTATTGGCCCAGT
TCCCGTAAACCACGGTTGGGTTGTAGTTGGGAATATAGACCACATCAGGATTGGCGGGCT
CAATGGAAATGACGGTTGTTGCCGGCTCTGTAATGACGGGGTTGGCAGTTAAAACTGTAT
TGGATGGTATGACGGGTGCCGTGACTGTCTGTTTTACCGGTACAGCTTTCTTCGTTGTGG
TAATAACTTTCTGTTCGGTTGATGACTTCAGCGAGCCGGTTTGTTGCGCCAGTTGCCGCA
ATCGCTGTACCGAGTCCATCACGTCCTGCGGCTGGGCCAGAAAAGCATCGCCCAGGTTTT
GCACCCATTGCGGGTTTTCGCCCATCAATGCCATCAATTGTGGAAAGGCCACCAGTGATT
TAACGCTGGCGTCCCACGGCTGGTCAGATACCGCCTGAATAGCAGCATCGCCTTGTTTAA
GTGGATTATCGTGCGACCATTGCACTGCTTGAGCAACGTTTGTCGGATAGGTTGATGCCA
TCAGCACCTGCGAAAGTAGGGCGTCGGGATACAGCGCGACGGGCGCGACCCATTGATCTA
TTTGTGCAGTGCTGAATGCGGATTTGACGACGGCGGGTGTTACGGGAGGTGCGGAAACCG
TTGCAGGAAACGTAACCGCGGCAGCGTCAGACACAGCCAGTTGTGTCGATTGCGGTTCCA
CAGGCGCTTCCACTGTGCGGCTTTTTATATATAGCCCGGTAGAGGCGGCACAAAGCCCGG
CACTGCAAATTAGCGCCAGCACATGGGGTTTAAACGGCAAAGTCATTTTCATAATTCGGA
TCTCAAGGAAATCGCAATGGTCGGCGAACTGCCACCCGCAGGTGCTGTGAATCCGAGTAT
AAAGAGGCGGTAGTTTAAATTTTGACTAATCTTGGGATTCGTTGAGAAAGGTGATTATCA
CCATGCGAATTAACGAAGTTTTTACGGAGGGAAACAATCTCTAGACCATCCTTAACGATT
CAGCCACTTTTTTATGTTGCTTTTTTGTAAACAGATTAACACCTCGTCAAAATCCTGCTA
TTCTGCCCGTTGCGGTACTGGGCATTTACCCTACAAACTGCTGTCTCACAGGAGCGTGAA
GAGAATCGCCTGCCGCACTATGACAATGAGAGCGAGGAGAACCGTCGTGCTAGAAGAATA
CCGTAAGCACGTAGCTGAGCGTGCCGCTGAGGGGATTGCGCCCAAACCCCTGGATGCAAA
CCAAATGGCCGCACTTGTAGAGCTGCTGAAAAACCCGCCCGCGGGCGAAGAAGAATTCCT
GTTAGATCTGTTAACCAACCGTGTTCCCCCAGGCGTCGATGAAGCCGCCTATGTCAAAGC
AGGCTTCCTGGCTGCTATCGCGAAAGGCGAAGCCAAATCCCCTCTGCTGACTCCGGAAAA
AGCCATCGAACTGCTGGGCACCATGCAGGGTGGTTACAACATTCATCCGCTGATCGACGC
GCTGGATGATGCCAAACTGGCACCTATTGCTGCCAAAGCACTTTCTCACACGCTGCTGAT
GTTCGATAACTTCTATGACGTAGAAGAGAAAGCGAAAGCAGGCAACGAATATGCGAAGCA
GGTTATGCAGTCCTGGGCGGATGCCGAATGGTTCCTGAATCGCCCGGCGCTGGCTGAAAA
ACTGACCGTTACTGTCTTCAAAGTCACTGGCGAAACTAACACCGATGACCTTTCTCCGGC
ACCGGATGCGTGGTCACGCCCGGATATCCCACTGCACGCGCTGGCGATGCTGAAAAACGC
CCGTGAAGGTATTGAGCCAGACCAGCCTGGTGTTGTTGGTCCGATCAAGCAAATCGAAGC
TCTGCAACAGAAAGGTTTCCCGCTGGCGTACGTCGGTGACGTTGTGGGTACGGGTTCTTC
GCGTAAATCCGCCACTAACTCCGTTCTGTGGTTTATGGGCGATGATATTCCACATGTGCC
GAACAAACGCGGCGGTGGTTTGTGCCTCGGCGGTAAAATTGCACCCATCTTCTTTAACAC
GATGGAAGACGCGGGTGCACTGCCAATCGAAGTCGACGTCTCTAACCTGAACATGGGCGA
CGTGATTGACGTTTACCCGTACAAAGGTGAAGTGCGTAACCACGAAACCGGCGAACTGCT
GGCGACCTTCGAACTGAAAACCGACGTGCTGATTGATGAAGTGCGTGCTGGTGGCCGTAT
TCCGCTGATTATCGGGCGTGGCCTGACCACCAAAGCGCGTGAAGCACTTGGTCTGCCGCA
CAGTGATGTGTTCCGTCAGGCGAAAGATGTCGCTGAGAGCGATCGCGGCTTCTCGCTGGC
GCAAAAAATGGTAGGCCGTGCCTGTGGCGTGAAAGGCATTCGTCCGGGCGCGTACTGTGA
ACCGAAAATGACTTCTGTAGGTTCCCAGGACACCACCGGCCCGATGACCCGTGATGAACT
GAAAGACCTGGCGTGCCTGGGCTTCTCGGCTGACCTGGTGATGCAGTCTTTCTGCCACAC
CGCGGCGTATCCGAAGCCAGTTGACGTGAACACGCACCACACGCTGCCGGACTTCATTAT
GAACCGTGGCGGTGTGTCGCTGCGTCCGGGTGACGGCGTCATTCACTCCTGGCTGAACCG
TATGCTGCTGCCGGATACCGTCGGTACCGGTGGTGACTCCCATACCCGTTTCCCGATCGG
TATCTCTTTCCCGGCGGGTTCTGGTCTGGTGGCGTTTGCTGCCGCAACTGGCGTAATGCC
GCTTGATATGCCGGAATCCGTTCTGGTGCGCTTCAAAGGCAAAATGCAGCCGGGCATCAC
CCTGCGCGATCTGGTACACGCTATTCCGCTGTATGCGATCAAACAAGGTCTGCTGACCGT
TGAGAAGAAAGGCAAGAAAAACATCTTCTCTGGCCGCATCCTGGAAATTGAAGGTCTGCC
GGATCTGAAAGTTGAGCAGGCCTTTGAGCTAACCGATGCGTCCGCCGAGCGTTCTGCCGC
TGGTTGTACCATCAAGCTGAACAAAGAACCGATCATCGAATACCTGAACTCTAACATCGT
CCTGCTGAAGTGGATGATCGCGGAAGGTTACGGCGATCGTCGTACCCTGGAACGTCGTAT
TCAGGGCATGGAAAAATGGCTGGCGAATCCTGAGCTGCTGGAAGCCGATGCAGATGCGGA
ATACGCGGCAGTGATCGACATCGATCTGGCGGATATTAAAGAGCCAATCCTGTGTGCTCC
GAACGACCCGGATGACGCGCGTCCGCTGTCTGCGGTACAGGGTGAGAAGATCGACGAAGT
GTTTATCGGTTCCTGCATGACCAACATCGGTCACTTCCGTGCTGCGGGTAAACTGCTGGA
TGCGCATAAAGGTCAGTTGCCGACCCGCCTGTGGGTGGCACCGCCAACCCGTATGGACGC
CGCACAGTTGACCGAAGAAGGCTACTACAGCGTCTTCGGTAAGAGTGGTGCGCGTATCGA
GATCCCTGGCTGTTCCCTGTGTATGGGTAACCAGGCGCGTGTGGCGGACGGTGCAACGGT
GGTTTCCACCTCTACCCGTAACTTCCCGAACCGTCTGGGTACTGGCGCGAATGTCTTCCT
GGCTTCTGCGGAACTGGCGGCTGTTGCGGCGCTGATTGGCAAACTGCCGACGCCGGAAGA
GTACCAGACCTACGTGGCGCAGGTAGATAAAACAGCCGTTGATACTTACCGTTATCTGAA
CTTCAACCAGCTTTCTCAGTACACCGAGAAAGCCGATGGGGTGATTTTCCAGACTGCGGT
TTAAAAAGTCAGCGCACGCGCTGCGCATAAACGACACAATGCCCGGTGAATGAGATTCCC
GGGCATTTTTTTATTTCTAAACCATCGCCGTTCCGCTGTTTTTCTCCGGTAAGGCTGCGA
TAATTACATCAATGGCGCAATGCGATTTCGGTGCATTGCCGGGAGCAGAGGAACACACTA
TGGATTACGAATTTCTGCGCGATATTACCGGAGTGGTAAAGGTGCGTATGTCCATGGGGC
ATGAAGTGGTCGGGCACTGGTTTAATGAAGAGGTGAAAGAAAACCTGGCCTTGCTTGATG
AAGTGGAACAAGCAGCGCACGCACTGAAAGGTAGCGAACGGTCCTGGCAACGGGCAGGGC
ATGAATACACCCTGTGGATGGACGGTGAAGAGGTGATGGTTCGCGCCAATCAACTGGAAT
TCGCTGGCGATGAAATGGAAGAGGGGATGAACTACTACGACGAAGAAAGCCTGTCGCTAT
GCGGCGTTGAGGATTTTCTGCAGGTCGTGGCGGCTTACCGCAATTTCGTGCAGCAGAAGT
AAATAAATCTGGCGGAGCCTGGGAGCTCCGCCAGAGCCGTTAAACAGCTGGCATATTGCG
CCCGTAATAAATCTCGCGCATTTCTTTCCACAGCGCAGCGGTAATTTCCTGGCGCTCGCT
GTCGGTTAAGTCTTCCGGTTTGGTGTGGAACATGTAGTGCTTAAGGTCGAACTCTTTAAG
CAACATCTTGGTATGGAAGATATTTTCCTGATAGACGTTCACATCCACCATGTCATACAG
CGCCTTCATATCGTCAGACATAAAGTTCTGAATCGAATTAATCTCATGGTCGATAAAGTG
CTTCATACCGTTAATGTCGCGGGTAAAACCGCGCACGCGATAATCAATGGTTACGATATC
GGACTCAAGCTGGTGGATCAGGTAATTCAGCGCCTTCAGCGGAGAAATCACGCCGCAGGT
AGAGACTTCAATATCGGCGCGGAAGGTACATAAACCGCCTTCAGGATGACTTTCCGGGTA
GGTATGTACGCAAATATGACTTTTATCAAGATGGGCAACGACCGTTTCTGGCAGTGGGCC
GGGGTGTTCTGTTTTGTCGATGAGTTTCGGGTCAACCGGTTCTTCACTCACCAGAATAGT
GACGCTGGCACCCTGTGGTTCGTAATCCTGGCGGGCGATGTTAAGAATATTAGCCCCGAT
AATGGAACAGGTTTCTGACAGGATTTCGGTCAGACGGTTGGCATTATAGAGTTCATCGAT
ATAAGCAATATAACCGTCGCGCTCTTCGGCAGTTTTGGCGTAGCAGATATCGTAAATACA
AAAACTCAGACTTTTGGTCAGATTATTAAAGCCATGCAGTTTCAGTTTTTTCAATTTCTT
ATCTTCTCCTTAGGACGGCTGTGAAGCCAGTGCGTCTTGCAGATACTGAGGTAAGGCAAA
AGCTGCCGTATGGATTGCCGGATTGTAATAACGGCATTTCAGGCCAGAGGCGAGAAAACG
CGCCTGAATAATTTCGGTTGAGAGATGGCGTAAGGCGTCGTTATCTGTCGCCCATGCAAA
AGTCATGATACCGCCGTAATAGGTCGGGATCGCCGCCTGATAAAAGCCAACGTCGCTGAA
GTAATGGCTGAGTTTGCGATGGCTGTCGATGGCTTCTTCCTGCTGTAAAAAGCAGACGCC
GTTTTGTGCGACGAAGATACCGCCAGGATTCAGGCAACGTTTGCAGCCTTCATAAAATGC
CGAAGTGAAAAGGCTTTCGCCGGGACCGATAGGATCGGTGCAGTCGGAGATAATGACATC
AAAGGTCTGGCTGGTTTGATTAACGAAATTGACGCCATCGTCGATCACCAGCTTAAAGCG
CGGATCGTCGTAGCTACCGGCGTTATGGTTGGGTAGATACTGACGGCAGAACGATACGAC
ACCCGCATCGATTTCCACCATCGTGATTGACTCAACGTTTTTATGTCGGGTTACTTCACG
CAGCATGGCACCGTCGCCGCCGCCGATAATCAGCACATGTTTCGCGTGACCATGGGCCAG
TAGCGGAACATGGGTCATCATCTCATGATAGATAAACTCGTCGCGCTCGGTGGTTTGTAC
TACGCCATCCAGCGCCATTACGCGACCAAATGCAGCGTTCTCAAAAATGATCAGATCCTG
GTGATCGGTCTTTTCATGATACAGAACGTTATCTACCGCAAAGTACTGCCCAAACTGGTC
GTGTAGCGTTTCATGCCACTGTTTTTTTTCGGCCATGGGTTGATACCTCCTTTGTTAACA
CCCGTAAAAAAAGGGCGCAACATAATAGCTAACATTGACCGCGGATGCACGGTCAATATT
TCTACAAAAAGGTATCAGGGATTATTTGACGTAGGCAAGCAGGCTTAAGGAATCGCGGGC
CAGGGCTTTGCATTTTTTAGCGACGGGAATGCCAATGCCGCTGAGATCGCGGTAGCTGTC
TTCACCGAGGGCTTTCATGTCGAAGGTGTCGTAATTACTGAGGTCCCACTGGTTTTGCTG
AGCGAAAAAGACCAGTGCGCGACGAATTTGCCCGTTAGGTAAGTTCTGGTAACCACAATC
GTTCTTCAGAAAGACAAAAACTGCCGTTAAATCGGCCATATCTTCGGCTTCAGACTCGCT
GAGCGCGTAACTGTTTGCGCAGACGGCCATCAGGCTGCCGAATAACACTGTTCTGAAAAA
CGTCTTCATTGCTTCTACCAGGGGCTTAAAGAAGATAAACGTTAGCACACTGCGAGCGAG
GCGACGACCATTATTGTCGATTAAATTGTGTCTGCGGCTTGACCTTCCCGTAAGGGGAAG
GACTATGCTCAACGTTTGATTTTGTTTCGCCTGCTTAAGAATAAGGAAATAACTATGCAA
CGTCGTGATTTCTTAAAATATTCCGTCGCGCTGGGTGTGGCTTCGGCTTTGCCGCTGTGG
AGCCGCGCAGTATTTGCGGCAGAACGCCCAACGTTACCGATCCCTGATTTGCTCACGACC
GATGCCCGTAATCGCATTCAGTTAACTATTGGCGCAGGCCAGTCCACCTTTGGCGGGAAA
ACTGCAACTACCTGGGGCTATAACGGCAATCTGCTGGGGCCGGCGGTGAAATTACAGCGC
GGCAAAGCGGTAACGGTTGATATCTACAACCAACTGACGGAAGAGACAACGTTGCACTGG
CACGGGCTGGAAGTACCGGGTGAAGTCGACGGCGGCCCGCAGGGAATTATTCCGCCAGGT
GGCAAGCGCTCGGTGACGTTGAACGTTGATCAACCTGCCGCTACCTGCTGGTTCCATCCG
CATCAGCACGGCAAAACCGGGCGACAGGTGGCGATGGGGCTGGCTGGGCTGGTGGTGATT
GAAGATGACGAGATCCTGAAATTAATGCTGCCAAAACAGTGGGGTATCGATGATGTTCCG
GTGATCGTTCAGGATAAGAAATTTAGCGCCGACGGGCAGATTGATTATCAACTGGATGTG
ATGACCGCCGCCGTGGGCTGGTTTGGCGATACGTTGCTGACCAACGGTGCAATCTACCCG
CAACACGCTGCCCCGCGTGGTTGGCTGCGCCTGCGTTTGCTCAATGGCTGTAATGCCCGT
TCGCTCAATTTCGCCACCAGCGACAATCGCCCGCTGTATGTGATTGCCAGCGACGGTGGT
CTGCTACCTGAACCAGTGAAGGTGAGCGAACTGCCGGTGCTGATGGGCGAGCGTTTTGAA
GTGCTGGTGGAGGTTAACGATAACAAACCCTTTGACCTGGTGACGCTGCCGGTCAGCCAG
ATGGGGATGGCGATTGCGCCGTTTGATAAGCCTCATCCGGTAATGCGGATTCAGCCGATT
GCTATTAGTGCCTCCGGTGCTTTGCCAGACACATTAAGTAGCCTGCCTGCGTTACCTTCG
CTGGAAGGGCTGACGGTACGCAAGCTGCAACTCTCTATGGACCCGATGCTCGATATGATG
GGGATGCAGATGCTAATGGAGAAATATGGCGATCAGGCGATGGCCGGGATGGATCACAGC
CAGATGATGGGCCATATGGGGCACGGCAATATGAATCATATGAACCACGGCGGGAAGTTC
GATTTCCACCATGCCAACAAAATCAACGGTCAGGCGTTTGATATGAACAAGCCGATGTTT
GCGGCGGCGAAAGGGCAATACGAACGTTGGGTTATCTCTGGCGTGGGCGACATGATGCTG
CATCCGTTCCATATCCACGGCACGCAGTTCCGTATCTTGTCAGAAAATGGCAAACCGCCA
GCGGCTCATCGCGCGGGCTGGAAAGATACCGTTAAGGTAGAAGGTAATGTCAGCGAAGTG
CTGGTGAAGTTTAATCACGATGCACCGAAAGAACATGCTTATATGGCGCACTGCCATCTG
CTGGAGCATGAAGATACGGGGATGATGTTAGGGTTTACGGTATAAAAAGACCGTATTCGG
AAATATGCCCGGATCTCTCCGGGCATTAAACTGATGACAAACGCAAATCTGCCTGATGCG
CTACGCTTATCAGGCCTACGCTAGCTGTGCAATCCATTGATTTTGCACAATTTTGTAGGC
TGGATAAGGCGTTCACGCCGCATCCGGCATGAACAACGCGCACGTTGTCAGCAATCTGAG
CAAGTCTTACTTCACATCATCCGGCAGCGCATAAGCCACAATATAGTCGCCCATCTTCGT
ACCAAATGAACCGTGACCGCCTGCGGAGATCACCACATACTGCTTACCATTCACTTCATA
GGTCATTGGCGTAGCCTGACCACCCGCTGGTAAACGACCCTGCCACAGTTTTTCACCGTT
GCTCATGTTGTAAGCGCGCAGGTAGTTATCTGCCGTAGCGGCGATAAACAGCACGTTACC
CGCCGTGGAGATTGGCCCGCCCAGCATCGGCATACCCATATTGAACGGCACCGGAACCGG
CATCGGGAACGGCATACTGTCCTGCGGCGTACCAATACGTTTCTTCCACACCACTTCATT
AGTTTTCAGATCCAGCGCCGAGATATAACCCCATGCTGGCTGTTTACATGGCAGACCAAA
TGGTGAGAGGAACGGGTTGAGCGTGACACCATACGGTACACCGTACTGTGGCTGAATGCC
GGATTCCGTACCCGTGCCTTTGGCATCTTTCGGCTGCTCCATCGGGTTGCCAGGACCACG
CGGGATCAGTTTCGAAACAAACGGCAGTGCCATTGGGTTGGCAATCGCCACTTCACGATT
TGGATCAACGGAAATCCCGCCCCATTCGAACATCCCCAGGTTACCCGGGAAGACCAGCGT
ACCCTGTTCAGATGGCGGGGTGAAAATGCCTTCATAGCGCATCTGGTGGAACATCACGCG
GCACACCAGTTGGTCAAACATGGTGGCTCCCCACATATCCGCACCGCTCAAATCTTTCGT
CGGACGGAAGCTCAGTTCAGAAAACGGTTGAGTTGGGGTTACGTAATCGCCTTTCGCTGC
ACCTTGGGGAACCGGTTTTTCCGGTGCCGGAACCACCAGTTCGCCATTACGACGATCGAG
CACAAAAATGTTGCCGGTTTTCGCCGGAGCGTAAATAACTGGCACTTTCTGACCATTAAC
GGTGATGTCCGCCAGCGTCGGCTGTGCCGGAAGATCCATGTCCCACAGGTCGTGGTGAAC
GGTCTGGTAGCTCCACGCCAGTTTCCCGGTAGTGGCATTCAGCGCCAGAATCGAGCTGGC
ATAACGTTCCTGTTCCGGTGTGCGGTTACCGCCCCAGATATCCGGCGTGGTCACGCCCAT
CGGCAGATAGACCAGATCCAGCTTCGCGTCATAGGCCGCTGGTGCCCAGGAGTTTGGCGA
GTTAAAGGTAAAGGTGTGTTCGTCAGACGGGATTGCGTTCGGATCTTTCGCGCCGGGATC
AAAAGCCCACAGCAGCTCCCCGGTGTTGACATCAAAACCACGGATCACGCCAGACGTTTC
GCGGGTTGAGAAGTTATCGGTAACTGAACCGGCCATCACGATGGTTTTATCGGTGATAAT
CGGTGGCGAAGTCGGTTCATACAGACCCGGTTTGGTGTCTGGCATATTGCTTTGCAGATT
GAGCACGCCTTTATTGGCGAAGGTTTCGCACAGTTTGCCGTTTTCAGCGTTAATCGCAAT
CAGTCGACCATCATTGACCGGAAGAATGATACGACGCGGGCAATCCGCCATCACTTCCGG
CGAAGCGGTTTCTGCTTTGGCTTCATGATAAGAGACACCACGGCAGGTTACGTGCTGGAA
AGACTCGTTGGTTTTCAGCTCAGGATCGTAATGCCATTTCTCTTTGCCGCTGGCGGCATC
AAGCGCAAACAGGCGCTGGTGAGCGGTACACAGGTAAAGGGTGTCGCCCACTTTAATCGG
CGTCACTTCATTGGTGATTTCACCCGGATCGTTCGGCTGCTTCACATCGCCAGTACGGAA
CACCCAGGCTTCTTTCAGATTATGGACGTTATCGGCGTTAATTTGTTTCAGCGGCGAAAA
GCGTTGACCTTCCTGATTACGACCATAGGCAGGCCAGTCCTGATCGGCTACGGGGGAGAT
AGCTTCAGCAGGTGTGGCATCGGCGCTTAAGGTGCCGTTGATCTCCTGCGGATCGTTAAA
TCCGGCCCAGGTCAGGATACCACCGCTAATCAGCAGTGCGACCACCAGTGCGGCAACTGC
GCCGCTGGCAGGAATGACCAGGCGACGCCAGACAAACGGCAGGATCAGCCAGATGCCGAA
GAAGACCAGAATGTCGCTGCGCGGAGTCAGCGCCCAGAAGTCGAAACCAACTTCCCAGAC
GCCCCAAATCATGGTGCCGAGCAGCAGGGCTGCGTATAGCCAAAGCGCGGCGCGTTTACT
GCGCCACAGCATCCAGGCGACGCCGAGCATCACAAGGCCAGCGATAGGGTAGTACCAGGA
GCCGCCAATCGCGACCAGCCAGCCTCCGCCAATGAGTAGATACAGCCCGCAAAGCGCTGC
AAAAAGGGCTGTTAGCGTGACGAGTAATCGTCGCGAGCCTGTATTGTTAATTGCCATAAA
GAGACACCATTTCAATTCATTAATATTTTAGTAGCAATTAATTATAGGTTTTAACATGTG
TGATCGTCATCACAATTCGAGCTTTATTAACAGATTCCGCGAATGAATAGTTTTACTGGT
ATACTGCGTGTCTTGCGCTTTGTTGCGGTGCCAAAACCTGCCCGTGCGAAGTGATTTGTT
TTTAAATCATATGGTTAGAGATATGAAACATACTGTAGAAGTAATGATCCCCGAAGCGGA
GATTAAAGCGCGTATCGCCGAACTGGGTCGTCAGATTACTGAGCGTTACAAAGACAGCGG
CAGCGATATGGTGCTGGTGGGTCTGCTGCGTGGCTCATTTATGTTTATGGCGGACCTGTG
CCGTGAAGTTCAGGTATCTCATGAAGTCGACTTTATGACCGCCTCCAGCTACGGTAGCGG
CATGTCCACCACCCGTGATGTGAAAATCCTCAAAGATCTGGATGAAGATATCCGTGGCAA
GGACGTGCTGATTGTTGAAGATATCATCGACTCGGGGAATACACTGTCGAAAGTGCGTGA
GATCTTAAGCCTGCGCGAACCGAAGTCGCTGGCGATTTGTACGCTGCTGGATAAACCGTC
CCGTCGTGAAGTGAACGTCCCGGTAGAATTTATCGGTTTCTCGATCCCGGATGAGTTTGT
GGTGGGTTACGGCATTGATTACGCACAGCGTTACCGTCATCTGCCGTATATCGGCAAAGT
GATTCTGCTGGACGAGTAAGTGTGAAGTTGCCGGATGTGTTGCATCCGGCATGGCATTTT
TATTTGTGGTTGGCGTGTTTCAGCTTGAGGTTGGAAATCCCGTGACGGTAACGTTGCTCA
AGGGTTTCGCGGTTGGTGGCGGTAACATCCAGATCACGCAGCAAGCCGTCGTGAATGCCG
TAGGCCCAGCCGTGAATGGTAACTTTCTGCCCGCGTTTCCACGCTGATTGCATAATGGTG
GAGTGGCCCAGGTTATACACCTGTTCCATGACGTTCAGTTCACACAAGGTATCCAGACGG
CGCTCTTGCGGCATTTCGCCGAGCAATGAGCTATGTTTGAACCAGATATCGCGGATATGC
AGCAGCCAGTTGTTGATAAGCCCCAGTTCCGGGTTTTCAACTGCGGCTTGTACGCCGCCG
CAACCGTAGTGGCCACAGATAATAATGTGTTCAACTTCGAGTACATCCACTGCATACTGA
ACCACGGAAAGGCAGTTCAGGTCAGTGTGAATGACCAGGTTAGCAACATTACGGTGAACA
AAGAGTTCGCCCGGCTCAAGACCGGTTAAACGTTCTGCAGGAACGCGACTGTCGGAACAT
CCAATCCATAGAAAGCGCGGTTTTTGCGCTTGTGCCAGTTTCTCAAAAAACCCGGGATCC
TCTTCCACCAGCATTTTTGACCATAGTGCATTGTTGCTGATGAGTGTATCTATGTCTTTC
ATGGAGGTTAACGACCTGTAACCAAATAATTACGTTTGGCTAATATAGGGCAACTCCGGG
ACGATTTAAACCACAGATAAAGTGTAAGAACGTAAGGTAAGTAAAAATTTATGACCATTG
CACTGGAACTTCAACAGCTTAAAAAAACCTATCCAGGCGGCGTTCAGGCGCTTCGTGGGA
TAGATTTGCAGGTCGAAGCGGGTGATTTTTATGCGCTTCTCGGGCCGAACGGGGCCGGGA
AATCGACCACTATCGGTATTATCAGCTCTCTGGTAAATAAAACCTCCGGGCGGGTCAGCG
TATTTGGTTACGATCTCGAGAAGGATGTCGTGAACGCTAAACGTCAGTTGGGACTGGTGC
CGCAGGAATTTAACTTCAACCCGTTTGAAACCGTGCAGCAAATTGTGGTGAATCAGGCAG
GGTACTACGGCGTGGAGCGCAAAGAAGCGTACATCCGCAGCGAAAAGTATCTTAAACAAC
TCGATCTATGGGGAAAACGCAACGAACGTGCGCGTATGTTATCTGGCGGGATGAAGCGCC
GTTTAATGATTGCCCGTGCGTTAATGCATGAACCTAAACTACTGATTCTCGACGAACCGA
CCGCAGGCGTGGATATTGAACTTCGCCGCTCAATGTGGGGCTTTTTGAAGGATTTAAACG
ACAAAGGCACCACCATCATTCTCACCACACACTACCTGGAAGAAGCAGAAATGCTGTGCC
GCAATATCGGCATTATTCAACACGGTGAGCTGGTGGAAAATACCTCGATGAAGGCGCTGC
TGGCGAAGCTGAAATCGGAAACCTTTATTCTCGATCTCGCACCGAAAAGCCCGTTACCGA
AGCTCGATGGCTATCAGTATCGACTGGTCGATACCGCGACGCTGGAAGTTGAAGTGCTGC
GTGAGCAGGGGATCAACAGCGTATTTACGCAGTTAAGTGAGCAGGGCATTCAGGTATTAA
GTATGCGTAACAAAGCTAACCGTCTGGAAGAGCTGTTTGTTTCACTGGTTAATGAAAAAC
AAGGAGATCGCGCATGATGCATCTTTACTGGGTGGCGCTAAAAAGCATCTGGGCGAAAGA
GATCCATCGCTTTATGCGTATCTGGGTGCAGACGCTGGTGCCGCCAGTCATCACCATGAC
CCTTTACTTTATTATCTTCGGTAACCTGATTGGTTCGCGTATTGGCGATATGCATGGCTT
CAGCTATATGCAGTTCATCGTACCGGGGCTGATCATGATGTCGGTGATCACCAATGCCTA
CGCCAACGTTGCGTCATCATTTTTTGGTGCCAAGTTCCAGCGTAATATTGAAGAGCTGCT
GGTAGCGCCGGTTCCGACTCACGTCATTATTGCCGGATATGTCGGCGGTGGCGTGGCGCG
TGGTCTGTTTGTTGGCATTCTGGTGACGGCAATTTCACTGTTTTTTGTGCCATTTCAGGT
GCATTCGTGGGTATTCGTTGCCTTAACGCTGGTGCTCACGGCGGTGTTGTTCTCCCTTGC
GGGTTTGCTGAACGGTGTGTTTGCCAAAACGTTCGATGACATCAGCCTGGTGCCAACCTT
TGTGTTAACGCCACTCACGTATTTGGGCGGGGTCTTTTACTCACTGACTTTGTTGCCGCC
GTTCTGGCAAGGGCTGTCGCACCTGAACCCAATCGTTTATATGATCAGTGGTTTCCGCTA
CGGCTTCCTCGGTATCAATGATGTTCCGCTGGTCACTACCTTTGGCGTACTGGTGGTCTT
TATTGTGGCGTTTTATTTGATCTGTTGGTCGCTGATCCAACGTGGACGTGGTTTGCGTAG
CTAAGGCTATTTCCTCTCCTCTGGATTTGGGGGAGAGGAGTTTTGACGGCTATCACCCTT
TATCAACAATGGTCAGGGTAGACTGATTTTCGGCTAAGGAGGAAGGCGATGTTAGGTTGG
GTAATTACCTGTCACGATGACCGGGCGCAAGAGATACTGGATGCGCTGGAGAAAAAACAT
GGGGCACTTCTTCAGTGCCGGGCCGTGAATTTCTGGCGCGGATTAAGCTCTAATATGCTC
AGCCGCATGATGTGCGATGCTCTGCATGAAGCGGACTCTGGTGAGGGTGTCATCTTCTTA
ACCGATATAGCCGGAGCGCCACCGTATCGCGTGGCTTCATTATTAAGCCACAAACACTCC
CGTTGCGAAGTGATTTCTGGTGTCACGTTACCGTTAATTGAACAGATGATGGCTTGCCGT
GAAACCATGACCAGTTCAGAGTTTCGCGAGCGTATTGTCGAACTGGGTGCGCCGGAGGTG
AGTAGTCTTTGGCACCAACAACAAAAAAATCCGCCTTTCGTCCTCAAACATAATTTGTAT
GAGTATTAACCCGCGATTCTGATGGCGCTTTTGCTACAATAAAAGCGTTGTTTCACCCTC
GGTTATTTTTTCATGTACAAACAAGCTGTTATTCTCCTGCTGATGCTGTTTACCGCAAGT
GTCAGTGCCGCGTTACCTGCCCGTTATATGCAAACCATCGAAAATGCTGCGGTCTGGGCG
CAAATTGGTGACAAGATGGTGACCGTGGGGAATATTCGGGCCGGACAAATCATTGCCGTG
GAGCCCACTGCCGCAAGTTATTACGCATTTAATTTTGGCTTTGGCAAAGGTTTTATCGAT
AAAGGTCATCTCGAGCCGGTTCAGGGGCGACAAAAAGTTGAAGACGGTTTGGGCGACCTC
AACAAGCCGCTGAGTAATCAGAACTTAGTTACCTGGAAAGATACGCCGGTCTATAACGCG
CCGAGTGCGGGAAGTGCGCCATTTGGGGTACTGGCGGACAATTTGCGCTACCCGATTTTG
CATAAACTGAAAGACAGGTTAAATCAAACCTGGTATCAGATCCGTATTGGCGATCGACTG
GCCTATATCAGCGCACTGGATGCCCAACCCGATAATGGCCTGTCGGTGCTAACCTATCAC
CATATTCTGCGCGACGAAGAAAACACCCGTTTTCGCCATACTTCGACGACCACATCGGTA
CGCGCTTTCAATAACCAGATGGCCTGGCTGCGTGACAGGGGATACGCGACACTGAGCATG
GTGCAGCTGGAAGGCTACGTGAAGAATAAGATCAATCTCCCTGCGCGAGCGGTGGTGATT
ACCTTTGATGATGGCCTCAAGTCGGTGAGCCGCTATGCGTATCCTGTGTTGAAACAATAT
GGCATGAAGGCGACGGCGTTTATTGTTACCTCACGCATCAAACGTCACCCGCAGAAGTGG
AACCCAAAATCGCTGCAATTTATGAGCGTTTCTGAGCTTAACGAAATTCGCGATGTATTT
GATTTCCAGTCACATACCCATTTTTTGCATCGGGTAGATGGTTATCGCCGACCCATATTA
CTGAGCCGTAGTGAGCACAATATTCTGTTTGATTTTGCACGTTCACGCCGCGCTCTGGCG
CAATTTAATCCGCATGTCTGGTATCTTTCGTATCCGTTTGGCGGATTTAATGACAACGCC
GTGAAGGCAGCAAACGATGCCGGATTTCACCTGGCGGTGACAACCATGAAAGGCAAAGTA
AAACCGGGGGATAATCCGTTGTTACTAAAACGACTTTATATCTTAAGAACGGATTCGCTG
GAGACGATGTCGCGGCTGGTGAGTAACCAGCCGCAGGGATAACAATCAAGCAACCTGTAC
CGGAATCGCTTTCGCGGTACGTTTCATTTCATTGTCGCCTTCAAAATAGGCGACGTTGGG
TCGCCAGGTGCGAGCTTCTTCATCTGGCATGGTAACGAAGCTGGCGATGATGACAATATC
GCCGACACTGGCGCAGTGGGCCGCCGCACCGTTAACAGAAATAATTCTCGAACCGCGTTC
TGCCGCGATGGCATAAGTGGAGAAACGCTTGCCGTTGGTGACATTCCAGATATCAATGGC
TTCGTTTTCGAGAATACCGGCTGCGTCAAGAAAATCCTGGTCAATGGCGCAAGAACCTTC
ATAGTGCAGGTCCGCATGAGTCACTTTCACGCGGTGGAGTTTGCCCTGCAGCATCGTGCG
AATCATAACTTCTACCTTTCTACCCTGTCGTTAACGAAGCAGGCGATGCCTGCTTTGAGG
AAATTCTCACGCAGTATTGCCCGATTTTTGTTTAGTGTCTACTCATCTGACGGCATTTGC
GTCAGCAGTTTGCGTACCGCGCCGAAGCGTGCCATGTATCGCCTGTAACGAATTGATATT
TCTCTGAACGCTGCTCGGTAAACAATAAAGAGGTGGCTGACGATAGCGCGCCTTGACTGG
ATACTGCCTTCACGCAAAGCCACACGGAAGACAGGGAAGATGGATGCACCGAGTACCACA
CCGCATGACGCGGTATTTAAACAATTTTTAATGCATGCGGAGACGGCTCGCGACTTTCTG
GAGATACATTTGCCAGTGGAATTACGCGAACTTTGTGACCTCAACACGCTTCATTTAGAG
TCGGGGAGTTTCATTGAAGAGAGCCTGAAAGGACACAGCACGGACGTGCTCTATTCCGTG
CAAATGCAGGGCAATCCCGGTTATCTGCATGTTGTGATTGAACACCAAAGCAAGCCGGAT
AAGAAAATGGCCTTTCGCATGATGCGTTATTCTATAGCCGCCATGCACCGGCATCTGGAG
GCTGACCACGATAAGCTGCCGCTGGTGGTGCCGATACTGTTTTATCAGGGCGAGGCCACA
CCTTATCCGCTATCAATGTGCTGGTTTGATATGTTTTACTCGCCGGAGCTGGCGCGACGC
GTCTATAACAGTCCTTTCCCGCTGGTGGATATCACCATCACACCGGATGACGAAATCATG
CAACATCGGCGGATTGCGATTCTCGAACTACTGCAAAAACATATTCGCCAGCGCGACTTA
ATGTTATTGCTTGAGCAACTGGTCACGCTGATCGACGAAGGGTACACTAGCGGAAGTCAG
TTAGTTGCCATGCAAAACTATATGCTGCAACGCGGTCATACTGAACAAGCGGATTTGTTT
TACGGTGTGTTGAGAGACAGGGAAACGGGAGGGGAGTCTATGATGACGCTGGCGCAGTGG
TTTGAAGAGAAAGGGATTGAGAAGGGGATTCAGCAGGGAAGACAGGAAGTAAGTCAGGAA
TTCGCCCAGCGTCTTCTGAGTAAAGGAATGTCTCGGGAAGACGTTGCAGAGATGGCAAAT
TTACCTCTTGCTGAGATTGATAAGGTAATTAACCTTATTTAAGTTACCTGTGTTATGACA
GATGACGTGGGGTAAATTAATAACTGGCGCCATCAGCCGTAGCGCCAGTTAAGTATTACG
CCAGCTCGACCATTTTGTTGTCGATCAGGCGAGCATCGCCAAGCCAGGCGGCTACCAGAA
TTACTGCCCGTTTGCTGGTTTCAGAAACTTCCAGCAATGTGTCGGCATCGCGAATCTGAA
TATCATCGGCGCGGAAGCCTTTTTCATTCAGTTCTTGCCCCGCAATGGTAATAATTTCAT
CGAGATCCCGTTCCCCAGCCTGCAATTTGTCAGCAATCGAACTTAAAACTTTGTACAGAC
CAGGCGCAATTTTGCGTTGTTCCGCCGTCAGATAACCGTTACGGGAACTTAGCGCCAGAC
CGTCTTTGGCGCGCATAATTGGCACACCGACAATCTCAATATCGAAGCCCATATCGGCAA
CCATTTTGCGGATCAGCGCCAGTTGCTGAAAATCTTTTTCACCGAAGCAGGCGATGTCCG
GCTGGACCAGGTTGAACAGCTTGCTGACAATAGTCGAAACGCCGCGAAAATGTCCCGGAC
GGCTGGCACCTTCCAGCATGGTCGAAAGGCCAGGAACGTCAACGTAAGTGTGGGTTTCAG
TACCGTTCGGGTAGATCTCTTTTACCGAAGGGGCGAAAACTAAATCCACTTTACGTTTGT
TTAGCTTCTCGCAGTCCTCCTGCAAGGTCCGTGGATAACGAGCCAGATCTTCCGGGCGGT
CGAACTGCATCGGGTTAACGAAAATACTGACGACGACCACATCGGCGCGGGCTTTGGCTT
CGTCGACCAGCTTCATATGGCCATCGTGCAGGTTACCCATGGTAGGCACCAGCGCCACGC
GCTTGCCTTCCATACGCAGGCGGCGAATTTGCTGACGCAGCAGCGGCAGGGTTTCGATAA
TTAACACAACGTGACTCCTTAATGGAAACTGTGTTCTTCGCCCGGATAAACGCCGGACTC
CACTTCAGCCATATACTGCCGCACAGCCGCGCGGATGTCGCCCGTTTCGGCGAGGAAATT
TTTAGCGAATTTAGGAATGTGACCGCCGGTAATACCAAAGGCGTCGTGCATCACGAGGAT
CTGCCCGTCAGTGACGTTGCCTGCGCCAATGCCAATAACCGGGATCGCCAGTGCTTCGGT
AATACGTTTTGCCAGTTCAACCGGCACGCATTCCAGCACCAGCAGCTGTGCCCCAGCAGC
TTCTAAGGCTAATGCATCGCTGAGCAGTTGATCGCCCGCTTCATCGCCGCGCCCCTGAAC
TTTGTAGCCACCGAAAATATTCACTGACTGTGGTGTTAAACCTAAGTGACCACATACAGG
AACGGCACGTTCGGTCAGCATTTGTACGGTTTCTACCAGCCACTCACCGCCTTCAATTTT
GACCATGTTAGCACCGGCACGCATAACCGTTGCGGCGTTTTCGAAGGCTTGTTCCGGCGT
GGCATACGCCATAAACGGCAGGTCAGCCAGCAGCAGGCAGTTTGGTGCGCCGCGACGTAC
GGCGGCAGTGTGGTAGGCGATATCGGCAACGGTAACTGGCAGGGTGGAGTCGTGCCCCTG
AACCGTCATGCCCAGCGAATCGCCCACCAGCATGACGTTAAGCCCTTCATCAGCAAAGAG
TTTGGCGAAGCTATAGTCATAAGCGGTGATGGTCGCGAAACGTTTTTTTTCCTGTTTGTA
CTTCTGCAGTAAGGAGATGGTGGTCGGTTTCATAACGTATCCTGATAAATTGATGTTGTG
CTGTCTGGCATTTTATCAGTCACATTGGTGGGGGCAATGATTTATCCGTAGCAGCACTGC
CAGAAGGTGACAGTGCTGCTACGTTATCAGGGATAGGTTACCTGGAAAGTACTGGTGGCT
TTAAATTCGCCGGGTTCGATAGCAATATTCCCGTCTTGCTTTAATGTTGCCTGGAAATGA
AGAGGCTGTGATGTGCCGTTACCTTGATTAGGGTAAACCCCATCGGAGGTGTCATCTTCG
GTTTCATAATCTATATAAACAGAATTCGTATCATTAGGTTTTAATGTCATTAGCGGATTT
TTACTGGTTGCTAAACCTTCAATGAGTACGCCAACGCCTTTGGCGGCAGTGCTTCCAGTA
AGCGTATTACCAAGCAGTTGTGTGTTTTGAGTACCTACTTTTCCAGTGACGAGTTTTGTT
TCAATATTACGCACACGAATACAATTCTGAAGCGAGATATCAAAGGGAACAGGTGAAGCG
CCATTTTTAATTGTCCCAGAGCTATATTCTCCCATTCTAACCGTTGAACCATTGACTGAT
GGCCCGGTAAGTATGGAGGTAAAACATGTTGGTAAGGTTAATTTGACATTATTCAGTGTG
AAATTGACATAAATGTGGTTGCTGTGATCTACAACTTTTGTACCAGGACTGTAGGCCTTA
AACGAATAAAGGTAATTTGATGAACTGGATAACTGGACTTGCTGATTAAGTGTAGGATCG
AAATTAGTATCTGTATAAAATTCAACAGTTATGTTGTGTACTATACCACCAATAGCCCAA
AACTTATCGTAGTCGTCTGCTTTGTTGCAACCCTTAGTTTGTAGATCGCTGTCTGTGACG
GAAAAGAAAAATTCTTGGTTGGAAGGATCTCCGATATAGATTCCTGGCGATTGAATGTCA
GTTATTGTATCGTATGCAGACCAGACCCTTGATATTAACATGGTGTAATACAGACCAGGA
ACAGATGTATTAAATAGTTTATGTCCGCCATAATCTTTACCTGAATAGACCATGGCATTT
TCAATAGTTATTGGACCAGGATTCGCTCTGCCAGATGTATTGCAGTAAAGAATACCACCA
CCGGTACCTGTATCCAGGTATGACCAGTACATTTTTACCCCAGTCGGGCCGAGCTGCGTG
GGTTTATAAAAAACCAAGTTGCTTGCTGTTGATGTGTAATTAAAGGTCATCTGTGCGGCA
GTGGAGGGGCCTCGATAGTTATCAACTCCTGCATTATTTCCCACAATAAAACTTGTATAT
GCACTGACTGTATTACAACAAGAATACAGTGCTAAAAAAAGAATGTACCTGAAGATAGTC
TTCATTTTTACTCCAATGTTTCTTTATTGTTATGGTTTGCGCTGTTTTTGTTTGTTATTC
GTAGTAAATATCCACTAACACATGGCTCATAAGTTGACCAGATGTAACACTCAATGCAGG
ATCGATTTTTTGCATTCGGGTGCTAAATTTCCAGGATGAACCATTCATGTCATCCGACAT
TACTGGATAAACGGAACGAGATCCGCCTGAAGCATTAAGAACATTGAATGTATTCGCCGA
ATCCTGAGTAGAAAATATAACTACTCCTACATTACTTGCTCCTGACGAAATTTCATTAGC
AAATATTTGCCTAGAGCCAGCAGCCATGACACCGCTAAGGGCTCTAAAATCAATATGTAA
CTGATTTAGCACATCGCCAGTTCCCTGTAATGCACAGTCGGATACAGTGATAGTGAACTC
TTTTCCACCTGGTTGATAACTTTCAGGAGTAACATTACCTGAAAAATATCCCACCCCAAC
GACGCCAAGATCAATATTACCCTGGTTACTGATTCCGCTTTTGCAGGTGCTGTTTTTTAC
ATTGGCAACAAGGTCAATATCCTGTCCAGCAATGGCTGGACAGGCGATGCAAAACAGTAA
TGACAGAAACAGAATTATTCTCTTCATCAGCTTACGTTGAGTGGGATGCATATATAGTTC
CTGAATCTGTAAGTCTGTTAGTTATAGGTTACTGTAAATGTGGCTGGTGCAGAAAACTTA
CCCGCAGTGACATTGTTTACGGTTTTATTTTTTTCCACGACCAGGCGTGCACTCATCGGA
TAATAAACGACCGCATTGGCTGCAGTGGAGATTGTTACCTCTTGTGATGCTGGTGTTACA
CAGCTAAATTGTGTTGCACTCCCTGTTGCCGGAGTTACAGTGCTCCAGACTTCAACGGCG
ACAGCACTTGCTTTATCTGCGGCTGTGGAACCATTTGCAAACCCCGCACCGTCATTAGCA
GTTCCCTCGCATGTGGCTCGCTTGGTTAATTTTATTTGCGCTTTTTTATTGGGGATACCC
GCACAGTCTTTGAATTTGAGTTTGAATGTTTTTACTTTGGTCTTGGCATTGATTTCAGAA
ATATATACATCACCAAAATCAACAACAGAAATGTCCTGATCAGAGTCATTTACTAATGTA
GCGGTACAAGTACCCATTTCTACAGTAGTAATAACGGTCAGTCCAATACTGTCTGTTGCC
GCATAAGAGAGTACGCTGAACAATGAGGCAGCCAAAACGACACTGCTGGATAATCCATAA
CGTAAATTTTTAAATGTCATCATAATTATCCTTCTTATTGATAGATGAAATTAAACGTCG
CCAGTGCACGAAAATTCCCCGGTACGCCTTGCCCTGCATCTGTTTCACGTAGCGCAACGG
TCATTTCAAGACCCTTATCGGGCTGCATCTCGTCTGTGCTCCAGCGTATCTTTTCCGCAC
TGTTAGGTTTAAGGAAAGTGGCATCATCAGTAGTCCGTTTTTTGAAACCCATACCGATAT
TACTTGTCGTCGAAGATGAATCACCAGACTGCGGTATAATAAGCTTAGGTGAGCTTGATG
ATGCATTTCCGGTCAGAGTGGTATCAATCCAACTGATGCCACTGCTGCACCCACTGGCAA
CCAGTTTAAAATCAGCCTGAGATTCTGTCGTTTTATTCGCGATCTTATCCAGACCCATCT
TAGGGATTCTCAATGTGTAGTTATTATTGCCATCATTCGTGACGTTATTACCAGTAAGTG
TGATGTTACAGGTTGTCGCTTTGACAGTGGCTGTAAACTCTACATTAATATCCGTTGCAA
ATACTGAGGGTGATAATAATATTCCCATCAGTATCACTATTTTATGTGGCGTTGTTTTTA
TCATTTGACGTCCCTTGTAGTTACTGAATCTGACACCGAATTCCATTCAGAATAATAGAT
TGTGCTATTTTTTCTGCTTCTGGGCTTTGTTGATAATGCGCAAGACAACTTACGGGTTTA
CTTTGTTCGAGCCATTTAATGCTGATATTTCCCTGCTGCTCAATACCACGAACAAATGCT
TGTCCACCCTGTCCAACATTACCAATGACATTGCCTTGCTCATCATAAATATCTGCAGCA
AATGGAATATTTTTACCATCACTTCGTGTGATGTTCATAATGGCTGATTGCCCTTGCACG
GTTTCAAAATCAGCAAAGACGACTGAACCCTGACGCGGTACAGCTACTGCACTGGTACTT
TTTAATTCAACATCGTTCTCAAGATCGTTGATATCCAGCGCGATACGGTTTTCATGATAA
GGAGAAAGAGCGCTGGTGACACCATAACCCCATCGATCGATAGTACTGTTGCCATAATTT
ATTCGCGCTCCTTGAGCACCTGGAGCCTGAACTACCGCCAGTGTATCGGAGTCGCTAAAA
CTATCATTACTGAAAGTCAGTCCACCGCTATGCAATACAAAACCACCGTCGGTGCTGAGA
GAAACTTGACGGCTGTTATCGCTATTTGCAGAAATTGAACCTGCCAGCGTTCCCCATGGT
GACTCATAGCTGGCATAACCCCCAACATAACTCAAATCTTTGCTGGCTTTATTCATCGTA
TAGCCAGTATTCACGCTATAACTGACGCGAGCGTTATCGCTATAGCCACTGCTGCTAACG
TTGAGTTGGTTATTACCCTTAAAGTCACTGCTTATTTGAGTATCAATACTCTGGAAACCT
GAAGTACGTTGTTCAGTGCCAAGTAATTTTTCAATTGGAATGGTGAAACTAAGATAAACG
CTATCGTCAGTGTCGCCGTCTTCATTCCATGAACGCTGGGCACTGACACTGTAGCTGCCC
CAGGATGTACTGTTACTGTAGCCAATAGAGTAATTGCTACGATTTTGTCCGGAAGCCCAG
TAATCGGACCAACTTCCGGAAAGATAAAATGAACCGTAATCTTTTTTCTCAAATTTCAAC
GGTTGGTTAATACTGACCGTAACCTGATTTTTCATGCGTGAGTAATTACGCATGGATTTC
GGTTCAAGATCTTGTTCGGGATGTTTCACTTCATCAATTAGAGTTAGTGCATCATTAAGA
CCAAGGTAATTCTGTGTCGAATAGCGATAGGCCGCGATATTCAGTGAAGTACTTGTTTCT
TCGAATAACTTGTTCCAGGAAACACGATAACTTTGCCCCTGGTATGTTTTATCATCCGGG
ATACGAACATTGGAATGAGTCACATCGAAAGAAAATGCACCAACTGAAGTATTCAGACCA
AGACCTAACAAACCAGCGGTATAGTTATTATCGGTTATCTGAATACCGGTATAACCCGTC
AGATAGTTATTCAGGCCGTAGTAGTAGCTTGCTTGAAATAAATTAGGCTCATCCTGAATA
TCATCTTTTAAGACCTGACCGCCGCTAATATCCCAACGTCCAACGCCAGGGCGTAACATT
TGAACAACGGATGAGAAAGGTTGCGAGAATGTCCGCTTTGAGCCATCGGATTCTTCGATG
GTAACAATAAGATCGCTGCCGTACCCTGACGGACTCAGATCATCAATGACGAAAGCGCCT
GGCGGCACCGTCGTTTCATAAATCTTATAGCCACCTTGCGTAATAGTGACTTTGGCGTTG
GTATTGGCAACGCCATGAATGATAGGCGCAAAGCTGGCTAAAGTCGGAGGCAACATGCGG
CTGTCACTGTATAAACGAATGCCTCGGATACTGACGGAATCAAAGGTTTCGCCCGTCGTA
TAAGACTCACCAAGAATGAGTTGAGAACGCAGCGAGGCGATATCACGCTGAACATACCGA
TTCTTAAAATCATAATTACTGCCAGAATCGGTCATCCAGTTGTAGTTGCCCGAGGCACGC
AGTCGCCATGCACCTAAATTCATCCCACCGTTAAATGCAGCATAAATGCTTTCATTTTTT
CGACCAGGGGTTTCACTATGATATCCGTTGAGGTTGTATGACAACATGGCCGCATTAATG
CCGTTTTCCCATAACGATGGATCAACATAGTTTTGGTAATTTTTCATTACCCAGGCTTGA
GGAACGTCTATATCCAGACGTTGATCGTTAACGTCATAACGAACAGAAGCCTGAGGGATA
ATTTCCGTCAAATTGAGGCAATTGCCGAGCGTTTCATCCCTGGCAAGCAGAACGGCTTTT
TCGTTATTTATATCGGGAGAATTAATATGAAACTGCAATAAATTCTTTAATGTGATACAA
GCCTGGGCGTTCTTTTTTCCTTCAATTGCGACAAATGTAATACTTTGGTTAATGATTGGT
TGGTCGTTTACATAAACACTGACGTCGTAAACACCCGGTATAGCGGGGTTACCTTCACTG
TACCGGCTGAGATCAATATTAGATGCATTCTGCCCCATCAGGAAGGTATGGTCATATTCA
ACGAGTTCAGCACTGAAAGCAGTATTGCAATACAGCAGCGCGCAAAACGTGGCGATACGG
GTCAGATGATGATAATTTTTAGTATATTCTATAGTCACGCTATGCTTCCTGCGGAATTAT
ATCCTTGCCTGATTACAGCCTGGCATTACCTTCAATTGCGCCACCAAAGTCATTAATGGC
GTAAAAATGCACTTTTGCAGAATTCGCTTTGCCATTAAGGCCATTGACTTTCATGACCTC
ATCACTAAATGGTGCAATCATTTTCACATCAATCGGATAGCGTTTACCGCTAGCTTCTAA
ATCACCACTGCTAAAAGAGACGTAGTAAGGGGTTGGATTGGTCACTCGTAATGACGCCTT
ACCTTCTGAACCTGACCAGAACCACTTCAGGGCTAACGGGGCTTCAGAGGGATTTCCCTT
CAATCCATCCGGGCGATAGAAAAGTTTTATACGTGTGCGAAATGCCAGTTGCAGCAGGCT
TTGATTCGCGACCTTTTCTGCATCTGGTTTTGGTGGAACTTCCAGTACGTTAAACCAGAA
CACGCTCTCTCTGTCTTTAGGCAGTGAGGTGCTGGCTGTGTACATTAATTTGATTGTTTG
CCCACGTTTGGCATCAATACGCGATACTGGCGGCGTAGCAGTAAAAGGGACTGTAATACT
GCCAGGCTCAGCGTTGTCATCGCCAGTATCTAACCAACTCTGGACAAGCAACGGGTTATT
CCCTTTATTTTCCAGACGTACGTTGACACTTTTTTGATCGCTTTTATATATTACGCGAGT
ACCCGAAATGACAATGTCCGCAATAGACGATGAACTAAAAGCCATACAGGTTACGAAGCA
TAAAGCTGTTGTATGTTTGGTGTTAAAAAACATAAACCATCCCTGATAGAGTTAATTAAA
ACAGGGAATAATATAAAATAGAAATTATTATTCCCTGTATATTCATTCAATCAATTTAAC
TGGTGAATACTTACTGATAAGTAATGGTGTATGCAGTGTTAGTTTTTACATAACCAGCAG
TTGCTGTTTGGTCTGCGACGGCACGAACGTAAGACGCTTTAAAATCATAAACAGCAGATT
TTGTCGTTGCATCCAGGGCTTTAGTATACACATCGCCAGGGTTGTTAATTTGAACCTGTT
TGATAGTGGAACCATCAATATTGTGTAGAGCGATATTAACGCCGTCAGATGGGTTGTTAA
TAGACATGTCGTTGTTCAAAGTCCCTTTGCTGTTACCAAAGAAAACAGAACCGAAGGTCA
TTTTAGCCGTGCTACCTGGATTCGGATTTGCTTTGCTGCAGTCAACGGTGATGCTGAAAG
GTTTAGCTTTAGCGCCAACGGTGTCATTCAGTACGCCAGCATCGATTTCACCAACGGTTG
CGGTTTGCAGCAGGATCAGACCATCCTTGTTACCGCCGTCAACGCGGGTTTCACAGGTGT
TATCAACAACCAGACCACTGATATTTAACTGACCGCCGTCCATATCAGCAGAAGCAGTAC
CTGCAACCATCGCCAGCATAAGACCAGACAGGGCAAAACCTAATTTTTTAGACATAAAAA
TCCTTTAATAAAATTCCATTAGTCAGACTACATGTTTGAAGAATGACTATTCATGACACA
AATAGGAGAAACAAATGTTAGATATTAATGAGCAATGATATTTGTTACCCAAATTTACAA
CCATTGTTCATTAGGTCGCCTATTGTGCACTTTAGAAGCTTTTGAACAAATTAAATTTAC
TTAATTCAAAATTAAGTAAAAATAAGTTCACAAGTGCAATTGGTTAGGGTATGGAGATGG
GATTGATATTTATTTATAGGAAGTTATATTATTTCCGCAAAGAGATGTTTAAACTAAAAT
CGTAATTAAGGAAAGAGATGAGATATGATTTTCAGAAAATATTTATATTCGCAATATAAA
TAAATTACCATTTGTTTAATTTGTCAAATGCTCTTGTATGTAAGATTTGACGCAACATCT
CCCCATCAGGAAACACCAACTCCGGCGCGATTTCAAACAGCGGCCACAGCATAAATCCAC
GATTCTTCATATCGTAGTGCGGAACGGTCAGGCGTTCAGTATTTATCACTTCATTACCAA
ACAGCATGATGTCGAGATCCAGCGTGCGTGGTCCCCAGCGTTCAGCTTTGCGGACGCGAC
CTTGCTGCAATTCAATACGCTGTGTGTGATTGAGTAGCTCTTCAGGTGCAAGAGAGGTTT
CCAGCGCCACGGCTGCGTTTAAGTAATCGGGTTGATCTTGCGGCCCCAGCGGTGGGGTGC
GGTAAAACGAAGAAACGGTAAGAATGTGGCTTTCAGGGATATCGCCTAATGCTTTCAGGG
CAGCATTGACCTGCTCCAGCGGAGAGGCCAGATTGCTGCCTATGGCAATATACGCCACTG
TCATGCGGTACCCTCACGACGTGGTGCGCGTTTGCGTGGACGACGAGTACGACGACGCGG
TGACGGTTCTTCATCCAGCTCGTTGAGCATCCCTTTTTGGTCTGGTGGCGCGGAAACCTG
GAACTCACCCCACCATTTCACCAGACGCTGCAGTTCAGCGTTACGCTCAACTTCAGCTCG
CAAGGCCAACAGGTCATAAGCCGCACGGAACTTAGGATGCTCCAGCAGTTTCCATGCGCG
TTTACCCTGACGACGGGACATACGCAACTGCAACTGCCAGATATCGCGGGTTAATGTCGT
CAGACGTTTCGGGATTGCCAGTGAACGGCAGGCTTCGTCCAGCACGTCGTTCATCGCCAG
CGCGAAAGCGTCGTGATAGGTCAGGCCGCTTTCCTGGGCGATCTTCTGTGCCGTCTCCAG
CAGTGGGTACCAGAACATGGCGGCAAACAGGAACGCCGGGTTCACGCGCATATCGTTATG
GATACGCGTATCGGTATTCTTCAGCACCTGTTCAATGATCCGCTCCATCGGGCTGTCGCC
ATTTTCCGTGAAGTAGCGGGTAATGGTCGGGAACAGCGGCTGGAACAGATGATATTCACA
CAACAGCTTATAGGTTTCGTAACCGTAGCCCGCTTGTAGCAGTTTAAGCGATTCTTCAAA
CAGGCGTGCCGGTGGGATATCGTTCAGCAGGGTAGCGAGGCGAGGGATCGGTTCTGCGGT
TTCCGGGCTGATGCGCATACCCAATTTGGCGGCAAAACGTACCGCGCGCAGCATACGTAC
CGGATCTTCACGGTAGCGCGTTTCCGGGTTACCAATCAGACGGATAACGCCGTCCTTCAG
ATCCTTCATGCCGCCAACGTAATCACGGACGGTAAAATCCGCTACGCTGTAATACAGGCT
GTTGATAGTGAAATCGCGGCGCTGGGCGTCTTCTTCGATGGAGCCGAAAATGTTGTCGCG
CAGCAACATGCCGTTTTGCCCGCGTTGGGAGGTCGTGCGGTCGCTGACGTTACCTTCGTG
GTGTCCACGGAAGGTCGCAACTTCGATAATCTCCGGGCCAAACATTACATGAGCCAGACG
GAAACGGCGACCCACCAGGCGGCAGTTACGGAACAGTTTGCGCACCTGCTCAGGCGTGGC
GTTAGTGGTTACGTCAAAATCTTTCGGCTTTTTGCCAAGTAACAGGTCGCGCACGCCGCC
GCCAACCAGCCAGGCTTCGTATCCCGCTTTATTGAGCCTGTACATTACCTTCAGGGCATT
TTCACTGATATCTTTGCGGGAAATAGCATGCTGCTCACGCGGGATCACCGTCACCTGTGG
ACGGGCGACTGCCTGTTCAGCCTCGCTTTCCTCGCGGCTTAGCACCTTGCGGCAAAAATT
AGCGACTCGGGTAAAAATAGTACACCTCGGTAGTGTCAAACATCATTCAGGACAAAAAAA
TAGCGGCTAATCATAGCTCAGCATGACGCATTTGAGAATGTTGAATTTACAATTGCCGAC
TCGGGCACGGCGGTAAGCCGCCAGTTTTTGACGGCTGACTGAAGGATTTGCTCGACGCTG
AAATCCTGCCAGTGTGCTTCTGCCTGCTGCCCCAGAAATTGAAGTGCCGCGATTAGTACC
GGGCGTGGATCGCCTTTCGGCAACGCAGGCGCATGATTCTGCTTGGAAAGTTTAGCGCCT
TGTGGATTAAGCGCCAGCGGCAGATGAATGTAATCTGGCACTTTCCAGCCAAAAAGCTGG
TACAGCGAGATTTGCCTTACTGTTGGTTCAATCAGATCAGCCCCACGCACTATTTCTGTA
ACGCCCTGGAAATGATCATCAACCACAACAGCCAGGTTGTAGGCGAACAACCCATCACGG
CGATGAATGATAAAATCTTCCCGTGCCAGTTTTTCGTCGGCGTGAATAATGCCGCGCAGC
TGGTCAGTAAATTGCGTGACCGGATGCTGCTGGCGGATACGCACTGCGGCGTTGTCTGGT
CCATGATGCAACACCCGGCAATGACCGTCGTAAATACCGCCAATGCTTTGAATACGCGCA
CGCGTACAGGTGCAGTAATAACTTAGTCCTTGTTCATGTAACCAGGCGAGTGCTTCACGA
TAGGCGTCGTGACGTTGCGATTGCCAGAGAACATCGCCGTCCCAGTGCAGACCGTAATGT
TCCAGCTGGCGCAGGATAGTTTCTGCGGCACCGGGAACTTCACGAGGCGGGTCGATATCT
TCTATGCGTACCAGCCAGCGACCTTGCCGGGCGCGAGCCTGCAAATAGCTGCCGAGCGCG
GCGATCAGAGAGCCAAAATGAAGCTCGCCGGAAGGAGAGGGGGCGAAGCGGCCAATATAC
TGTGTGTCTGTCATCTCTTTGAACAAAAAATAAGGCGGGAGCATTTCCCGCCTGTGGTAA
ACGTGATGGAACGGCTGTAATTAGCCAGCCATCTGTTTTTCGCGAATTTCAGCCAGCGTT
TTGCAGTCGATGCACAGATCGGCTGTCGGGCGCGCTTCCAGACGGCGAATACCAATTTCA
ACACCGCAGGATTCGCAGTAGCCGAAATCTTCGTCTTCCACTTTTTTCAGCGTCTTCTCG
ATCTTTTTGATCAGCTTACGCTCGCGATCGCGGTTACGCAGTTCGAGGCTGAACTCTTCT
TCCTGGGCTGCACGGTCTACCGGGTCCGGGAAGTTGGCTGCTTCATCCTGCATATGTGTA
ACGGTGCGATCGACTTCATCCCTGAGTTGATTACGCCATGCTTCCAGAATACGACGGAAG
TGCGCCAGCTGGGCTTCATTCATATACTCTTCGCCCGGCTTCTCCTGATATGGTTCCACC
CCAGCGATGGCGAGAATACTCAGGGACGATGTTTTACGGTTTTGCCCTTCTTGCATGTTG
CTTCTCCTTAACACGCACTATCGATCCCCATGTTCGGGGGAAAAATGAGGCCGCTATAAA
TAGCAGATGCTTTTCCGGATAGCAATTATCTAAACGTAACACTTGACAACTGTGTGAGGA
AAAGCGTATTTGCGCACGCGACCAGAATGTAAATTAACCAGTTACTTACTTTACTACAAT
GTAACCGGCAGTGATTTTTTAAGAGCCATGCCTTCAGCAGAAATTTCCGCTTTGTAAGCC
AGAATTTCTACCCCCCTCTGTTGAGCTTCTGACAATAGTTGCGCGTATTTCTCATCGATG
TGGCGCGCGGGTGAAAACCGTGTAATGGCTGAATGCAGCACGGCGAAAAAGATAACCGCA
CGCTGGCCTTCAGCCGCTACGCTCATCAACTCCCGAAGGTGTTTCTGACCTCGTTCAGTG
ACCGCATCGGGAAAATATCCCTGTTCGTTCTCCGCTAACGTAACCGATTTCACTTCAATA
TAGCAGTCTGGACGCGAATCCGCCTGCAACATAAAGTCAATACGGCTGCGTTCTGCGCCG
TATTTTACTTCGCTTTTCAGCGAGCTATAGCCTGACAGTTCTGAAATTGATTCATTAAGG
ATAGCCTCTTTCGTCAACCTGTTAGCCCAAAGCGTGTTGACGCAAATAAATGCGCCGCTC
TGGCTTTGAGTTAATTCCCAGGTGTGTGGGTATTTCCGTTTGGTGTTGTCTGAAGTCGAA
TACCAGACGGTATCGCCAGGCGTTGCACAACCGGTCATCGCACCCGTATTCGGGCAGTGT
AGCGTTAATTCGCGACCATCGGGTGTGATCACATCGGCTAAAAAACGTTTGTAACGCTGA
ATTAGCGTCGCGCGCTGTAGAGGGGGAGAAAATTCCATTGCGACAATCCTTGTTATTGCG
TTAGCGCCCAGCGTTTTAGCGGCGTGTAGCGTGTGCGTCCACGGGCAAACGAGGAGGCGT
AAAGGGTGAACTCCGTCACCGCATACGACCAGTTAAAACCTGGCGGCGGGATTGTCACCG
CCTCGCTGGCGTCGCGCAATAAGGTAATATGTGGATGAAACGGACGATTGCTTTGAAAAC
AACCGCTGCGGGCAGCCTGTGAACGGAGCATATTCGCCAGCTGGATTAAGCCGCGTGGCG
GCTGACGCATCCCTAACCACACCACACGCGAACGCAGCCATTGTCCGGCGTCATCAAGCG
TGAGTGTGAAACCAGGTTGACGAATCCGTCCGGCTAAAAGAGAAAGCGCCTTCTCTTTCT
CGGCGCTCACTTCGCCTAAAAATGCCAGAGTCAGATGCAAATTATCGGCGGCGACCGGAC
GTCCCGCCTCAGGTGGGAAGTGTGTGGCGCGCCAATGGATAATCTGTTCGCGGATTTCTG
CAGGTAAGTCGATAGCAAAGAACAGACGTTGCGGTTCAGACATGTGAGGCACTCGGTTAT
GAATTACCGCGATGCTACAATGTGGCGCGAAGAATGTTAACCCTCTGGAGCGTTTTGTGT
CGTCGTTGCCCGTTGCTGCCGTCTTACCTGAATTACTTACCGCTCTCGATTGTGCGCCGC
AGGTATTATTAAGTGCGCCGACCGGGGCCGGGAAATCAACCTGGCTGCCGCTGCAACTGC
TGGCGCATCCCGGCATTAACGGGAAAATTATCCTGCTGGAGCCGCGTCGTCTGGCGGCGC
GTAACGTCGCGCAACGGCTGGCGGAGCTGCTTAACGAAAAGCCAGGCGATACCGTTGGCT
ACCGGATGCGTGCGCAAAACTGCGTCGGGCCGAATACCCGCCTGGAAGTGGTTACCGAAG
GCGTGCTGACGCGCATGATCCAGCGTGACCCGGAACTGAGCGGTGTTGGACTGGTGATCC
TTGATGAATTTCATGAGCGCAGCTTGCAGGCGGATTTGGCGTTGGCGCTGTTACTCGATG
TGCAACAAGGTCTGCGTGATGACCTTAAACTGCTGATTATGTCGGCTACCCTGGACAACG
ACCGCTTGCAGCAAATGCTGCCAGAAGCGCCTGTCGTCATCTCAGAAGGGCGCTCGTTTC
CGGTTGAACGCCGTTATTTACCGCTGCCCGCGCATCAGCGTTTTGACGATGCCGTTGCGG
TAGCCACCGCTGAAATGCTGCGTCAGGAAAGCGGATCATTACTGTTATTTTTACCTGGCG
TCGGAGAAATTCAGCGTGTGCAGGAACAACTGGCTTCGCGCATCGGCAGTGATGTATTGC
TCTGCCCGCTGTATGGCGCGTTGTCGCTGAACGATCAGCGAAAAGCGATCCTCCCGGCAC
CGCAAGGGATGCGCAAAGTGGTGCTGGCGACCAATATTGCTGAAACCAGTTTAACCATTG
AAGGTATTCGTCTGGTGGTGGATTGTGCCCAGGAGCGTGTGGCGCGTTTTGATCCGCGCA
CGGGGCTTACGCGACTGATTACTCAACGCGTTAGCCAGGCATCCATGACGCAGCGTGCCG
GGCGCGCCGGGCGTCTGGAGCCGGGTATCAGCCTGCATTTAATCGCCAAAGAACAAGCAG
AACGCGCCGCGGCGCAAAGTGAACCGGAGATCTTACAAAGCGATCTTTCCGGTTTGCTGA
TGGAATTACTGCAATGGGGATGCAGCGATCCGGCGCAGATGAGCTGGCTGGATCAACCGC
CAGTAGTGAATCTACTGGCCGCGAAACGTCTGTTACAAATGCTGGGGGCACTGGAGGGTG
AACGGCTTAGTGCGCAAGGGCAAAAAATGGCAGCGCTGGGTAACGATCCGCGTTTAGCGG
CAATGCTGGTTAGCGCGAAGAACGACGACGAAGCTGCTACCGCGGCAAAAATTGCCGCCA
TTCTCGAAGAGCCGCCACGGATGGGCAATAGTGACCTGGGCGTGGCGTTTTCGCGCAATC
AACCAGCCTGGCAGCAACGTAGTCAGCAACTGTTAAAACGCTTAAACGTACGTGGCGGTG
AGGCAGACAGTTCGCTTATCGCGCCGCTACTTGCCGGGGCGTTTGCCGATCGCATTGCTC
GTCGCCGTGGGCAAGATGGACGCTATCAACTGGCAAACGGCATGGGAGCGATGCTCGATG
CCAACGACGCGCTAAGCCGCCACGAATGGTTGATCGCACCGTTATTATTGCAGGGCAGCG
CCTCGCCGGATGCGCGGATTTTACTGGCGCTGCTGGTCGATATTGATGAGTTAGTACAAC
GCTGCCCGCAGCTGGTACAGCAGTCTGACACTGTGGAGTGGGATGACGCGCAAGGTACGC
TGAAAGCCTGGCGTCGGCTACAAATCGGTCAGTTGACGGTGAAAGTGCAGCCGCTGGCGA
AACCGTCAGAAGACGAGTTGCATCAGGCGATGCTTAATGGCATCCGTGATAAAGGTTTAA
GCGTGCTCAACTGGACGGCGGAAGCGGAACAGCTACGCTTGCGTTTGTTATGCGCCGCAA
AGTGGTTGCCGGAATATGACTGGCCAGCGGTTGATGATGAAAGTTTATTGGCAGCGCTGG
AAACGTGGCTGCTGCCACATATGACTGGCGTACATTCACTACGCGGCCTGAAATCACTCG
ACATTTATCAGGCACTACGCGGATTACTTGATTGGGGAATGCAGCAACGTCTGGATAGTG
AATTGCCTGCGCATTACACTGTGCCGACGGGAAGCCGGATCGCCATTCGTTATCATGAAG
ATAACCCGCCCGCGCTGGCGGTGAGAATGCAAGAGATGTTTGGCGAGGCCACCAATCCGA
CGATCGCCCAGGGGCGCGTGCCGCTGGTGCTGGAGTTGCTTTCACCTGCCCAAAGGCCAT
TACAAATCACACGAGATTTGAGCGACTTCTGGAAAGGAGCGTACCGTGAGGTGCAAAAAG
AGATGAAAGGGCGTTATCCCAAACATGTCTGGCCGGACGACCCGGCAAATACTGCACCGA
CGCGACGGACGAAAAAGTATTCGTAAGGTTGGTTTTCTCCCTCTCCCTGTGGGAGAGGGC
CGGGGTGAGGGCATCAGCGCGCACGTTCACCCTCACCCTAACCCTCTCCCTCAAGGGAGA
GGGGACCGATCGAGCACAAATTTTGAGAGATATCTTCTTCTGTCTTGTAACAGAAGAACA
GAAAATCGGGCTTTTGCGCCTGAATATTGCGGAGAAAAAGCATGGCCGGGAATGACCGCG
AGCCAATTGGACGCAAAGGGAAACCGACGCGTCCGGTCAAACAAAAGGTAAGCCGTCGTC
GTTACGAAGATGACGATGATTACGACGATTATGATGACTATGAGGATGAAGAACCGATGC
CGCGCAAAGGTAAGGGCAAAGGCAAAGGGCGTAAGCCTCGTGGCAAACGCGGCTGGCTAT
GGCTACTGCTAAAACTGGCTATCGTTTTTGCCGTGCTGATCGCCATTTACGGCGTTTATC
TCGATCAAAAAATTCGTAGCCGTATTGATGGCAAGGTCTGGCAACTGCCTGCGGCAGTTT
ATGGCCGAATGGTCAATCTTGAGCCAGACATGACCATCAGCAAGAACGAGATGGTGAAGC
TGCTGGAGGCGACCCAGTATCGTCAGGTGTCGAAAATGACCCGTCCTGGCGAATTTACCG
TGCAGGCCAACAGCATTGAGATGATTCGCCGTCCGTTTGATTTCCCGGACAGTAAAGAAG
GACAGGTGCGCGCGCGTCTGACCTTTGATGGCGATCATCTGGCGACGATCGTCAATATGG
AGAACAACCGTCAGTTCGGTTTCTTCCGTCTTGATCCGCGTCTGATCACCATGATCTCTT
CGCCAAACGGTGAGCAGCGTCTGTTTGTGCCGCGCAGTGGTTTCCCGGATTTGCTGGTGG
ATACTTTGCTGGCGACAGAAGACCGTCATTTTTACGAGCATGATGGAATCAGTCTCTACT
CAATCGGACGTGCGGTGCTGGCAAACCTGACCGCCGGACGCACGGTACAGGGTGCGAGTA
CGCTGACGCAACAGCTGGTGAAAAACCTGTTCCTCTCCAGCGAGCGTTCTTACTGGCGTA
AAGCGAACGAAGCTTACATGGCGCTGATCATGGACGCGCGTTACAGCAAAGACCGTATTC
TTGAGCTGTATATGAACGAGGTGTATCTCGGTCAGAGCGGCGACAACGAAATCCGCGGCT
TCCCGCTGGCAAGCTTGTATTACTTTGGTCGCCCGGTAGAAGAGCTAAGCCTCGACCAGC
AGGCGCTGTTAGTCGGTATGGTGAAAGGGGCGTCCATCTACAACCCGTGGCGTAACCCAA
AACTGGCGCTGGAGCGACGTAATCTGGTGCTGCGTCTGCTGCAACAGCAACAGATTATTG
ATCAAGAACTCTATGACATGTTGAGTGCCCGTCCGCTGGGGGTTCAGCCGCGCGGTGGGG
TGATCTCTCCTCAGCCAGCCTTTATGCAACTGGTGCGTCAGGAGCTGCAGGCAAAACTGG
GCGATAAGGTAAAAGATCTCTCCGGCGTGAAGATCTTCACTACCTTTGACTCGGTGGCCC
AGGACGCGGCAGAAAAAGCCGCCGTGGAAGGCATTCCGGCACTGAAGAAACAGCGTAAGT
TGAGCGATCTTGAAACTGCGATTGTGGTCGTCGACCGCTTTAGTGGTGAAGTTCGTGCGA
TGGTCGGAGGTTCTGAGCCGCAGTTTGCGGGCTACAACCGTGCGATGCAGGCGCGTCGTT
CGATTGGTTCCCTTGCAAAACCAGCGACTTATCTGACGGCCTTAAGCCAGCCGAAAATCT
ATCGTCTGAATACGTGGATTGCGGATGCGCCAATTGCGCTGCGTCAGCCGAATGGCCAGG
TCTGGTCACCGCAGAATGATGACCGTCGTTATAGCGAAAGCGGCAGAGTGATGCTGGTGG
ATGCGTTGACCCGTTCGATGAACGTGCCGACGGTAAATCTGGGGATGGCGCTGGGGCTGC
CTGCGGTTACGGAGACCTGGATTAAACTGGGCGTACCGAAAGATCAGTTGCATCCGGTTC
CGGCAATGCTGCTGGGGGCGTTGAACTTAACGCCAATCGAAGTGGCGCAGGCATTCCAGA
CCATCGCCAGCGGTGGTAACCGTGCACCGCTTTCTGCGCTGCGTTCGGTAATCGCGGAAG
ATGGCAAAGTGCTGTATCAGAGCTTCCCGCAGGCGGAACGCGCTGTTCCGGCGCAGGCGG
CGTATCTGACACTATGGACCATGCAGCAGGTGGTACAACGCGGTACGGGTCGTCAGCTTG
GGGCGAAATACCCGAACCTGCATCTGGCAGGGAAAACAGGGACTACCAACAATAACGTAG
ATACCTGGTTTGCGGGCATTGACGGCAGCACGGTGACCATCACCTGGGTCGGCCGTGATA
ACAACCAGCCGACCAAACTGTATGGTGCCAGCGGGGCAATGTCGATTTATCAGCGTTATC
TGGCTAACCAGACGCCAACGCCGCTGAATCTTGTTCCGCCAGAAGATATTGCAGATATGG
GCGTGGACTACGACGGCAACTTTGTTTGCAGCGGTGGCATGCGTATCTTGCCGGTCTGGA
CCAGCGATCCGCAATCGCTGTGCCAGCAGAGCGAGATGCAGCAGCAGCCGTCAGGCAATC
CGTTTGATCAGTCTTCTCAGCCGCAGCAACAGCCGCAACAGCAACCTGCTCAGCAAGAGC
AGAAAGACAGCGACGGTGTAGCCGGTTGGATCAAGGATATGTTTGGTAGTAATTAACATC
TAAGCGTGAAATACCGGATGGCGAGTTGCCATCCGGTAAAATAACATCCCATCTAAGATA
TTAACCCTTTCTTTTCATCTGGTTGTTTATTAACCCTTCAGGAACGCTCAGATTGCGTAC
CGCTTGCGAACCCGCCAGCGTTTCGAATATTATCTTATCTTTATAATAATCATTCTCGTT
TACGTTATCATTCACTTTACATCAGAGATATACCAATGGCGCGTTCCAAAACTGCTCAGC
CAAAACACTCACTGCGTAAAATCGCAGTTGTAGTAGCCACAGCGGTTAGCGGCATGTCTG
TTTATGCACAGGCAGCGGTTGAACCGAAAGAAGACACTATCACCGTTACCGCTGCACCTG
CGCCGCAAGAAAGCGCATGGGGGCCTGCTGCAACTATTGCGGCGCGACAGTCTGCTACCG
GCACTAAAACCGATACGCCGATTCAAAAAGTGCCACAGTCTATTTCTGTTGTGACCGCCG
AAGAGATGGCGCTGCATCAGCCGAAGTCGGTAAAAGAAGCGCTTAGCTACACGCCGGGTG
TCTCTGTTGGTACGCGTGGCGCATCCAACACCTATGACCACCTGATCATTCGCGGCTTTG
CGGCAGAAGGCCAAAGCCAGAATAACTATCTGAATGGCCTGAAGTTGCAGGGCAACTTCT
ATAACGATGCGGTCATTGACCCGTATATGCTGGAACGCGCTGAAATTATGCGTGGCCCGG
TTTCCGTGCTTTACGGTAAAAGCAGTCCTGGCGGCCTGTTGAATATGGTCAGCAAGCGTC
CGACCACCGAACCGCTGAAAGAAGTTCAGTTTAAAGCCGGTACTGACAGCCTGTTCCAGA
CTGGTTTTGACTTTAGCGATTCGTTGGATGATGACGGTGTTTACTCTTATCGCCTGACCG
GTCTTGCGCGTTCTGCCAATGCCCAGCAGAAAGGGTCAGAAGAGCAGCGTTATGCTATTG
CACCGGCGTTCACCTGGCGTCCGGATGATAAAACCAATTTTACCTTCCTTTCTTACTTCC
AGAACGAGCCGGAAACCGGTTATTACGGCTGGTTGCCGAAAGAGGGAACCGTTGAGCCGC
TGCCGAACGGTAAGCGTCTGCCGACAGACTTTAATGAAGGGGCGAAGAACAACACCTATT
CTCGTAATGAGAAGATGGTCGGCTACAGCTTCGATCACGAATTTAACGACACCTTTACTG
TGCGTCAGAACCTGCGCTTTGCTGAAAACAAAACCTCGCAAAACAGCGTTTATGGTTACG
GCGTCTGCTCCGATCCGGCGAATGCTTACAGCAAACAGTGTGCGGCATTAGCGCCAGCGG
ATAAAGGCCATTATCTGGCACGTAAATACGTCGTTGATGATGAGAAGCTGCAAAACTTCT
CCGTTGATACCCAGTTGCAGAGCAAGTTTGCCACTGGCGATATCGACCACACCCTGCTGA
CCGGTGTCGACTTTATGCGTATGCGTAATGACATCAACGCCTGGTTTGGTTACGACGACT
CTGTGCCACTGCTCAATCTGTACAATCCGGTGAATACCGATTTCGACTTCAATGCCAAAG
ATCCGGCAAACTCCGGCCCTTACCGCATTCTGAATAAACAGAAACAAACGGGCGTTTATG
TTCAGGATCAGGCGCAGTGGGATAAAGTGCTGGTCACCCTAGGCGGTCGTTATGACTGGG
CAGATCAAGAATCTCTTAACCGCGTTGCCGGGACGACCGATAAACGTGATGACAAACAGT
TTACCTGGCGTGGTGGTGTTAACTACCTGTTTGATAATGGTGTAACACCTTACTTCAGCT
ATAGCGAATCGTTTGAACCTTCTTCGCAAGTTGGGAAGGATGGTAATATTTTCGCACCGT
CTAAAGGTAAGCAGTATGAAGTCGGCGTGAAATATGTACCGGAAGATCGTCCGATTGTAG
TTACTGGTGCCGTGTATAATCTCACTAAAACCAACAACCTGATGGCGGACCCTGAGGGTT
CCTTCTTCTCGGTTGAAGGTGGCGAGATCCGCGCACGTGGCGTAGAAATCGAAGCGAAAG
CGGCGCTGTCGGCGAGTGTTAACGTAGTCGGTTCTTATACTTACACCGATGCGGAATACA
CCACCGATACTACCTATAAAGGCAATACGCCTGCACAGGTGCCAAAACACATGGCTTCGT
TGTGGGCTGACTACACCTTCTTTGACGGTCCGCTTTCAGGTCTGACGCTGGGCACCGGTG
GTCGTTATACTGGCTCCAGTTATGGTGATCCGGCTAACTCCTTTAAAGTGGGAAGTTATA
CGGTCGTGGATGCGTTAGTACGTTATGATCTGGCGCGAGTCGGCATGGCTGGCTCCAACG
TGGCGCTGCATGTTAACAACCTGTTCGATCGTGAATACGTCGCCAGCTGCTTTAACACTT
ATGGCTGCTTCTGGGGCGCAGAACGTCAGGTCGTTGCAACCGCAACCTTCCGTTTCTAAT
TTCTCTTTTGGGGCACGGATTTCCGTGCCCATTTCACAAGTTGGCTGTTATGCAGGAATA
CACGAATCATTCCGATACCACTTTTGCACTGCGTAATATCTCCTTTCGTGTGCCCGGGCG
CACGCTTTTGCATCCGCTGTCGTTAACCTTTCCTGCCGGGAAAGTGACCGGTCTGATTGG
TCACAACGGTTCTGGTAAATCCACTCTGCTCAAAATGCTTGGCCGTCATCAGCCGCCGTC
GGAAGGGGAGATTCTTCTTGATGCCCAACCGCTGGAAAGCTGGAGCAGCAAAGCGTTTGC
CCGCAAAGTGGCTTATTTGCCGCAGCAGCTTCCTCCGGCAGAAGGGATGACCGTGCGTGA
ACTGGTGGCGATTGGTCGTTACCCGTGGCATGGCGCGCTGGGGCGCTTTGGGGCGGCAGA
TCGCGAAAAAGTCGAGGAAGCTATCTCGCTGGTTGGCTTAAAACCGCTGGCGCATCGGCT
GGTCGATAGTCTCTCTGGCGGCGAACGTCAGCGGGCGTGGATCGCCATGCTGGTGGCGCA
GGATAGCCGTTGTCTGTTGCTCGACGAACCGACCTCGGCGCTGGATATCGCCCACCAGGT
TGATGTGCTGTCGCTGGTGCACCGTTTAAGTCAGGAGCGTGGCCTGACGGTCATTGCCGT
GTTGCACGATATCAATATGGCGGCACGCTACTGTGATTATCTGGTCGCCCTGCGCGGCGG
TGAAATGATTGCTCAGGGAACGCCTGCGGAAATTATGCGCGGCGAAACCCTCGAAATGAT
TTATGGCATCCCGATGGGTATTTTGCCGCATCCGGCGGGTGCTGCACCTGTGAGTTTTGT
TTATTGATGAGCGGCTTACCTCTTATTTCGCGCCGTCGACTGTTAACGGCGATGGCGCTT
TCTCCGTTGTTATGGCAGATGAATACCGCCCACGCGGCGGCTATTGATCCCAATCGTATT
GTGGCGCTGGAGTGGTTGCCGGTGGAATTACTGCTGGCGCTCGGCATCGTGCCTTACGGC
GTGGCGGATACCATCAACTATCGCCTGTGGGTCAGCGAACCACCATTGCCGGACTCAGTG
ATCGACGTCGGTTTGCGCACAGAACCTAACCTTGAACTGCTGACCGAAATGAAACCATCG
TTTATGGTCTGGTCGGCAGGATATGGCCCTTCACCAGAAATGCTGGCTCGTATTGCGCCG
GGTCGCGGATTTAACTTCAGTGACGGCAAACAGCCGTTGGCGATGGCGCGTAAATCGCTG
ACGGAAATGGCAGATTTACTTAACCTGCAAAGCGCAGCGGAAACGCATTTAGCGCAATAT
GAAGACTTTATCCGCAGCATGAAACCCCGCTTTGTGAAGCGTGGTGCGCGTCCGTTATTG
CTGACGACGCTTATCGATCCGCGCCATATGCTGGTCTTCGGTCCAAACAGCTTGTTCCAG
GAAATTCTTGATGAGTACGGCATCCCAAATGCCTGGCAAGGGGAAACCAACTTCTGGGGC
AGTACCGCCGTCAGTATCGATCGTCTGGCGGCGTATAAAGACGTTGATGTGCTCTGTTTT
GATCACGACAACAGCAAAGACATGGATGCGCTAATGGCAACGCCGCTGTGGCAGGCCATG
CCGTTTGTCCGCGCCGGACGCTTTCAGCGCGTACCTGCAGTCTGGTTTTATGGTGCGACG
CTCTCGGCAATGCACTTTGTGCGCGTTCTGGATAACGCCATCGGAGGTAAAGCGTGAGTA
AACGAATTGCGCTTTTCCCGGCGTTATTGCTGGCGCTGTTAGTGATTGTCGCTACGGCGC
TCACCTGGATGAACTTCTCGCAGGCGCTGCCGCGTAGCCAGTGGGCGCAGGCTGCCTGGT
CGCCGGATATTGACGTCATCGAGCAGATGATTTTTCACTACAGCTTGTTGCCGCGTCTGG
CGATTTCGCTGCTGGTGGGCGCGGGTCTGGGGCTGGTGGGCGTGCTGTTTCAGCAAGTGC
TGCGTAACCCGCTGGCGGAGCCGACGACGCTTGGCGTTGCTACAGGCGCGCAACTGGGGA
TTACCGTCACTACGCTCTGGGCGATCCCTGGTGCGATGGCGAGCCAGTTTGCTGCGCAGG
CAGGGGCTTGTGTTGTTGGCTTAATTGTCTTTGGCGTCGCGTGGGGGAAACGGCTGTCGC
CGGTAACGCTGATTCTCGCGGGGTTGGTAGTGAGCCTTTATTGCGGCGCAATCAATCAGT
TACTGGTTATCTTCCATCATGACCAACTGCAAAGCATGTTTCTGTGGAGCACTGGAACGC
TGACGCAAACCGACTGGGGCGGCGTTGAGCGTTTATGGCCGCAGCTGCTGGGCGGTGTGA
TGCTGACGTTGCTGCTACTTCGTCCGTTAACCCTGATGGGGCTTGATGATGGCGTGGCGC
GCAATCTCGGGCTGGCCTTGTCGCTTGCGCGTCTGGCAGCGCTGTCGCTGGCGATTGTCA
TCAGTGCGCTGCTGGTGAACGCTGTGGGGATTATCGGCTTTATCGGGTTGTTCGCGCCGC
TGCTGGCAAAAATGCTGGGGGCGCGGCGTCTGCTGCCACGACTGATGCTGGCGTCGTTGA
TTGGTGCGCTGATCCTCTGGCTTTCCGATCAAATCATCCTCTGGCTGACTCGCGTGTGGA
TGGAAGTGTCCACCGGTTCGGTCACTGCGTTGATCGGTGCGCCGCTGCTACTGTGGCTGT
TGCCGCGTTTACGCAGCATTAGCGCGCCGGATATGAAGGTCAACGATCGTGTCGCGGCTG
AACGCCAACATGTGCTGGCGTTTGCCCTCGCGGGCGGCGTGCTGCTGTTGATGGCTGTGG
TGGTGGCGCTGTCGTTTGGTCGTGATGCGCACGGCTGGACGTGGGCGAGCGGGGCGTTGC
TCGAGGATTTAATGCCCTGGCGCTGGCCGCGAATTATGGCGGCGCTGTTTGCGGGCGTCA
TGCTGGCGGTGGCGGGCTGTATTATTCAGCGACTGACCGGAAACCCGATGGCAAGCCCGG
AAGTGCTGGGGATTAGCTCCGGCGCGGCGTTTGGCGTGGTGTTGATGCTGTTTCTGGTGC
CGGGTAATGCCTTTGGCTGGCTGTTACCTGCAGGCAGTCTCGGCGCGGCGGTGACGCTGT
TGATCATTATGATCGCCGCCGGCCGCGGTGGATTTTCCCCACACCGTATGTTACTGGCGG
GGATGGCGTTAAGCACCGCGTTCACCATGCTTTTGATGATGTTGCAGGCAAGTGGTGACC
CGCGAATGGCGCAAGTGCTGACCTGGATTTCCGGTTCGACCTACAACGCGACCGATGCGC
AGGTCTGGCGCACCGGAATTGTGATGGTGATTTTGCTGGCGATTACCCCGCTGTGCCGCC
GCTGGCTGACCATTTTACCGCTGGGTGGTGATACCGCCCGAGCCGTAGGAATGGCGCTGA
CGCCGACGCGAATTGCGCTGCTGCTGTTAGCGGCTTGCCTGACGGCGACCGCGACGATGA
CTATTGGACCGTTGAGTTTTGTTGGTTTAATGGCACCGCATATTGCGCGGATGATGGGCT
TTCGACGGACGATGCCACACATCGTAATTTCGGCGCTGGTGGGTGGTTTACTGCTGGTGT
TCGCTGACTGGTGTGGGCGGATGGTGCTGTTTCCATTCCAGATCCCGGCGGGGCTGCTGT
CAACCTTTATCGGCGCGCCATATTTTATCTATTTGTTGAGAAAGCAGAGCCGTTAATTTT
TCCATATAACGGCCCTGTACGCCTGGACGGATAAAGCGTTTACGCGACAACGGATGCCCG
ATGCGACGCTGGCGCGTCTTATCGGGCCTACAAACGGCCCCGAATCGTAGGTCGGATAAG
GCGTTCACGCCGCATCCGACAAACCATGCTGGATCACAACTTCGCAAACACCCGACGTGC
AGCATCGATGGTGTTATTGATATCTTCCATGCTGTGCGCCACGGACATAAAGCCCGCTTC
AAACGCTGACGGTGCCAGGTAAACACCTTCGTCCAGCATCATATGGAAGAAACGCTTAAA
GCGTTCCACGTCACAGGCCATCACATCCTGATAGCACGTCACGGACTCGGCGTCGGTAAA
GAAAATACCGAACATGCCGCCAACGTGGTTAACGACCAGCGGAATTCCGGCTTCTTCTGC
CGCTTCCAGCAGACCTTCTGCCAGACGTGTTGTCAGCTCATCCAGCGTTTCGTGAACGCC
CGGCTGCGCGACTTCATTCAGACAGGCGAAACCCGCTGCCATCGCAATCGGGTTACCGGA
AAGCGTACCCGCCTGATAGACCGGACCCGTCGGGGCCAGCGCATCCATTACATCACGACG
ACCACCGAATGCGCCTACCGGCATTCCACCGCCGATGATTTTGCCGAGGCAGGTTAAATC
TGGCACTACGCCGTAATAATCCTGTGCGCCAGCTAGCGCTACGCGGAAACCGGTCATCAC
TTCATCGATGATCAGCAACGCGCCAAATTCGTCGCACAGCGCGCGCAGACCTGGCAGGAA
CTCTGGCAGCGGCGGAACACAGTTCATATTGCCTGCCACCGGCTCGACGATAATACAGGC
AATCTCTTGCGGGTATTGCTCAAATGCGGCGCGTACAGAAGCCAGATCATTATAAGTACA
GGTTAAGGTATATTTGGCGAAATCTGCCGGAACGCCCGGCGAGTTTGGCTGGCCTAACGT
GAGTGCGCCAGAACCGGCTTTCACCAGCAGGCAGTCAGCGTGACCATGGTAACACCCTTC
AAATTTAATAATTTTGTCGCGACCGGTAAAACCACGGGCCAGGCGGATGGCGCTCATGGT
CGCTTCAGTGCCGGAGTTCACCATGCGCACCATATCCATGGTCGGGACCAGTTCGGTCAC
CAGTTGCGCCATTTTCACTTCCATTTCGGTTGGTGCACCAAAGCTTAAACCACGCTCGGC
GGCTTCAATCACGGCATTGCGGATTGCCGGATGGTTATGGCCCAGCACCATCGGCCCCCA
GGAACCGACATAATCGATATAGGCTTTGCCATCAACATCGTACAGATAAGCGCCGTCCGC
TTTTTCGATAAACAGTGGAGTGCCGCCCACGCCAGTAAAGGCGCGAACAGGGGAGTTCAC
ACCGCCAGGGATCAGCTCGCGCGCTGCGCTGTAAAGATTTTCAGACTTACTCATGGAGGG
TTCCTGATTCGTAGAAAAAGTGAATGGCTGCTATTCTATGTTATTCATAACAAGTTAAAT
ACTCGTCAAACATCAGGCTGCTTGTACTGGTGCAATCCTGATTTCTTAGAGTATAAAAGT
TTTGTGCATTTGAAACATTACGCTTTGCAAAGGATTTTCATGGAACGTGCGAGTAAAATG
CCGTCATCTTATTTGTATGACCAATAAGTGATCATTGGATGAAAACTGATACTCCCTCTT
TAGAAACACCGCAGGCCGCGCGCCTGCGACGCAGACAACTGATTCGCCAACTTCTTGAGC
GCGATAAAACCCCGTTAGCCATTTTGTTTATGGCGGCAGTCGTCGGCACGCTTGTTGGGC
TGGCAGCGGTTGCTTTTGACAAAGGTGTCGCCTGGTTGCAGAACCAACGTATGGGGGCGC
TGGTACATACTGCTGATAATTATCCGCTTCTGTTAACCGTCGCTTTTCTCTGTTCGGCGG
TGCTGGCGATGTTTGGCTACTTTTTGGTGCGCAAATACGCGCCGGAAGCAGGTGGTTCGG
GGATCCCGGAAATTGAAGGGGCGCTGGAAGATCAACGTCCCGTTCGCTGGTGGCGTGTAT
TGCCGGTGAAGTTCTTTGGCGGGCTGGGGACACTCGGCGGAGGCATGGTGTTGGGGCGCG
AAGGGCCAACCGTGCAGATCGGCGGTAACATTGGCCGTATGGTGCTTGATATTTTCCGCC
TGAAAGGTGACGAAGCTCGCCATACGCTGCTGGCAACCGGTGCTGCTGCGGGGCTGGCTG
CGGCCTTTAACGCGCCGCTGGCGGGTATTTTGTTTATTATCGAAGAGATGCGTCCGCAGT
TTCGCTATACGTTAATTTCGATTAAAGCGGTATTTATTGGTGTCATTATGTCGACCATTA
TGTACCGGATTTTTAATCATGAAGTTGCGTTGATTGACGTCGGTAAACTTTCTGATGCGC
CGCTTAATACGCTGTGGCTTTATCTGATCCTCGGTATTATTTTTGGCATTTTCGGCCCTA
TTTTTAATAAATGGGTGCTGGGGATGCAGGATTTGCTGCACCGTGTGCACGGCGGCAATA
TTACCAAATGGGTGCTAATGGGCGGTGCGATTGGCGGTCTGTGTGGATTGCTGGGGTTTG
TGGCACCAGCAACGTCGGGCGGCGGTTTTAACCTGATTCCTATCGCTACCGCGGGGAATT
TCAGCATGGGAATGCTGGTGTTTATCTTCGTCGCGCGGGTCATTACCACCTTACTCTGCT
TCTCTTCCGGCGCGCCGGGCGGTATTTTTGCCCCGATGCTGGCGCTGGGTACTGTGCTGG
GAACCGCTTTCGGAATGGTTGCCGTTGAGCTGTTTCCGCAATATCACCTTGAGGCGGGGA
CGTTTGCTATTGCCGGAATGGGGGCATTACTGGCGGCATCTATTCGCGCGCCGTTAACGG
GGATCATTCTGGTTCTGGAGATGACCGATAACTACCAGCTCATTTTGCCAATGATTATTA
CCGGTCTTGGCGCAACACTATTAGCGCAATTTACCGGCGGGAAACCGCTATACTCGGCGA
TTCTTGCGCGCACGCTGGCAAAACAGGAAGCTGAGCAACTGGCGCGAAGCAAGGCCGCAT
CAGCCAGCGAGAATACTTGAACGAAATACCAGGGTATTAGATAATGGCGATTATTATTGG
GTTAGAATTTGCCCAATTGCCGATGTCGTTTGGAGCAAAATATGAGTGATGACGTAGCAC
TGCCGCTGGAGTTTACCGACGCAGCAGCCAACAAAGTTAAAAGCCTGATCGCTGACGAAG
ATAACCCGAATCTGAAATTACGCGTGTATATCACCGGTGGCGGTTGCAGCGGCTTCCAGT
ATGGTTTCACCTTTGATGATCAGGTGAACGAAGGCGATATGACCATCGAAAAACAGGGCG
TTGGCCTGGTGGTTGATCCGATGAGCCTGCAATATCTGGTCGGCGGTTCCGTTGATTATA
CCGAAGGTCTGGAAGGTTCTCGTTTCATCGTGACCAACCCGAACGCGAAAAGCACCTGCG
GTTGCGGTTCTTCCTTTAGTATCTAATCTGTTGTTCATGTGCCGGATAAACTATCCGGCA
CATCTTCTCTCTTCAACGCCCATTCTCATCCAGCGCAAACGTCGGTAGCTTAAGATGCCA
ACGAATAGCCGCCAGCCGAATCAATAGCGTCACGACCATGCCCATCATACTGGCTGTTTC
CAGTGGTACGGAAAATGTGTAATAAGCCGTAGCGTGGACAATACCGCCGATAATACAGGC
AGTTGCGTAGATTTCTGTACGTAAAATCATGGGGATTTCGCGGGCCAGAACATCACGAAT
GATCCCGCCGCCAACGCCAGTAATGACGCCCATACAAACCGCGATTAACGGACCGGCTTC
CGCATTAAAGGCTTTATTCACGCCAATGCCGACAAACACCGCCAGACCAACGGCGTCCAG
CACCGGCAACATCCATTTTGGTAAGCGTCTTGGCTGGCGCACCAGCACGATGGTCAGCAT
GCTGGTGACCATTGCAACGACCAGATCGGTGGGATCTTTCACCCAAAATACCGGGCCGTG
ATCCAGCGCCATGTCGCGAATTGTCCCGCCGCCTACTGCGGTTACCACGCCCAGTACCAG
AACACCAAAAGGGTCCATACGCAATTTTCCGGCTAACAAAACGCCGGAGATGGCAAATAC
CGCTGTGCCGACTATATCCAGCCAATAGACGAGCATTGTTCAATCCCCACTGAGCACCTG
AAAAGGTCAGGCGCTAATCTACCTGTGAAAGCGCATTACAGAGCTGTTGTGCAGCGAGGA
TAATACGTGGGCTTGCACGTTCAAACCAGTCACTCGTGAGAGGAATAACGGGAATTTTGA
GCTGTTCACCCCAGTATTGTTTGATTTTAGGAATTTGGTCCGGTCCGCCTGTAATGACAA
TCGCCTGTGGCGAGCGTGCTAACACCTGTTCGCGGCTAACTTGCGGCCAGGGAACCCGGC
TGTCTTTAAAGATGTTTTCTCCGCCACAAACTTCGAGTACCTGGTTCTGAATCGACTCTT
TTCCACTGGTAAATGGCGGATTAATGCCGAATTGCAGAAAAACACGTTTTTTAGGTTTAT
CAGCATATTGCGCTTTCAATTGCGCGTACTGATCCAGCAGGGATTGCGCGGCTTGTTCGG
CCTTGTCTGGTTGCGGACTCCAGGGGGCCAGTTGACGTAACGCATTGGCAATTTGTTCAA
TGCTTGTCGCATCGACCCACATCACTTTTATTCCCAGCGAAGCCAGCTGGTCAACCTGCC
GCTCGGCATTACCTCCACGCCAGGCAATCACCAGATCGGGTTTCAGCGCGACAATGCGTT
CCAGATTCATCCCCTGCCAGGTGGAAACCTGCTCAATCTTTTGCGCTTGTGGAGGATAGT
CGGAATAGCTGCTGACCCCAACCGGCGTGATCCCGGCGGCAAAGGCAAGTTCAGTGTTGG
CGGGAGAAAGCGTGATGACGCGCGGCGCGGCGTTGAGCCACAGTGGCGCAAGAAAAGACA
GGGCGACCAGCGCCCTGAACAGTGACTTAGCCATGTGCAAGTTTCTGCACCAGTGACTCA
ACCATCAGGCTGGACTGTTTAGCGGCAACAGCCAGGAACTCATCGAAGCTAAGATGAGAC
TGTTGATCGGCCACGTCGGAGATGGCGCGTACGACAACAAACGGGACGTTGAAATTGTGG
CAGACATGGGCGATTGCCGTCGCTTCCATCTCTACAGCAATGGCCTGTGGGAAGTTGTGG
CGGATTTTCGCCAGACCAACAGAACCGTTGATGAAAGCGTCGCCGCTAACAATCAGGCCA
CGTACAGCGTTAAGATTCAGTTCGGCAATGCAGGCCTCAGCGGCAGCGATCAGTTTATCG
TCAGCTTTAAAGCCTGCCGGACAGCCTGGTAACTGACCGTATTCATAACCAAATGCCGTG
ACATCCGCGTCGTGATAACGTGCTTCGTCCGAGACAACGATATCGCCCACTTTCAACGTT
GGTGCCAGGCCACCGGCAGAACCGGTGTTAATAATCACATCTGGCTTGCAGTGTTCCAAC
AGCAAAGTGGCACCCAGCGCCGCAGCGACTTTACCGATGCCCGATTTCAGAAGCGCAACC
TCGGTTCCATTCAGTTGGCCGGTATAGATTTCGCAACCGCCGAGACTGATAGTTTGACGG
TTTTCGATTTTGTCACGCAGCAGCGTAACTTCTTCTTCCATTGCACCAATGATGCCGATT
TTCATAGATTTACTCGCGATAAGCCCGATTTGAAGGCATAGTTTACCATGCGCTTACGGG
GAAGCGTATTTCTCACGCGGGAGAGGACATGGCACAGATTGATTTCCGAAAAAAAATAAA
CTGGCATCGTCGTTACCGTTCACCGCAGGGCGTTAAAACCGAACATGAGATCCTGCGGAT
CTTCGAGAGCGATCGCGGGCGTATCATCAACTCTCCGGCAATTCGTCGTCTGCAACAAAA
GACCCAGGTTTTTCCACTGGAGCGCAATGCCGCCGTGCGCACGCGTCTTACCCACTCGAT
GGAAGTCCAGCAGGTGGGGCGCTACATCGCCAAAGAAATTTTAAGCCGTCTGAAAGAGCT
TAAATTACTGGAAGCATACGGCCTGGATGAACTGACCGGTCCCTTTGAAAGCATTGTTGA
GATGTCATGCCTGATGCACGATATCGGCAATCCGCCGTTTGGTCATTTTGGCGAAGCGGC
GATAAATGACTGGTTTCGCCAACGTTTGCACCCGGAAGATGCCGAAAGCCAGCCTCTGAC
TGACGATCGCTGCAGCGTGGCGGCACTACGTTTACGGGACGGGGAAGAACCGCTTAACGA
GCTGCGGCGCAAGATTCGTCAGGACTTATGTCATTTTGAGGGGAATGCACAAGGCATTCG
CCTGGTGCATACATTGATGCGGATGAATCTCACCTGGGCACAGGTTGGCGGTATTTTAAA
ATATACCCGTCCGGCGTGGTGGCGTGGCGAAACGCCTGAGACACATCACTATTTAATGAA
AAAGCCGGGTTATTATCTTTCTGAAGAAGCCTATATTGCCCGGTTGCGTAAAGAACTTAA
TTTGGCGCTTTACAGTCGTTTTCCATTAACGTGGATTATGGAAGCTGCCGACGACATCTC
CTATTGTGTGGCAGACCTTGAAGATGCGGTAGAGAAAAGAATATTTACCGTTGAGCAGCT
TTATCATCATTTGCACGAAGCGTGGGGCCAGCATGAGAAAGGTTCGCTCTTTTCGCTGGT
GGTTGAAAATGCCTGGGAAAAATCACGCTCAAATAGTTTAAGCCGCAGTACGGAAGATCA
GTTTTTTATGTATTTACGGGTAAACACCCTAAATAAACTGGTACCCTACGCGGCACAACG
ATTTATTGATAATCTGCCTGCGATTTTCGCCGGAACGTTTAATCATGCATTATTGGAAGA
TGCCAGCGAATGCAGCGATCTTCTTAAGCTATATAAAAATGTCGCTGTAAAACATGTGTT
TAGCCATCCAGATGTCGAGCGGCTTGAATTGCAGGGCTATCGGGTCATTAGCGGATTATT
AGAGATTTATCGTCCTTTATTAAGCCTGTCGTTATCAGACTTTACTGAACTGGTAGAAAA
AGAACGGGTGAAACGTTTCCCTATTGAATCGCGCTTATTCCACAAACTCTCGACGCGCCA
TCGGCTGGCCTATGTCGAGGCTGTCAGTAAATTACCGTCAGATTCTCCTGAGTTTCCGCT
ATGGGAATATTATTACCGTTGCCGCCTGCTGCAGGATTATATCAGCGGTATGACCGACCT
CTATGCGTGGGATGAATACCGACGTCTGATGGCCGTAGAACAATAACCAGGCTTTTGTAA
AGACGAACAATAAATTTTTACCTTTTGCAGAAACTTTAGTTCGGAACTTCAGGCTATAAA
ACGAATCTGAAGAACACAGCAATTTTGCGTTATCTGTTAATCGAGACTGAAATACATGAA
AAAAACCACATTAGCACTGAGTGCACTGGCTCTGAGTTTAGGTTTGGCGTTATCTCCGCT
CTCTGCAACGGCGGCTGAGACTTCTTCAGCAACGACAGCCCAGCAGATGCCAAGCCTTGC
ACCGATGCTCGAAAAGGTGATGCCTTCAGTGGTCAGCATTAACGTAGAAGGTAGCACAAC
CGTTAATACGCCGCGTATGCCGCGTAATTTCCAGCAGTTCTTCGGTGATGATTCTCCGTT
CTGCCAGGAAGGTTCTCCGTTCCAGAGCTCTCCGTTCTGCCAGGGTGGCCAGGGCGGTAA
TGGTGGCGGCCAGCAACAGAAATTCATGGCGCTGGGTTCCGGCGTCATCATTGATGCCGA
TAAAGGCTATGTCGTCACCAACAACCACGTTGTTGATAACGCGACGGTCATTAAAGTTCA
ACTGAGCGATGGCCGTAAGTTCGACGCGAAGATGGTTGGCAAAGATCCGCGCTCTGATAT
CGCGCTGATCCAAATCCAGAACCCGAAAAACCTGACCGCAATTAAGATGGCGGATTCTGA
TGCACTGCGCGTGGGTGATTACACCGTAGCGATTGGTAACCCGTTTGGTCTGGGCGAGAC
GGTAACTTCCGGGATTGTCTCTGCGCTGGGGCGTAGCGGCCTGAATGCCGAAAACTACGA
AAACTTCATCCAGACCGATGCAGCGATCAACCGTGGTAACTCCGGTGGTGCGCTGGTTAA
CCTGAACGGCGAACTGATCGGTATCAACACCGCGATCCTCGCACCGGACGGCGGCAACAT
CGGTATCGGTTTTGCTATCCCGAGTAACATGGTGAAAAACCTGACCTCGCAGATGGTGGA
ATACGGCCAGGTGAAACGCGGTGAGCTGGGTATTATGGGGACTGAGCTGAACTCCGAACT
GGCGAAAGCGATGAAAGTTGACGCCCAGCGCGGTGCTTTCGTAAGCCAGGTTCTGCCTAA
TTCCTCCGCTGCAAAAGCGGGCATTAAAGCGGGTGATGTGATCACCTCACTGAACGGTAA
GCCGATCAGCAGCTTTGCCGCACTGCGTGCTCAGGTGGGTACTATGCCGGTAGGCAGCAA
ACTGACCCTGGGCTTACTGCGCGACGGTAAGCAGGTTAACGTGAACCTGGAACTGCAGCA
GAGCAGCCAGAATCAGGTTGATTCCAGCTCCATCTTCAACGGCATTGAAGGCGCTGAGAT
GAGCAACAAAGGCAAAGATCAGGGCGTGGTAGTGAACAACGTGAAAACGGGCACTCCGGC
TGCGCAGATCGGCCTGAAGAAAGGTGATGTGATTATTGGCGCGAACCAGCAGGCAGTGAA
AAACATCGCTGAACTGCGTAAAGTTCTCGACAGCAAACCGTCTGTGCTGGCACTCAACAT
TCAGCGCGGCGACAGCACCATCTACCTGTTAATGCAGTAATCTCCCTCAACCCCTTCCTG
AAAACGGGAAGGGGTTCTCCTTACAATCTGTGAACTTCACCACAACTCCATACATCTTCA
TCATCCTTTAGGCATTTGCACAATGCCGTACGTTACGTACTTCCTTATGCTAAGCCGTGC
ATAACGGAGGACTTATGGCTGGCTGGCATCTTGATACCAAAATGGCGCAGGATATCGTGG
CACGTACCATGCGCATCATCGATACCAATATCAACGTAATGGATGCCCGTGGGCGAATTA
TCGGCAGCGGCGATCGTGAGCGTATTGGTGAATTGCACGAAGGTGCATTGCTGGTACTTT
CACAGGGACGAGTCGTCGATATCGATGACGCGGTAGCACGTCATCTGCACGGTGTGCGGC
AGGGGATTAATCTACCGTTACGGCTGGAAGGTGAAATTGTCGGCGTAATTGGCCTGACAG
GTGAACCAGAGAATCTGCGTAAATATGGCGAACTGGTCTGCATGACGGCTGAAATGATGC
TGGAACAGTCGCGGTTGATGCACTTGTTGGCGCAGGATAGCCGTTTGCGGGAAGAACTGG
TGATGAACCTGATTCAGGCAGAGGAGAATACTCCCGCACTTACTGAATGGGCGCAACGGC
TGGGGATCGATCTCAATCAACCGCGAGTGGTGGCTATTGTTGAGGTCGACAGCGGTCAGC
TTGGCGTGGACAGCGCAATGGCGGAGTTACAACAACTGCAAAACGCGCTGACTACGCCCG
AGCGTAATAATCTGGTGGCGATTGTCTCGCTAACCGAAATGGTGGTGTTGAAACCGGCGT
TGAACTCTTTTGGGCGCTGGGATGCAGAAGATCATCGTAAGCGAGTTGAACAACTGATTA
CCCGCATGAAAGAGTACGGCCAGCTGCGTTTTCGCGTTTCACTGGGCAACTATTTTACCG
GTCCTGGCAGTATTGCCCGATCCTATCGTACGGCGAAAACGACGATGGTGGTGGGTAAAC
AGCGGATGCCAGAAAGTCGCTGCTATTTTTATCAGGATCTGATGTTACCTGTGTTACTCG
ACAGTTTGCGTGGCGACTGGCAGGCCAACGAACTGGCGCGACCGCTGGCGCGGCTGAAAA
CGATGGACAATAACGGCTTGCTGCGACGAACGCTGGCGGCGTGGTTTCGCCACAATGTGC
AACCGCTGGCAACGTCAAAGGCGTTGTTTATTCATCGTAATACCCTGGAGTATCGGCTTA
ATCGTATATCGGAACTGACCGGGCTTGATTTGGGCAATTTTGATGACAGGTTGCTGCTGT
ATGTGGCGTTACAACTGGATGAAGAGCGGTAGGTTATGCGTTAAGGTTGAGGCGGCGCTG
GCTCATTCCCCTCAGCCCGAAGGGTAGAGGGGAATGCCCGAATTAACCGTCAGTTCGGGA
TTATTTACGCGTTAGTTTTTCCAGATCGGCTTCAATCTCGCTGATCTTATTGGTTACGAC
TGACTCCAGGTGACGTAAGTCGTCGAGGATCTTACGCTTAAGATCAACTTCGCTGCGGTC
ACGCTGGCAGATTTGATCAAGCTCATCAATGATATACCGTAGATTCGGGCTGATTTCCTG
GACTTCTTTATAACCCTGACCCACACCATCAGCGACGACCGTTTTACGCTGACGCGGATA
TTTAAACTTAACGCTCTTGGCGAAAAACTCGCCTTTGTCTTTCTGGAAATAGATTTTCAG
AATATCGTTGTTGGCTTCCTGCCGGAGGCTGTAACGATCAATTTCTTCAGGATTGGTAAT
ACCCAGACTTTTCAGATTGTCGTACATAGCGTTACCTCAAAATGAGTCAGTAAATTGTGC
TTATTTTAGCATTTGGCCTGGCCCGCCCGGCTCGACTGTGATCGCAGAAAGCCTTTTTCT
TCCAGACTTCTATCATGGCGTAAAAATCAAAAAATTACCTGCTTTATTCTGGTGATAAAA
TTCACGATCTACACCAGTTCCAGCATCGTTACTTCCGGGCGGCAGTTCAGACGCAAACCA
TACAAACTGCCCACGCCACGGGTTGTGTAGATGTGTCTTTCGCCAAAGGCATTTAATCCG
GCGACGTAACGTTTATCTTCGACAGGGGCAAAAGGTTCACCAACCAACGGTACGCGCAGT
TGCCCGCCGTGAGTATGGCCGCACAGCATCAGATCCCAGGGTTCATCACGCATGACTTCT
TTGCTGTCGGGATTATGCGCCAGCACCAGTCTTGGCAGATTGGCTTCGCTGGCGGGAGGC
GGTTTGCATTGTCCGGCCCATAAGTCACCAGTGCCTACCAGTTCGAATTGCCTGTTCGGC
GTGGCGATCACCGTAGCCTGGTTAAACAACACCGTGATGCCCGCTGATTTCAACGTCTCG
CCAATTAAGTGATTTTTTTCTGTACCAACAGGGCGATCGTGGTTGCCGAAGCAGGCAAAC
GTCGGCGCACATTCGGCAAGGGGGGAGAGTACGTCACTAAACGCCGAAAAATTCAGCGAC
ATATCAAATAATACGTAATCGCCGCCCAGTAATATCAAATCGGGCTTTTGTTCTATGCCA
AGAGCAATCGCGTCAGAAATCAGGCTTAAAGGAACAAAACGAGAGTAATGGAGATCGGCC
AGAAAAAGAATTTTGAATGGTGCTGCGTTGTCTTTAAAAAAGGCGAGGCGGTGACGGATT
AATTCAAACCAGCCTGGCTCACAGTAATGCATATAACCGAAACCTGAGCTCGTGGCTATC
GTCGCGGCAGTAGCCTGCAAAAATCGGCGGCGTGAAATCATCGCTCATCCCTGCAAAAAA
ATCGGGCAGCGTCGTGCTGCCCGTGTGCATACTTTTAGTCGATGGTACGCAGCAGTTCGT
TAATGCCGACTTTGCCGCGAGTTTTCGCGTCAACTTTCTTAACGATAACCGCACAGTAGA
GGCTGTATTTGCCATCTTTTGACGGCAGATTACCTGAAACAACCACAGACCCCGCCGGAA
CGCGACCGTAGTGGATTTCGCCGGTTTCACGGTCGTAAATACGGGTGCTCTGACCAATGT
ATACGCCCATGGAAATGACGGAACCTTCTTCGACAATCACCCCTTCAACCACTTCAGAGC
GCGCGCCGATGAAGCAATTATCTTCAATGATGGTTGGGTTAGCCTGCAGCGGTTCCAGCA
CGCCGCCGATGCCCACGCCACCGGAAAGGTGGACGTTTTTACCAATCTGCGCACAAGAAC
CGACGGTCGCCCAGGTATCAACCATGGTGCCTTCATCAACATATGCGCCGATGTTGACGT
AAGACGGCATCAGCACGGTGTTACGGGCAATAAACGCACCCTGACGTACCGCCGCTGGTG
GCACAACGCGGAAGCCTTCTTTCTGGAAACGTGCTTCGTCGTAGTCGGCGAATTTCATCG
GCACTTTGTCGAAGTAGCGGCTTTCTGCCCCTTCGATCACCTGATTATCATTAATACGGA
AAGAGAGCAGCACCGCTTTTTTCAACCACTGATGCGTCACCCACTGACCGTCAATTTTTT
CCGCTACACGCAGTGCGCCGGAATCCAGCAGGGCGATCACCTGATTTACCGCTTCGCGGG
TAACGGTGTCTGCATTGGCTGGCGTGATCTCGGCACGGCGTTCAAAAGCGGTTTCAATAA
TGTTCTGTAACTGCTGCATTGTTAAACTCTTTTCATATCAGTAAACACATCACCCTTTAT
CGTTTGGATTGAGGGCCTCTGTCAACCGCTGATGCACTTCCTGCTGCAACTCGTTATTAA
GCGCACGCCGGTCAGCGGTGGCAATTATGAATAAATCTTCTACTCGCTCGCCAATGGTTG
TAATTCGGGCACCATGAAGCGAAATTCCCAGATCGGCAAAAATTTTCCCGACTCGCGCCA
GCAGTCCAGGTTGGTCGAGGGCGATCAGTTCGAGGAACGATTTGCGGTCGGTATGGGTCG
GCAAAAACGTTACTTCGGTTTCAACAGTAAAATGGCGTAATTTGGCGGGTTGGCGACGGG
GCTGCGGTGGCTGCCAGCTACTTTGCGTCAGTACTTGCTCCAGACCAAACCGAATAACCT
CATGACGATCTGCGGACAGCGGGTTGCCATCGGGTTCCAGCACGATAAAGGTATCCATCG
CCATACCGTCGCGAGTGGTGAAAATTTGTGCGTCGTGAACACTTAAATTGCGGCGGTCTA
ATTCGGCACAGACGGCGGCAAACAGATAAGGGCGGTCCGGGCTCCAGATAAAAATCTCGG
TGCCTCCACGCGTAGCCTGCGGGCTAAGCAATACCAGCGGTTTGCTTAAATCATGCTGTA
ATAAATGGCGGGCATGCCAGGCCAGTTGATTTGGGCTATGGCGGACAAAATAGTTAGCAC
GACAGCGTGACCAAATTTGGTGCAGCGCCTCTTCGTCGATGTTATCCATGCGCAGTAGTG
CCAGTGCCTGGAGTTGGTGATGGCGAACCCGTTCGCGCATATCCGGCGTGTTTTGCATTC
CGCGTCGTAGCTGCTTTTCGGTGGCAAAGTAGAGCTCACGCAACAGACTTTGCTTCCAGC
TATTCCACAGCGTTTCGTTGGTGGCGCAAATGTCAGCCACAGTCAGGCATACCAGATAGC
GCAGACGATTTTCCGTTTGCACTTCTTCGGCAAACTGCTTGATGACTTCCGGGTCCTGAA
TATCGCGGCGTTGGGCGGTCACCGACATCAACAGGTGCTGGCGAACCAGCCAGGCGACCA
GCTGTGTTTCGCGTGAGTTCAGCCCGTGGAGTTCGGCAAAATGCACTACATCCTGAGCAC
CGAGAATGGAGTGGTCGCCGCCGCGTCCTTTGGCGATATCGTGAAACAGCGCGGCGATGA
AAATCAGCTCAGTTGACGGCAGGCGCGGCCAGACGTCCACACACAACGGATGGCGCTGGC
GCGTTTCTTCACTGGCAAAACTCTCCAGTTTCAGCATCACGCGGATAGTATGTTCATCCA
CCGTGTAGGCGTGGAACAGATCAAACTGCATCTGCCCGACGATATGCGACCATTGCGGCA
TATACGCGCCGAGCACGCTATGGCGATGCATTGGCAATAGCCCGCGCCGCACCGCTCCGG
GGTGACGCAGAATGCTCAAAAACAGTTTTCGTGCTTCCGGAATATTACACAGCGGTTGTT
GCAGATGGCGACGGGCATGGCGTAACTGGCGCAGCGTGGTGGAGTAAATGCCGGTGATCG
CACTGTTGTGCACCATGGTGTAGAACATACGCAAGATGGCTTCCGGCTGGCGCATAAATA
GTGTTTCATCACGCAGGTCGATTAGCGTACCGCGTAGCTGAAACTCATCGTCGATTGGAC
GTGGTTTTTCGTCGGCGGGAAGGGCGAGGATGGCTTCATCGAACAGTTGCAGCAGCATCT
GGTTGAGTTCACTGACGCGGCGTGTAACGCGGAAGTAATCCTTCATCATCCGCTCGACCG
GTTCGTTACCTTCACCACTGTAATTCAGACGCTGGGCGACGCTAAGCTGGCGATCGAATA
ACAGGCGATTATCGTAACGGCTGACGACCAGATGCAGGGCAAAGCGAATACGCCACAATA
TATGCAGACATTCGTTTAATTCCGCCCGCTCCGCTGAGGTTAAGAAGCCAAACCCGACCA
TTTCATCCAGCGATGTTGCGCCAAAATGACGGCGGGCCACCCATTGCAGAGTGTGGATAT
CGCGCAAGCCGCCAGGGCTGCTTTTGATGTCTGGTTCAAGGTTGTAGCTGGTGCCATGGT
AACGCTGATGGCGCTGGTTCTGTTCTTCAACTTTCGCCGCGTAGAACTTGTCGGAAGGCC
AGAATCCTTCGCTGAAAATATGTTTTTGCAGTTCGAGGAACAGCGCAACATCGCCAATTA
ATAAGCGGGATTCGATTAAATTGGTGGCGACGGTTAAATCCGATAACCCTTCCAGCATGC
ACTCTTCAAGCGTGCGCACGCTATGACCGACTTCCAGCTTTACATCCCAGAGCAGCGTTA
ACAGCTCGCCCACTTTTTGCGCCTGATCGTCCGGGAGCTTTTTACGGCTTAAAATCAGTA
AATCGACGTCTGAAAGTGGATGCAGCTCGCCACGACCGTAGCCACCGACGGCGACCAATG
CCAGGTCGGCAATCTGGCTGAATCCCGCTTCAATCCATAATCGTTGCAGGAGCTGGTCGA
TAAACTCGGTGCGCGCCTCAATCAACTGTTCTGCAGAGATCCCATTGTCAAAGGCATCAC
CCAGCCAACGCTGGAAAGTATCGATATGGGCTTTTATCCCACCGACGGTTAATTCATCAC
GGGGCCAGACGCATGGATTTTGCGGTTGACCGGGCAGGGTGGGGAGAGCGGTGTTTGCGT
ACTGTTCTGGAAGGGTATTCATTGTGCGCCACCCATAAGATTAAATTATCGCATTAAAAA
AGCCGGCATTCGCCGGCTTCATCTTATTCGTCGTGCGAGATTATCGCCGGGATGGTGTCA
TCCTTGCGTAGCGTCAGAATTTCGCAGCCGTTATCAGTCACCACAATAGTATGCTCATAT
TGTGCAGACAAGCTGCGATCTTTGGTTTTTACCGTCCAGCCATCTTTCATGGTGCGGATC
TCTTTTTTACCCGCGTTGACCATTGGCTCGATGGTGAACGTCATCCCAGGTTTCAGTACG
ACGTTGGTTTCACGGGAGTCATAGTGCAGCACCTGCGGTTCTTCATGGAAGCCGCGACCA
ATACCGTGTCCGCAATATTCACGAACGACGGAGAAGCCTTCTGCTTCGACAAATTTCTGA
ATCGCCGCACCGATTTCGCGCAGATTAATGCCTGGTTTTACCATGCGTAGCGCCAGGTAC
AGGCTTTCTTGCGTGATGCGGCACAGACGTTCGCCCATGATGGTCGGCTTACCGACGATA
AACATTTTCGAGGTATCGCCGTGGAAACCATCTTTGATTACGGTGACATCAATGTTAACG
ATATCGCCATCTTTCAGCAGCTTAGCATCGTCCGGGATACCGTGGCACACCACTTCATTA
ATAGAGATGCAAACGGATTTCGGATAGCCGTGATAGCCGAGGCAGGCAGAAACCGCGTGT
TGTTCATTAACAATGTAATCATTACAGATGCGATCCAGCTCGCCGGTGCTGACGCCCGGT
TTAACATACGGTTCGATCATCTCCAGCACTTCGGCAGCCAGTCGGCCAGCGACGCGCATT
TTTTCGATATCTTCTGGGGTCTTGATTGAGATAGCCATTAATTCTGTCCATCAGCGTCGG
TGATACCGACAATATATATGTAAGTGCCGTCAATGGTATCACACCCGGGCAAATTGAGAA
TCATTCTGAATTTCGCCAAACGTGCCACTGAAGGTTTTCTATAATAGAAAATTCGACGTC
TGATGCTGTACACAGCGCCAACAATTATTGGTGTCCACGACGTATTTGTGGTATAAAGCG
CGCCGGACTTCCGATCCATTTCGTATACACAGACTGGACGGAAGCGACAATCTCACTTTG
TGTAACAACACACACGTATCGGCACATATTCCGGGGTGCCCTTTGGGGTCGGTAATATGG
GATACGTGGAGGCATAACCCCAACTTTTATATAGAGGTTTTAATCATGGCAACTGTTTCC
ATGCGCGACATGCTCAAGGCTGGTGTTCACTTCGGTCACCAGACCCGTTACTGGAACCCG
AAAATGAAGCCGTTCATCTTCGGTGCGCGTAACAAAGTTCACATCATCAACCTTGAGAAA
ACTGTACCGATGTTCAACGAAGCTCTGGCTGAACTGAACAAGATTGCTTCTCGCAAAGGT
AAAATCCTTTTCGTTGGTACTAAACGCGCTGCAAGCGAAGCGGTGAAAGACGCTGCTCTG
AGCTGCGACCAGTTCTTCGTGAACCATCGCTGGCTGGGCGGTATGCTGACTAACTGGAAA
ACCGTTCGTCAGTCCATCAAACGTCTGAAAGACCTGGAAACTCAGTCTCAGGACGGTACT
TTCGACAAGCTGACCAAGAAAGAAGCGCTGATGCGCACTCGTGAGCTGGAGAAACTGGAA
AACAGCCTGGGCGGTATCAAAGACATGGGCGGTCTGCCGGACGCTCTGTTTGTAATCGAT
GCTGACCACGAACACATTGCTATCAAAGAAGCAAACAACCTGGGTATTCCGGTATTTGCT
ATCGTTGATACCAACTCTGATCCGGACGGTGTTGACTTCGTTATCCCGGGTAACGACGAC
GCAATCCGTGCTGTGACCCTGTACCTGGGCGCTGTTGCTGCAACCGTACGTGAAGGCCGT
TCTCAGGATCTGGCTTCCCAGGCGGAAGAAAGCTTCGTAGAAGCTGAGTAATAAGGCTTG
ATAACTCCCCCAAAATAGTTCGAGTTGCAGAAAGGCGGCAAGCTCGAGAATTCCCGGGAG
CTTACATCAGTAAGTGACCGGGATGAGCGAGCGAAGATAACGCATCTGCGGCGCGAAATA
TGAAGGGGGAGAGCCCTTATAGACCAGGTAGTACACGTTTGGTTAGGGGGCCTGCATATG
GCCCCCTTTTTCACTTTTATATCTGTGCGGTTTAATGCCGGGCAGATCACATCTCCGAGG
ATTTTAGAATGGCTGAAATTACCGCATCCCTGGTAAAAGAGCTGCGTGAGCGTACTGGCG
CAGGCATGATGGATTGCAAAAAAGCACTGACTGAAGCTAACGGCGACATCGAGCTGGCAA
TCGAAAACATGCGTAAGTCCGGTGCTATTAAAGCAGCGAAAAAAGCAGGCAACGTTGCTG
CTGACGGCGTGATCAAAACCAAAATCGACGGCAACTACGGCATCATTCTGGAAGTTAACT
GCCAGACTGACTTCGTTGCAAAAGACGCTGGTTTCCAGGCGTTCGCAGACAAAGTTCTGG
ACGCAGCTGTTGCTGGCAAAATCACTGACGTTGAAGTTCTGAAAGCACAGTTCGAAGAAG
AACGTGTTGCGCTGGTAGCGAAAATTGGTGAAAACATCAACATTCGCCGCGTTGCTGCGC
TGGAAGGCGACGTTCTGGGTTCTTATCAGCACGGTGCGCGTATCGGCGTTCTGGTTGCTG
CTAAAGGCGCTGACGAAGAGCTGGTTAAACACATCGCTATGCACGTTGCTGCAAGCAAGC
CAGAATTCATCAAACCGGAAGACGTATCCGCTGAAGTGGTAGAAAAAGAATACCAGGTAC
AGCTGGATATCGCGATGCAGTCTGGTAAGCCGAAAGAAATCGCAGAGAAAATGGTTGAAG
GCCGCATGAAGAAATTCACCGGCGAAGTTTCTCTGACCGGTCAGCCGTTCGTTATGGAAC
CAAGCAAAACTGTTGGTCAGCTGCTGAAAGAGCATAACGCTGAAGTGACTGGCTTCATCC
GCTTCGAAGTGGGTGAAGGCATCGAGAAAGTTGAGACTGACTTTGCAGCAGAAGTTGCTG
CGATGTCCAAGCAGTCTTAATTATCAAAAAGGAGCCGCCTGAGGGCGGCTTCTTTTTGTG
CCCATCTTGTAAATTCAGCTAACCCTTGTGGGGCTGCGCTGAAAAGCGACGTACAATGTC
GCTAGTATTAATTCATTTCAATCGTTGACAGTCTCAGGAAAGAAACATGGCTACCAATGC
AAAACCCGTCTATAAACGCATTCTGCTTAAGTTGAGTGGCGAAGCTCTGCAGGGCACTGA
AGGCTTCGGTATTGATGCAAGCATACTGGATCGTATGGCTCAGGAAATCAAAGAACTGGT
TGAACTGGGTATTCAGGTTGGTGTGGTGATTGGTGGGGGTAACCTGTTCCGTGGCGCTGG
TCTGGCGAAAGCGGGTATGAACCGCGTTGTGGGCGACCACATGGGGATGCTGGCGACCGT
AATGAACGGCCTGGCAATGCGTGATGCACTGCACCGCGCCTATGTGAACGCTCGTCTGAT
GTCCGCTATTCCATTGAATGGCGTGTGCGACAGCTACAGCTGGGCAGAAGCTATCAGCCT
GTTGCGCAACAACCGTGTGGTGATCCTCTCCGCCGGTACAGGTAACCCGTTCTTTACCAC
CGACTCAGCAGCTTGCCTGCGTGGTATCGAAATTGAAGCCGATGTGGTGCTGAAAGCAAC
CAAAGTTGACGGCGTGTTTACCGCTGATCCGGCGAAAGATCCAACCGCAACCATGTACGA
GCAACTGACTTACAGCGAAGTGCTGGAAAAAGAGCTGAAAGTCATGGACCTGGCGGCCTT
CACGCTGGCTCGTGACCATAAATTACCGATTCGTGTTTTCAATATGAACAAACCGGGTGC
GCTGCGCCGTGTGGTAATGGGTGAAAAAGAAGGGACTTTAATCACGGAATAATTCCCGTG
ATGGATAAATAAGGGTAAGATTCCGCGTAAGTATCGCGGGGGCGTAAGTCTGGTTATAAG
GCGTTATTGTTGCAGGCAGTTTGGTCACGGCCAGCGCGCAGCAACCGGAGCGTACAAAAG
TACGTGAGGATGGCGAGCACTGCCCGGGGCCAAAATGGCAAATAAAATAGCCTAATAATC
CAGACGATTACCCGTAATATGTTTAATCAGGGCTATACTTAGCACACTTCCACTGTGTGT
GACTGTCTGGTCTGACTGAGACAAGTTTTCAAGGATTCGTAACGTGATTAGCGATATCAG
AAAAGATGCTGAAGTACGCATGGACAAATGCGTAGAAGCGTTCAAAACCCAAATCAGCAA
AATACGCACGGGTCGTGCTTCTCCCAGCCTGCTGGATGGCATTGTCGTGGAATATTACGG
CACGCCGACGCCGCTGCGTCAGCTGGCAAGCGTAACGGTAGAAGATTCCCGTACACTGAA
AATCAACGTGTTTGATCGTTCAATGTCTCCGGCCGTTGAAAAAGCGATTATGGCGTCCGA
TCTTGGCCTGAACCCGAACTCTGCGGGTAGCGACATCCGTGTTCCGCTGCCGCCGCTGAC
GGAAGAACGTCGTAAAGATCTGACCAAAATCGTTCGTGGTGAAGCAGAACAAGCGCGTGT
TGCAGTACGTAACGTGCGTCGTGACGCGAACGACAAAGTGAAAGCACTGTTGAAAGATAA
AGAGATCAGCGAAGACGACGATCGCCGTTCTCAGGACGATGTACAGAAACTGACTGATGC
TGCAATCAAGAAAATTGAAGCGGCGCTGGCAGACAAAGAAGCAGAACTGATGCAGTTCTG
ATTTCTTGAACGACAAAAACGCCGCTCAGTAGATCCTTGCGGATCGGCTGGCGGCGTTTT
GCTTTTTATTCTGTCTCAACTCTGGATGTTTCATGAAGCAACTCACCATTCTGGGCTCGA
CCGGCTCGATTGGTTGCAGCACGCTGGACGTGGTGCGCCATAATCCCGAACACTTCCGCG
TAGTTGCGCTGGTGGCAGGCAAAAATGTCACTCGCATGGTAGAACAGTGCCTGGAATTCT
CTCCCCGCTATGCCGTAATGGACGATGAAGCGAGTGCGAAACTTCTTAAAACGATGCTAC
AGCAACAGGGTAGCCGCACCGAAGTCTTAAGTGGGCAACAAGCCGCTTGCGATATGGCAG
CGCTTGAGGATGTTGATCAGGTGATGGCAGCCATTGTTGGCGCTGCTGGGCTGTTACCTA
CGCTTGCTGCGATCCGCGCGGGTAAAACCATTTTGCTGGCCAATAAAGAATCACTGGTTA
CCTGCGGACGTCTGTTTATGGACGCCGTAAAGCAGAGCAAAGCGCAATTGTTACCGGTCG
ATAGCGAACATAACGCCATTTTTCAGAGTTTACCGCAACCTATCCAGCATAATCTGGGAT
ACGCTGACCTTGAGCAAAATGGCGTGGTGTCCATTTTACTTACCGGGTCTGGTGGCCCTT
TCCGTGAGACGCCATTGCGCGATTTGGCAACAATGACGCCGGATCAAGCCTGCCGTCATC
CGAACTGGTCGATGGGGCGTAAAATTTCTGTCGATTCGGCTACCATGATGAACAAAGGTC
TGGAATACATTGAAGCGCGTTGGCTGTTTAACGCCAGCGCCAGCCAGATGGAAGTGCTGA
TTCACCCGCAGTCAGTGATTCACTCAATGGTGCGCTATCAGGACGGCAGTGTTCTGGCGC
AGCTGGGGGAACCGGATATGCGTACGCCAATTGCCCACACCATGGCATGGCCGAATCGCG
TGAACTCTGGCGTGAAGCCGCTCGATTTTTGCAAACTAAGTGCGTTGACATTTGCCGCAC
CGGATTATGATCGTTATCCATGCCTGAAACTGGCGATGGAGGCGTTCGAACAAGGCCAGG
CAGCGACGACAGCATTGAATGCCGCAAACGAAATCACCGTTGCTGCTTTTCTTGCGCAAC
AAATCCGCTTTACGGATATCGCTGCGTTGAATTTATCCGTACTGGAAAAAATGGATATGC
GCGAACCACAATGTGTGGACGATGTGTTATCTGTTGATGCGAACGCGCGTGAAGTCGCCA
GAAAAGAGGTGATGCGTCTCGCAAGCTGAGGATAATCCGGCTACAGAGAGTCGCGCTATT
TGTTAGCGTAGGGCTTCAGTGATATAGTCTGCGCCATCTGATCGTAAGTAGTTGGCTTTA
TAAGGTCAGATATGCCGTGGTTTTACACGGCTTTTTTTTGTATAGGCTTCAGTATTCCTG
AGTACCGTAAACCCTGTCAGGGAATAAAAAACGCGTGATGTTGTCTGCTACTCAACCACT
TAGCGAAAAATTGCCAGCGCATGGCTGCCGTCATGTTGCGATCATTATGGACGGCAATGG
CCGCTGGGCAAAAAAGCAAGGGAAGATTCGTGCCTTTGGGCATAAAGCCGGGGCAAAATC
CGTCCGCCGGGCTGTCTCTTTTGCGGCCAACAACGGTATTGAGGCGTTAACGCTGTATGC
CTTTAGTAGTGAAAACTGGAACCGACCAGCGCAGGAAGTCAGTGCGTTAATGGAACTGTT
TGTGTGGGCGCTCGATAGCGAAGTAAAAAGTCTGCACCGACATAACGTGCGTCTGCGTAT
TATTGGCGATACCAGTCGCTTTAACTCGCGTTTGCAAGAACGTATTCGTAAATCTGAAGC
GCTAACAGCCGGGAATACCGGTCTGACGCTGAATATTGCGGCGAACTACGGTGGACGTTG
GGATATAGTCCAGGGAGTCAGGCAACTGGCTGAAAAGGTGCAGCAAGGAAACCTGCAACC
AGATCAGATAGATGAAGAGATGCTAAACCAGCATGTCTGTATGCATGAACTGGCCCCTGT
AGATTTAGTAATTAGGACTGGGGGGGAGCATCGCATTAGTAACTTTTTGCTTTGGCAAAT
TGCCTATGCCGAACTTTACTTTACAGATGTTCTCTGGCCCGATTTCGATGAACAAGACTT
TGAAGGGGCGTTAAATGCCTTTGCTAATCGAGAGCGTCGTTTCGGCGGCACCGAGCCCGG
TGATGAAACAGCCTGATGGGGGTCGCTTTTGCTGAAGTATCGCCTGATATCTGCTTTTGT
GTTAATACCCGTCGTCATCGCGGCGTTGTTTCTGTTGCCGCCGGTGGGGTTCGCCATTGT
AACGCTGGTGGTCTGCATGCTGGCAGCGTGGGAATGGGGACAGCTTAGCGGTTTTACCAC
TCGTTCGCAGCGAGTATGGTTGGCGGTGTTATGCGGGTTATTGTTGGCGCTGATGCTTTT
TCTGTTGCCGGAATATCACCGAAATATTCATCAACCGCTGGTTGAAATCTCACTTTGGGC
TTCGCTGGGTTGGTGGATTGTCGCGCTATTGCTGGTGCTGTTTTACCCAGGTTCCGCAGC
AATCTGGCGTAACTCTAAAACATTGCGCCTTATTTTTGGCGTGCTAACCATTGTTCCCTT
CTTCTGGGGCATGCTGGCGTTACGGGCCTGGCACTATGACGAGAATCATTACAGTGGCGC
AATATGGCTGCTCTATGTCATGATCCTGGTATGGGGCGCTGACTCCGGCGCATATATGTT
TGGCAAATTGTTTGGTAAACATAAGCTGGCACCGAAGGTTTCTCCGGGTAAAACCTGGCA
AGGCTTTATCGGTGGACTCGCTACTGCAGCGGTAATCTCATGGGGTTATGGCATGTGGGC
GAATCTCGACGTCGCTCCCGTCACCTTACTCATTTGCTCTATTGTCGCAGCGTTAGCCTC
AGTGCTCGGCGATCTGACCGAGAGTATGTTTAAGCGTGAAGCAGGAATTAAGGACAGCGG
TCATTTAATTCCAGGACACGGTGGTATTTTAGATCGTATTGATAGCCTGACGGCTGCGGT
ACCGGTCTTTGCTTGCTTGTTGTTACTGGTATTCAGGACGCTTTAACGGAAGGTAATATG
CTGAGTTTTCTCTGGGATTTGGCTTCGTTCATCGTTGCACTGGGTGTACTTATCACCGTG
CATGAATTTGGTCATTTCTGGGTTGCCCGGCGTTGTGGTGTTCGCGTTGAGCGTTTCTCA
ATAGGGTTTGGTAAGGCGCTCTGGCGGCGAACTGATAAGCTCGGCACCGAATATGTTATC
GCCCTGATCCCGTTGGGCGGTTATGTCAAAATGCTGGATGAGCGCGCAGAACCGGTCGTT
CCGGAACTCCGCCACCATGCCTTCAATAATAAATCTGTCGGCCAACGAGCGGCGATTATT
GCCGCAGGTCCGGTTGCAAACTTCATTTTTGCTATCTTTGCCTACTGGCTGGTTTTTATT
ATTGGTGTGCCTGGCGTACGTCCGGTGGTTGGCGAAATAGCAGCCAATTCGATAGCTGCG
GAAGCACAAATTGCACCAGGTACGGAACTAAAAGCCGTAGATGGTATCGAAACGCCTGAT
TGGGATGCCGTGCGTTTGCAGTTGGTCGATAAAATTGGCGATGAAAGCACCACCATTACA
GTAGCGCCATTTGGCAGCGACCAACGGCGGGATGTAAAGCTCGATTTACGTCACTGGGCG
TTTGAGCCTGATAAAGAAGATCCGGTATCTTCGCTGGGGATTCGTCCTCGTGGGCCGCAA
ATTGAACCTGTACTGGAAAATGTGCAGCCAAACTCGGCGGCAAGCAAGGCAGGTTTGCAA
GCAGGCGACAGGATCGTTAAAGTCGATGGTCAGCCCTTAACGCAGTGGGTGACCTTTGTG
ATGCTTGTCCGGGATAACCCGGGTAAATCCTTAGCGTTAGAAATCGAAAGGCAGGGGAGT
CCCTTGTCTTTGACATTAATCCCGGAGAGTAAACCGGGTAATGGTAAAGCGATTGGTTTT
GTCGGTATTGAGCCGAAAGTCATTCCTTTGCCAGATGAGTATAAAGTTGTACGCCAGTAT
GGGCCGTTCAACGCCATCGTCGAAGCCACGGACAAAACGTGGCAGCTGATGAAGCTGACG
GTCAGTATGCTGGGAAAATTGATCACCGGTGATGTGAAACTGAACAACCTCAGTGGGCCG
ATCTCTATCGCCAAGGGGGCTGGGATGACAGCGGAACTCGGGGTTGTTTATTACCTGCCG
TTTCTTGCGCTTATTAGCGTGAACTTAGGGATAATTAACCTGTTTCCGTTGCCCGTACTT
GACGGGGGGCATCTGCTGTTCCTTGCGATCGAAAAGATCAAGGGCGGACCGGTATCCGAG
CGGGTTCAAGACTTTTGTTATCGCATTGGCTCGATTCTGCTGGTGCTGTTAATGGGGCTT
GCACTTTTCAATGATTTCTCTCGGTTATGAGAGTTAGTTAGGAAGAACGCATAATAACGA
TGGCGATGAAAAAGTTGCTCATAGCGTCGCTGCTGTTTAGCAGCGCCACCGTATACGGTG
CTGAAGGGTTCGTAGTGAAAGATATTCATTTCGAAGGCCTTCAGCGTGTCGCCGTTGGTG
CGGCCCTCCTCAGTATGCCGGTGCGCACAGGCGACACGGTTAATGATGAAGATATCAGTA
ATACCATTCGCGCTCTGTTTGCTACCGGCAACTTTGAGGATGTTCGCGTCCTTCGTGATG
GTGATACCCTTCTGGTTCAGGTAAAAGAACGTCCGACCATTGCCAGCATTACTTTCTCCG
GTAACAAATCGGTGAAAGATGACATGCTGAAGCAAAACCTCGAGGCTTCTGGTGTGCGTG
TGGGCGAATCCCTCGATCGCACCACCATTGCCGATATCGAGAAAGGTCTGGAAGACTTCT
ACTACAGCGTCGGTAAATATAGCGCCAGCGTAAAAGCTGTCGTGACCCCGCTGCCGCGCA
ACCGTGTTGACCTAAAACTGGTGTTCCAGGAAGGTGTGTCAGCTGAAATCCAGCAAATTA
ACATTGTTGGTAACCATGCTTTCACCACCGACGAACTGATCTCTCATTTCCAACTGCGTG
ACGAAGTGCCGTGGTGGAACGTGGTAGGCGATCGTAAATACCAGAAACAGAAACTGGCGG
GCGACCTTGAAACCCTGCGCAGCTACTATCTGGATCGCGGTTATGCCCGTTTCAACATCG
ACTCTACCCAGGTCAGTCTGACGCCAGATAAAAAAGGTATTTACGTCACGGTGAACATCA
CCGAAGGCGATCAGTACAAGCTTTCTGGCGTTGAAGTGAGCGGCAACCTTGCCGGGCACT
CCGCTGAAATTGAGCAGCTGACTAAGATCGAGCCGGGTGAGCTGTATAACGGCACCAAAG
TGACCAAGATGGAAGATGACATCAAAAAGCTTCTCGGTCGCTATGGTTATGCCTATCCGC
GCGTACAGTCGATGCCCGAAATTAACGATGCCGACAAAACCGTTAAATTACGTGTGAACG
TTGATGCGGGTAACCGTTTCTACGTGCGTAAGATCCGTTTTGAAGGTAACGATACCTCGA
AAGATGCCGTCCTGCGTCGCGAAATGCGTCAGATGGAAGGTGCATGGCTGGGGAGCGATC
TGGTCGATCAGGGTAAGGAGCGTCTGAATCGTCTGGGCTTCTTTGAAACTGTCGATACCG
ATACCCAACGTGTTCCGGGTAGCCCGGACCAGGTTGATGTCGTCTACAAGGTAAAAGAGC
GCAACACCGGTAGCTTCAACTTTGGTATTGGTTACGGTACTGAAAGTGGCGTGAGCTTCC
AGGCTGGTGTGCAGCAGGATAACTGGTTAGGTACAGGTTATGCTGTTGGTATCAACGGGA
CCAAAAACGATTACCAGACCTATGCTGAACTGTCGGTAACCAACCCGTACTTCACCGTAG
ATGGCGTAAGCCTCGGTGGTCGTCTCTTCTATAATGACTTCCAGGCAGATGACGCCGACC
TGTCCGACTATACCAACAAGAGTTATGGTACAGACGTGACGTTGGGCTTCCCGATTAACG
AATATAACTCGCTGCGTGCAGGTCTGGGTTATGTACATAACTCCCTGTCCAACATGCAGC
CTCAGGTTGCGATGTGGCGTTATCTGTACTCTATGGGTGAACATCCGAGCACCTCTGATC
AGGATAACAGCTTCAAAACGGACGACTTCACGTTCAACTATGGTTGGACCTATAACAAGC
TTGACCGTGGTTACTTCCCGACAGATGGTTCACGTGTCAACCTGACCGGTAAAGTGACCA
TTCCTGGATCGGATAACGAATACTACAAAGTGACGTTAGACACGGCGACTTATGTGCCGA
TCGATGACGATCACAAATGGGTTGTTCTGGGGCGTACCCGCTGGGGTTATGGTGATGGTT
TAGGCGGCAAAGAGATGCCGTTCTACGAGAACTTCTATGCCGGTGGTTCCAGCACCGTGC
GTGGCTTCCAGTCCAATACCATTGGTCCGAAAGCAGTTTACTTCCCGCATCAGGCCAGTA
ATTATGATCCGGACTATGATTACGAATGTGCGACTCAGGACGGCGCGAAAGACCTGTGTA
AATCGGATGATGCTGTAGGCGGTAACGCCATGGCGGTTGCCAGCCTCGAGTTCATCACCC
CGACGCCGTTTATTAGCGATAAGTATGCTAACTCGGTTCGTACTTCCTTCTTCTGGGATA
TGGGTACCGTTTGGGATACAAACTGGGATTCCAGCCAATATTCTGGATATCCGGACTATA
GTGATCCAAGCAATATCCGTATGTCTGCGGGTATCGCATTACAATGGATGTCCCCATTGG
GGCCGTTGGTGTTCTCCTACGCCCAGCCGTTCAAAAAGTACGATGGAGACAAGGCAGAAC
AGTTCCAGTTTAACATCGGTAAAACCTGGTAAGTGTTCTCCACAAAGGAATGTAGTGGTA
GTGTAGCGATGACTTTAGGCGATCAATATAAGATCGCCGGGCCACGCAAAGAACTGCACC
CTCCGGTGCAAATGGGATGGTAAGGAGTTTATTGTGAAAAAGTGGTTATTAGCTGCAGGT
CTCGGTTTAGCACTGGCAACTTCTGCTCAGGCGGCTGACAAAATTGCAATCGTCAACATG
GGCAGCCTGTTCCAGCAGGTAGCGCAGAAAACCGGTGTTTCTAACACGCTGGAAAATGAG
TTCAAAGGCCGTGCCAGCGAACTGCAGCGTATGGAAACCGATCTGCAGGCTAAAATGAAA
AAGCTGCAGTCCATGAAAGCGGGCAGCGATCGCACTAAGCTGGAAAAAGACGTGATGGCT
CAGCGCCAGACTTTTGCTCAGAAAGCGCAGGCTTTTGAGCAGGATCGCGCACGTCGTTCC
AACGAAGAACGCGGCAAACTGGTTACTCGTATCCAGACTGCTGTGAAATCCGTTGCCAAC
AGCCAGGATATCGATCTGGTTGTTGATGCAAACGCCGTTGCTTACAACAGCAGCGATGTA
AAAGACATCACTGCCGACGTACTGAAACAGGTTAAATAAGTAATGCCTTCAATTCGACTG
GCTGATTTAGCGCAGCAGTTGGATGCAGAACTACACGGTGATGGCGATATCGTCATCACC
GGCGTTGCGTCCATGCAATCTGCACAAACAGGTCACATTACGTTCATGGTTAACCCAAAA
TACCGTGAGCATTTAGGCTTGTGCCAGGCGTCCGCGGTTGTCATGACCCAGGACGATCTT
CCTTTCGCGAAAAGTGCCGCACTGGTAGTGAAGAATCCCTACCTGACTTACGCGCGCATG
GCGCAAATTTTAGATACCACGCCGCAGCCCGCGCAGAACATTGCACCCAGTGCGGTGATC
GACGCGACGGCGAAGCTGGGTAACAACGTATCGATTGGCGCTAACGCGGTGATTGAGTCC
GGCGTTGAACTGGGCGATAACGTGATTATCGGTGCCGGTTGCTTCGTAGGTAAAAACAGC
AAAATCGGTGCAGGTTCGCGTCTCTGGGCGAACGTAACCATTTACCATGAGATCCAGATC
GGTCAGAATTGCCTGATCCAGTCCGGAACAGTGGTAGGCGCAGACGGCTTTGGTTATGCC
AACGATCGTGGTAACTGGGTGAAGATCCCACAGATTGGTCGCGTAATTATTGGCGATCGC
GTGGAGATCGGTGCCTGCACAACCATCGATCGCGGCGCGCTGGATGACACTATTATTGGC
AATGGCGTGATCATTGATAACCAGTGCCAGATTGCACATAACGTCGTGATTGGCGACAAT
ACGGCGGTTGCCGGTGGCGTCATTATGGCGGGCAGCCTGAAAATTGGTCGTTACTGCATG
ATCGGCGGAGCCAGCGTAATCAACGGGCATATGGAAATATGCGACAAAGTGACGGTTACG
GGCATGGGTATGGTGATGCGTCCCATCACTGAACCAGGCGTCTATTCCTCAGGCATTCCG
CTGCAACCCAACAAAGTCTGGCGCAAAACCGCTGCACTGGTGATGAACATTGATGACATG
AGCAAGCGTCTGAAATCGCTTGAGCGCAAGGTTAATCAACAAGACTAACGTTCCATCTTT
TGTTCGCCAAACTTTACGGCCTGTCTCATTCTTACGATTGCGGCAGGCCGTGTTATTATT
GTCGTTTCTTATATTTTGACAGGAAGAGTATCTTGACTACTAACACTCATACTCTGCAGA
TTGAAGAGATTTTAGAACTTCTGCCGCACCGTTTCCCGTTCTTACTGGTGGATCGCGTGC
TGGATTTTGAAGAAGGTCGTTTTCTGCGCGCAGTAAAAAATGTCTCTGTCAATGAGCCAT
TCTTCCAGGGCCATTTCCCTGGAAAACCGATTTTCCCGGGTGTGCTGATTCTGGAAGCAA
TGGCACAGGCAACAGGTATTCTGGCGTTTAAAAGCGTAGGAAAACTGGAACCGGGTGAGC
TGTACTACTTCGCTGGTATTGACGAAGCGCGCTTCAAGCGCCCGGTCGTGCCTGGCGATC
AAATGATCATGGAAGTCACTTTCGAAAAAACGCGCCGCGGCCTGACCCGTTTTAAAGGGG
TTGCTCTGGTCGATGGTAAAGTAGTTTGCGAAGCAACGATGATGTGTGCTCGTAGCCGGG
AGGCCTGATACGTGATTGATAAATCCGCCTTTGTGCATCCAACCGCCATTGTGGAAGAGG
GCGCGTCAATTGGCGCGAACGCACACATTGGTCCTTTTTGTATCGTTGGACCCCATGTCG
AAATTGGTGAGGGTACCGTACTGAAATCTCACGTTGTCGTGAATGGTCATACTAAAATTG
GCCGCGATAATGAGATTTATCAGTTCGCCTCCATCGGCGAAGTTAACCAGGATCTGAAAT
ATGCTGGCGAACCGACCCGTGTGGAAATCGGCGATCGTAACCGCATTCGCGAAAGCGTCA
CCATTCATCGTGGCACAGTCCAGGGCGGTGGATTGACGAAGGTGGGCAGCGACAACTTAC
TGATGATCAACGCGCACATTGCGCACGATTGTACGGTAGGTAACCGCTGTATTCTCGCCA
ACAACGCAACGCTGGCGGGTCACGTATCGGTTGACGACTTCGCGATCATCGGCGGCATGA
CCGCAGTCCATCAGTTCTGCATCATTGGTGCGCACGTGATGGTTGGCGGCTGCTCCGGTG
TGGCGCAGGACGTCCCTCCTTATGTCATTGCGCAGGGTAACCACGCAACGCCGTTCGGTG
TCAATATCGAAGGGCTGAAGCGCCGCGGATTCAGCCGTGAGGCGATTACCGCTATCCGCA
ATGCGTATAAGCTGATTTATCGTAGCGGTAAAACGCTCGATGAAGTGAAACCGGAAATTG
CTGAACTGGCGGAAACATATCCGGAAGTGAAAGCCTTTACCGATTTCTTTGCACGCTCAA
CGCGCGGTCTGATTCGTTAATGACTGAACAGCGTCCATTAACGATTGCCCTGGTCGCCGG
AGAAACCTCCGGCGATATCCTGGGGGCCGGTTTAATCCGCGCTCTGAAAGAACATGTGCC
CAACGCCCGCTTTGTTGGTGTTGCCGGGCCACGAATGCAGGCTGAAGGCTGCGAAGCCTG
GTACGAAATGGAAGAACTGGCGGTGATGGGCATTGTTGAAGTGCTCGGTCGTCTGCGTCG
CTTACTGCATATTCGTGCCGATCTGACAAAGCGTTTTGGCGAACTGAAGCCAGATGTTTT
TGTTGGTATTGATGCGCCTGACTTCAATATTACTCTTGAAGGTAACCTCAAAAAGCAGGG
TATCAAAACCATTCATTACGTCAGTCCGTCAGTCTGGGCGTGGCGACAGAAACGTGTTTT
CAAAATAGGCAGAGCCACCGATCTGGTGCTCGCATTTCTGCCTTTCGAAAAAGCGTTTTA
TGACAAATACAACGTACCGTGCCGCTTTATCGGTCATACCATGGCTGATGCCATGCCATT
AGATCCAGATAAAAATGCCGCCCGTGATGTGCTGGGGATCCCTCACGATGCCCACTGCCT
GGCGTTGCTACCGGGGAGCCGTGGTGCAGAAGTTGAAATGCTTAGTGCCGATTTCCTGAA
AACGGCCCAGCTTTTGCGCCAGACATATCCGGATCTCGAAATCGTGGTGCCACTGGTGAA
TGCCAAACGCCGCGAGCAGTTTGAACGCATCAAAGCTGAAGTCGCGCCAGACCTTTCAGT
TCATTTGCTGGATGGGATGGGCCGTGAGGCGATGGTCGCCAGCGATGCGGCGCTACTGGC
GTCGGGTACGGCAGCCCTGGAGTGTATGCTGGCGAAATGCCCGATGGTGGTGGGATATCG
CATGAAGCCTTTTACCTTCTGGTTGGCGAAGCGGCTGGTGAAAACTGATTATGTCTCGCT
GCCAAATCTGCTGGCGGGCAGAGAGTTAGTCAAAGAATTATTGCAGGAAGAGTGTGAGCC
GCAAAAACTGGCTGCGGCGCTGTTACCGCTGTTGGCGAACGGGAAAACCAGCCACGCGAT
GCACGATACCTTCCGTGAACTGCATCAGCAGATCCGCTGCAATGCCGATGAGCAGGCGGC
ACAAGCCGTTCTGGAGTTAGCACAATGATCGAATTTGTTTATCCGCACACGCAGCTGGTT
GCGGGTGTGGATGAAGTCGGACGCGGGCCGTTAGTTGGCGCGGTCGTCACCGCTGCGGTG
ATCCTTGACCCGGCGCGCCCGATTGCCGGGCTGAATGATTCCAAAAAGCTGAGCGAAAAA
CGCCGTCTGGCGCTCTATGAAGAGATCAAAGAGAAAGCGTTGAGCTGGAGTCTGGGCCGC
GCGGAACCCCACGAAATCGACGAGCTGAACATTCTTCATGCGACCATGCTGGCGATGCAG
CGTGCCGTCGCTGGGCTGCATATTGCGCCGGAATATGTGTTGATTGATGGTAACCGCTGC
CCGAAATTACCGATGCCTGCGATGGCTGTGGTGAAAGGCGATAGCCGCGTACCGGAAATC
AGTGCCGCGTCTATCCTGGCGAAAGTGACGCGTGACGCCGAAATGGCGGCGCTGGATATT
GTTTTCCCGCAATATGGTTTTGCCCAACACAAAGGGTACCCAACCGCTTTTCATCTGGAA
AAACTGGCTGAACACGGCGCGACCGAACACCATCGGCGCAGCTTTGGGCCTGTCAAACGC
GCACTGGGACTTGCGTCCTGATTCTTGTGTCGAGATTAAGTAAACCGGAATCTGAAGATG
TCTGAACCACGTTTCGTACACCTGCGGGTGCACAGCGACTACTCGATGATCGATGGCCTG
GCCAAAACCGCACCGTTGGTAAAAAAGGCGGCGGCGTTGGGTATGCCAGCACTGGCGATC
ACCGATTTCACCAACCTTTGTGGTCTGGTGAAGTTCTACGGAGCGGGACATGGCGCAGGG
ATTAAGCCTATCGTCGGGGCAGATTTTAACGTCCAGTGCGACCTGCTGGGTGATGAGTTA
ACCCACCTGACGGTACTGGCGGCGAACAATACCGGCTATCAGAATCTGACGTTGCTGATC
TCAAAAGCGTATCAGCGCGGGTACGGTGCCGCCGGGCCGATCATCGATCGCGACTGGCTT
ATCGAATTAAACGAAGGGTTGATCCTTCTTTCCGGCGGACGCATGGGCGACGTCGGACGC
AGTCTTTTGCGTGGTAACAGCGCGCTGGTAGATGAGTGTGTCGCGTTTTATGAAGAACAC
TTCCCGGATCGCTATTTTCTCGAGCTGATCCGCACCGGCAGGCCGGATGAAGAAAGCTAT
CTGCACGCGGCGGTGGAACTGGCGGAAGCGCGCGGTTTGCCCGTCGTGGCGACCAACGAC
GTGCGCTTTATCGACAGCAGCGACTTTGACGCACACGAAATCCGCGTCGCGATCCACGAC
GGCTTTACCCTCGACGATCCTAAACGCCCGCGTAACTATTCGCCGCAGCAATATATGCGT
AGCGAAGAGGAGATGTGTGAGCTGTTTGCCGACATCCCCGAAGCCCTTGCCAACACCGTT
GAGATCGCCAAACGCTGTAACGTAACCGTGCGTCTTGGTGAATACTTCCTGCCGCAGTTC
CCGACCGGGGACATGAGCACCGAAGATTATCTGGTCAAGCGTGCAAAAGAGGGCCTGGAA
GAGCGTCTGGCCTTTTTATTCCCTGATGAGGAAGAACGTCTTAAGCGCCGCCCGGAATAT
GACGAACGTCTGGAGACTGAACTTCAGGTTATCAACCAGATGGGCTTCCCGGGCTACTTC
CTCATCGTTATGGAATTTATCCAGTGGTCGAAAGATAACGGCGTACCGGTAGGGCCAGGC
CGTGGCTCCGGTGCGGGTTCACTGGTGGCCTACGCGCTGAAAATCACCGACCTCGATCCG
CTGGAATTTGACCTGCTGTTCGAACGTTTCCTTAACCCGGAACGTGTCTCCATGCCTGAC
TTCGACGTTGACTTCTGTATGGAGAAACGCGATCAGGTTATCGAGCACGTAGCGGACATG
TACGGTCGTGATGCGGTATCGCAGATCATCACCTTCGGTACAATGGCGGCGAAAGCGGTG
ATCCGCGACGTAGGCCGCGTGCTGGGGCATCCGTACGGCTTTGTCGATCGTATCTCGAAA
CTGATCCCGCCCGATCCGGGGATGACGCTGGCGAAAGCGTTTGAAGCCGAGCCGCAGCTG
CCGGAAATCTACGAAGCGGATGAAGAAGTTAAGGCGCTGATCGACATGGCGCGCAAACTG
GAAGGGGTCACCCGTAACGCCGGTAAGCACGCCGGTGGGGTGGTTATCGCGCCGACCAAA
ATTACCGATTTTGCGCCGCTTTACTGCGATGAAGAGGGCAAACATCCGGTCACCCAGTTT
GATAAAAGCGACGTTGAATACGCCGGACTGGTGAAGTTCGACTTCCTTGGTTTGCGTACG
CTCACCATCATCAACTGGGCGCTGGAGATGATCAACAAGCGGCGGGCGAAGAATGGCGAG
CCGCCGCTGGATATCGCTGCGATCCCGCTGGATGATAAGAAAAGCTTCGACATGCTGCAA
CGCTCGGAAACCACGGCGGTATTCCAGCTTGAATCGCGCGGCATGAAGGACCTGATCAAG
CGTCTACAACCTGACTGCTTCGAAGATATGATCGCCCTAGTGGCACTGTTCCGCCCCGGT
CCGTTGCAATCAGGGATGGTGGATAACTTTATCGACCGTAAACATGGTCGTGAAGAGATC
TCCTATCCGGACGTACAGTGGCAGCATGAAAGCCTGAAACCGGTACTGGAGCCAACCTAC
GGCATTATCCTGTATCAGGAACAGGTCATGCAGATTGCGCAGGTGCTTTCTGGTTATACC
CTCGGTGGCGCGGATATGCTGCGTCGTGCGATGGGTAAGAAAAAGCCGGAAGAGATGGCT
AAGCAACGTTCTGTATTTGCTGAAGGTGCAGAAAAGAACGGAATCAACGCTGAACTGGCG
ATGAAAATCTTCGACCTGGTGGAGAAATTCGCTGGTTACGGATTTAACAAATCGCACTCT
GCGGCCTATGCTTTGGTGTCATATCAAACGTTATGGCTGAAAGCGCACTATCCTGCGGAG
TTTATGGCGGCGGTAATGATGCTGGCGGATGGGGCTGAAAATCCTGCCACCAGATATAAA
CTCCGGTCTTTACCATTTCCACGTCAACGACGACGGCGAAATCGTGTATGGTATTGGCGC
GATCAAAGGGGTCGGTGAAGGTCCGATTGAGGCCATCATCGAAGCCCGTAATAAAGGCGG
CTACTTCCGCGAACTGTTTGATCTCTGCGCCCGTACCGACACCAAAAAGTTGAACCGTCG
CGTGCTGGAAAAACTGATCATGTCCGGGGCGTTTGACCGTCTTGGGCCACATCGCGCAGC
GCTGATGAACTCGCTGGGCGATGCGTTAAAAGCGGCAGATCAACACGCGAAAGCGGAAGC
TATCGGTCAGGCCGATATGTTCGGCGTGCTGGCCGAAGAGCCGGAACAAATTGAACAATC
CTACGCCAGCTGCCAACCGTGGCCGGAGCAGGTGGTATTAGATGGGGAACGTGAAACGTT
AGGCCTGTACCTGACCGGACACCCTATCAACCAGTATTTAAAAGAGATTGAGCGTTATGT
CGGAGGCGTAAGGCTGAAAGACATGCACCCGACAGAACGTGGTAAAGTCATCACGGCTGC
GGGGCTCGTTGTTGCCGCGCGGGTTATGGTCACCAAGCGCGGCAATCGTATCGGTATCTG
CACGCTGGATGACCGTTCCGGGCGGCTGGAAGTGATGTTGTTTACTGACGCCCTGGATAA
ATACCAGCAATTGCTGGAAAAAGACCGCATACTTATCGTCAGCGGACAGGTCAGCTTTGA
TGACTTCAGCGGTGGGCTTAAAATGACCGCTCGCGAAGTGATGGATATTGACGAAGCCCG
GGAAAAATATGCTCGCGGGCTTGCTATCTCGCTGACGGACAGGCAAATTGATGACCAGCT
TTTAAACCGACTCCGTCAGTCTCTGGAACCCCACCGCTCTGGGACAATTCCAGTACATCT
CTACTATCAGAGGGCGGATGCACGCGCGCGGTTGCGTTTTGGCGCGACGTGGCGTGTCTC
TCCGAGCGATCGTTTATTAAACGATCTCCGTGGCCTCATTGGTTCGGAGCAGGTGGAACT
GGAGTTTGACTAATACAGGAATACTATGAGTCTGAATTTCCTTGATTTTGAACAGCCGAT
TGCAGAGCTGGAAGCGAAAATCGATTCTCTGACTGCGGTTAGCCGTCAGGATGAGAAACT
GGATATTAACATCGATGAAGAAGTGCATCGTCTGCGTGAAAAAAGCGTAGAACTGACACG
TAAAATCTTCGCCGATCTCGGTGCATGGCAGATTGCGCAACTGGCACGCCATCCACAGCG
TCCTTATACCCTGGATTACGTTCGCCTGGCATTTGATGAATTTGACGAACTGGCTGGCGA
CCGCGCGTATGCAGACGATAAAGCTATCGTCGGTGGTATCGCCCGTCTCGATGGTCGTCC
GGTGATGATCATTGGTCATCAAAAAGGTCGTGAAACCAAAGAAAAAATTCGCCGTAACTT
TGGTATGCCAGCGCCAGAAGGTTACCGCAAAGCACTGCGTCTGATGCAAATGGCTGAACG
CTTTAAGATGCCTATCATCACCTTTATCGACACCCCGGGGGCTTATCCTGGCGTGGGCGC
AGAAGAGCGTGGTCAGTCTGAAGCCATTGCACGCAACCTGCGTGAAATGTCTCGCCTCGG
CGTACCGGTAGTTTGTACGGTTATCGGTGAAGGTGGTTCTGGCGGTGCGCTGGCGATTGG
CGTGGGCGATAAAGTGAATATGCTGCAATACAGCACCTATTCCGTTATCTCGCCGGAAGG
TTGTGCGTCCATTCTGTGGAAGAGCGCCGACAAAGCGCCGCTGGCGGCTGAAGCGATGGG
TATCATTGCTCCGCGTCTGAAAGAACTGAAACTGATCGACTCCATCATCCCGGAACCACT
GGGTGGTGCTCACCGTAACCCGGAAGCGATGGCGGCATCGTTGAAAGCGCAACTGCTGGC
GGATCTGGCCGATCTCGACGTGTTAAGCACTGAAGATTTAAAAAATCGTCGTTATCAGCG
CCTGATGAGCTACGGTTACGCGTAATTCGCAAAAGTTCTGAAAAAGGGTCACTTCGGTGG
CCCTTTTTTATCGCCACGGTTTGAGCAGGCTATGATTAAGGAAGGATTTTCCAGGAGGAA
CACATGAACATCATTGCCATTATGGGACCGCATGGCGTCTTTTATAAAGATGAGCCCATC
AAAGAACTGGAGTCGGCGCTGGTGGCGCAAGGCTTTCAGATTATCTGGCCACAAAACAGC
GTTGATTTGCTGAAATTTATCGAGCATAACCCTCGAATTTGCGGCGTGATTTTTGACTGG
GATGAGTACAGTCTCGATTTATGTAGCGATATCAATCAGCTTAATGAATATCTCCCGCTT
TATGCCTTCATCAACACCCACTCGACGATGGATGTCAGCGTGCAGGATATGCGGATGGCG
CTCTGGTTTTTTGAATATGCGCTGGGGCAGGCGGAAGATATCGCCATTCGTATGCGTCAG
TACACCGACGAATATCTTGATAACATTACACCGCCGTTCACGAAAGCCTTGTTTACCTAC
GTCAAAGAGCGGAAGTACACCTTTTGTACGCCGGGGCATATGGGCGGCACCGCATATCAA
AAAAGCCCGGTTGGCTGTCTGTTTTATGATTTTTTCGGCGGGAATACTCTTAAGGCTGAT
GTCTCTATTTCGGTCACCGAGCTTGGTTCGTTGCTCGACCACACCGGGCCACACCTGGAA
GCGGAAGAGTACATCGCGCGGACTTTTGGCGCGGAACAGAGTTATATCGTTACCAACGGA
ACATCGACGTCGAACAAAATTGTGGGTATGTACGCCGCGCCATCCGGCAGTACGCTGTTG
ATCGACCGCAATTGTCATAAATCGCTGGCGCATCTGTTGATGATGAACGATGTAGTGCCA
GTCTGGCTGAAACCGACGCGTAATGCGTTGGGGATTCTTGGTGGGATCCCGCGCCGTGAA
TTTACTCGCGACAGCATCGAAGAGAAAGTCGCTGCTACCACGCAAGCACAATGGCCGGTT
CATGCGGTGATCACCAACTCCACCTATGATGGCTTGCTCTACAACACCGACTGGATCAAA
CAGACGCTGGATGTCCCGTCGATTCACTTCGATTCTGCCTGGGTGCCGTACACCCATTTT
CATCCGATCTACCAGGGTAAAAGTGGTATGAGCGGCGAGCGTGTTGCGGGAAAAGTGATC
TTCGAAACGCAATCGACCCACAAAATGCTGGCGGCGTTATCGCAGGCTTCGCTGATCCAC
ATTAAAGGCGAGTATGACGAAGAGGCCTTTAACGAAGCCTTTATGATGCATACCACCACC
TCGCCCAGTTATCCCATTGTTGCTTCGGTTGAGACGGCGGCGGCGATGCTGCGTGGTAAT
CCGGGCAAACGGCTGATTAACCGTTCAGTAGAACGAGCTCTGCATTTTCGCAAAGAGGTC
CAGCGGCTGCGGGAAGAGTCTGACGGTTGGTTTTTCGATATCTGGCAACCGCCGCAGGTG
GATGAAGCCGAATGCTGGCCCGTTGCGCCTGGCGAACAGTGGCACGGCTTTAACGATGCG
GATGCCGATCATATGTTTCTCGATCCGGTTAAAGTCACTATTTTGACACCGGGGATGGAC
GAGCAGGGCAATATGAGCGAGGAGGGGATCCCGGCGGCGCTGGTAGCAAAATTCCTCGAC
GAACGTGGGATCGTAGTAGAGAAAACCGGCCCTTATAACCTGCTGTTTCTCTTTAGTATT
GGCATCGATAAAACCAAAGCAATGGGATTATTGCGTGGGTTGACGGAATTCAAACGCTCT
TACGATCTCAACCTGCGGATCAAAAATATGCTACCCGATCTCTATGCAGAAGATCCCGAT
TTCTACCGCAATATGCGTATTCAGGATCTGGCACAAGGGATCCATAAGCTGATTCGTAAA
CACGATCTTCCCGGTTTGATGTTGCGGGCATTCGATACTTTGCCGGAGATGATCATGACG
CCACATCAGGCATGGCAACGACAAATTAAAGGCGAAGTAGAAACCATTGCGCTGGAACAA
CTGGTCGGTAGAGTATCGGCAAATATGATCCTGCCTTATCCACCGGGCGTACCGCTGTTG
ATGCCTGGAGAAATGCTGACCAAAGAGAGCCGCACAGTACTCGATTTTCTACTGATGCTT
TGTTCCGTCGGGCAACATTACCCCGGTTTTGAAACGGATATTCACGGCGCGAAACAGGAC
GAAGACGGCGTTTACCGCGTACGAGTCCTAAAAATGGCGGGATAACTTGCCAGAGCGGCT
TCCGGGCGAGTAACGTGCTGTTAACAAATAAAGGAGACGTTATGCTGGGTTTAAAACAGG
TTCACCATATTGCGATTATTGCGACGGATTATGCGGTGAGCAAAGCTTTCTACTGCGATA
TTCTTGGTTTCACGCTGCAAAGCGAAGTCTATCGCGAAGCGCGCGACTCATGGAAAGGGG
ATTTGGCGCTTAATGGGCAATATGTGATTGAGCTTTTCTCATTTCCGTTCCCGCCGGAAC
GACCCAGCCGACCGGAAGCTTGCGGTCTGCGTCATCTGGCTTTTAGCGTTGATGACATCG
ATGCGGCAGTGGCGCACCTTGAAAGCCATAACGTGAAGTGTGAAACCATCCGTGTCGATC
CATACACGCAAAAACGCTTCACCTTCTTTAACGATCCGGACGGGCTGCCGTTGGAACTGT
ATGAGCAGTAAGGCTTGTCATCGCCGCATTTGCCCGGTAACGTGCCGGGCATTGCTACTG
TAAAATCGCACCATCATGACACTCACGCTCAATAGACAACTTCTCACCTCACGCCAGATT
CTGGTGGCCTTTAGCGGCGGGCTTGACTCCACCGTTCTGCTGCATCAGTTGGTGCAGTGG
CGGACGGAAAATCCGGGTGTCGCTCTGCGCGCTATTCATGTGCATCACGGTTTAAGTGCC
AATGCCGATGCCTGGGTTACGCATTGCGAAAACGTCTGCCAACAGTGGCAGGTGCCGCTG
GTGGTCGAACGCGTACAACTTGCGCAAGAAGGACTGGGCATTGAGGCCCAGGCGCGGCAG
GCACGTTATCAGGCATTTGCCCGCACCTTGTTGCCCGGTGAAGTGCTGGTCACCGCGCAA
CATCTCGACGATCAATGTGAAACCTTTCTGCTGGCGCTAAAACGCGGCAGTGGCCCTGCC
GGGCTTTCGGCTATGGCGGAAGTCTCGGAGTTTGCCGGAACGCGGCTTATTCGCCCGTTG
CTCGCCCGCACGCGGGGGGAACTGGTGCAGTGGGCGCGTCAGTATGATTTACGCTGGATT
GAAGACGAAAGTAATCAGGACGACTCATACGATCGTAACTTTCTGCGCCTGCGCGTAGTG
CCGTTATTGCAGCAGCGTTGGCCGCATTTTGCCGAAGCAACGGCCCGCAGCGCCGCACTT
TGTGCTGAACAAGAGAGCCTGCTGGATGAACTGCTGGCAGATGATTTAGCACACTGTCAA
TCGCCGCAGGGGACGCTGCAGATTGTGCCAATGCTGGCGATGAGTGATGCCCGCCGCGCG
GCGATTATCCGCCGCTGGCTGGCAGGGCAGAATGCACCGATGCCTTCCCGCGACGCGTTG
GTGAGGATCTGGCAGGAAGTGGCGCTGGCGCGGGAAGATGCCTCACCCTGTTTACGTTTG
GGCGCGTTTGAAATCCGACGCTATCAGTCGCAACTGTGGTGGATTAAATCCGTCACCGGG
CAAAGCGAAAACATTGTGCCGTGGCAGACGTGGCTTCAACCGCTGGAATTACCGGCGGGG
CTGGGAAGTGTACAGCTTAATGCGGGAGGCGATATTCGCCCTCCGCGTGCAGACGAAGCG
GTCAGCGTGCGTTTCAAAGCGCCAGGATTGCTGCATATTGTCGGGCGTAACGGCGGACGT
AAGCTAAAGAAAATCTGGCAAGAGCTGGGCGTGCCGCCGTGGCTACGTGACACCACGCCA
CTGCTGTTTTATGGCGAAACGCTGATTGCGGCGGCAGGGGTATTTGTGACGCAAGAAGGT
GTGGCTGAAGGTGAGAATGGCGTAAGTTTTGTCTGGCAGAAAACGCTTAGTTAAGTGAAA
GCCGGATAAGACGCATCAAACGTCGCATCCGGCGAAAGTCAATCAGGATTCGCTTACCAC
CACCGTACCGATTTCCGGGTGGCTAAAGCTGGTAATTTTATCCAGACGCAGCTCGCGGGT
TTCGCCAGCGGCCTCGACGACCAGGTACTCCACATTTTTGCGGGAGACTAAATCACTGGC
TTTTGCCTGCAATTTTTCGCCATCTTTCAGCTCAAGTGTCAGCATTAAATGATGCTGGCA
GGCGAGCTCAAGATTATCGTAATCATCACAATTGATTGGTTGATACGTATCATTCATTGA
CATAATCGCTCACCAGTAAGTTTGCCGCAGCGTATGCTGCTTTTTCCCTGACAGCCTCAG
AAAGGGCGTCGTCGGCAGCCATTTCATTCAGCACTTTCAAAACGCAGCCCAGCGCGTCCG
GAACGTATCCTAAGTCTCCGCTGGCGATTTCCGCGTACCGCTTGCGTATTAACTCACAAT
ATTTTTCCACATGCCCTCCTGTCAGCACTCTGACTTAACCGTGGATGCAAGTCTAAGCCT
ACGAAGATAAACTCTGTTTCGCAAGGTGACTATACCACACTCATTTCTGCAATATCAGCG
CCGCAACTGCACGTATTCCGTTACAATGGCCTCCTGATTCGAAAGGAGTTTTCTTATGGC
GCTTAAAGCGACAATTTATAAAGCGACGGTTAATGTGGCCGATCTCGACCGCAACCAGTT
TCTCGATGCCTCTCTGACGCTGGCGCGCCATCCTTCAGAAACCCAGGAGCGTATGATGCT
GCGCTTGCTGGCGTGGCTGAAATATGCTGATGAACGTCTGCAATTTACCCGTGGTTTGTG
TGCCGATGATGAGCCGGAAGCGTGGCTGCGTAACGATCACCTGGGCATTGATTTGTGGAT
TGAGCTGGGGCTGCCGGATGAGCGGCGGATTAAGAAAGCCTGCACCCAGGCCGCAGAAGT
GGCGCTGTTTACCTATAATAGTCGGGCGGCGCAAATCTGGTGGCAGCAAAATCAGAGCAA
ATGTGTGCAGTTTGCCAATCTTTCCGTCTGGTATCTGGACGATGAACAACTGGCGAAAGT
AAGCGCCTTTGCCGATCGTACCATGACGCTGCAGGCAACGATTCAGGATGGCGTGATCTG
GTTATCGGATGATAAGAATAATCTGGAAGTGAACTTAACCGCCTGGCAACAACCTTCATG
ATTGTGATTTCCCGACATGTTGCTATTCCCGATGGTGAGCTTGAGATCACCGCCATTCGT
GCGCAGGGCGCGGGCGGGCAGCATGTTAATAAGACCTCAACGGCTATTCATCTGCGTTTT
GACATTCGGGCGTCCAGCCTGCCAGAGTATTACAAAGAGCGTCTGCTCGCCGCCAGCCAT
CATTTGATCAGCAGTGATGGCGTGATTGTCATTAAGGCACAGGAATACCGCAGTCAGGAA
CTGAACCGCGAAGCAGCTCTGGCCCGGCTGGTGGCTATGATTAAAGAATTAACAACAGAA
AAAAAAGCCCGACGACCCACGCGGCCCACCCGTGCATCGAAAGAGCGCAGGCTGGCATCG
AAAGCACAAAAATCAAGCGTGAAGGCGATGCGCGGCAAAGTGCGCAGCGGTCGGGAATAA
AAAGAAGGAATGGATGGTGAAAAAAGCGATAGTGACAGCGATGGCTGTAATCAGCCTCTT
TACTCTGATGGGATGTAATAATCGGGCCGAAGTCGATACGCTTTCTCCGGCGCAGGCTGC
CGAACTGAAACCGATGCCGCAAAGTTGGCGCGGCGTGCTGCCGTGTGCCGATTGCGAAGG
AATCGAAACCTCTCTGTTCCTCGAAAAAGACGGAACATGGGTGATGAATGAGCGTTATCT
CGGTGCTCGTGAAGAACCTTCCTCCTTCGCTTCCTACGGTACATGGGCGCGAACCGCTGA
CAAGCTGGTATTAACCGACAGCAAAGGTGAAAAGTCATATTATCGGGCGAAAGGCGATGC
GCTGGAGATGCTCGATCGTGAAGGCAATCCGATTGAATCGCAGTTCAACTATACGCTGGA
AGCGGCACAATCCAGTTTACCTATGACGCCGATGACCCTGCGGGGCATGTATTTTTATAT
GGCTGATGCGGCGACCTTCACTGATTGCGCGACCGGAAAACGTTTCATGGTAGCGAATAA
CGCAGAGCTGGAGCGTAGCTACCTGGCTGCGCGCGGTCACAGTGAAAAACCGGTGTTACT
GTCAGTAGAAGGTCACTTTACGCTTGAGGGTAATCCGGATACCGGTGCGCCGACTAAAGT
ATTGGCACCCGATACGGCAGGGAAATTTTACCCCAACCAGGATTGCAGTAGTTTGGGGCA
GTAACCCGTCTTGAGACAGAAACAAACGCAAAACAGGCCAGAAGGATATATTTCAACATT
TTGAATTTGCACGTTTTTTGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCAATGGTG
CTCAACGCCTGATGCGACGCTGGCGCGTCTTATCATGCCTACAACCCCCCTCATACCTTA
AGGCGGATAAGGCATTTACTTTATCACCGGGTCAAACCAACAAAGCGACCCGCCTTGATA
TAAATCCCAGGCTTCAGGTGCCCAACATACTGTAACTGCGTTTCTGGCTTAAACGCAGAG
ACATCACCAATACGCATATGCATCAGATCGGCAGGGCTAATCCAGCCCGATTGCGCCAGT
GTAAGTGGATGCCCGGCTTTGGCAAAGGCATCCGTGACAAATTCCGAACAAAACCACGAC
TTTTTGTCTCCTTCGCCCACACTGCTTAACTGCGCTTTCGCCAGGCCGCTGACGCACTGT
TGGCGAAAATCCTCGGAGAACGGATTCAGTGAGCACATCTGGCGAGTCACCATAAAGGGA
ATAAATTCGACAATGCCGCGATAGTTATAACCGCTATCTTTGATTTTATTGGCAAACGCG
GTGATATCTGTGGCTTGTTGCGGGGTAAGATCCGGGACTCGTAAGACGAAAAGCTTATCA
CTATGCTTCATCGCTTTTTTAAGGGAAACGATCTGGACGCCAGCGCCTGTCGCTTCTGCA
ACGTTATTATCACCCAGAAAGATTGCAACGTGACTCACAGAGGAAGTGCTGAAGACGCGG
ATTCCAAATGAGGTTACCCCAAGGCTTGAGGAGAACAGCAAATCGCCGGGTTTGAGATCA
GGTGCCGTTATTTCTTTTATTGATTGTTCGGTGAAAGAGCTTTGATGCTGGAATTTGACA
GCCCATGTTTTTGCCTCGGCATCTACTGCTGTGGCTGATGGGTCTGGCTGGCTGATATCA
ACGGTACAAGCCGAAAGTAAAAGAAAGCTGGGGAGAAACAGGCGGCAGTACGCCTTTGGT
TTATCCATTTTATACAATCCATGTAAAAAAAGGGCCCTGAAATTCAGGACCCTTTCTGGC
ATCAGCCTTTAATCTGTTTCACCAGATATTCGACGATGTCACCAGTCTTAATTAACTGTT
TCTCGCCGTTGCGACGATATTTATATTCGATATCGTCGTTGTCGAGGTTACGGTCGCCCA
GCACAATAGTGTGCGGAATACCGATCAGTTCCATATCAGCAAACATCACGCCCGGACGCT
CTTTGCGGTCATCCAGCAGCACTTCGATACCTTGTGCACGCAGTTCGCTGTACAGTTTCT
CAGCAAGCTCTTGTACGCGGAAGGATTTGTGCATGTTCATCGGCAGAATCGCCACCTGGA
ACGGCGCGATAGCGTCAGGCCATACGATGCCTCGTTCGTCGTAGTTCTGCTCAATCGCCG
CAGCTACCACACGCGTTACCCCGATACCGTAGCAACCCATCGTCAGGATTTGGTTACGGC
CATCTTCACCCTGTACGGAGGCTTTCAGTGCTTCGGAGTACTTGGTACCCAGCTGGAAGA
TGTGACCAACTTCGATACCACGTTTGATCAGCAGCCTACCCTGGCCATCCGGGCTTGGAT
CGCCAGCCACCACGTTACGGATATCTGCAACTTCCGGGGTAGCGACATCGCGATCCCAGT
TGATGCCGAAGTAGTGTTTACCATCGATGTTAGCACCAGCAGCGAAATCACTCATCGCCG
CAACGGTACGGTCAATCACCACCGGAATCGGCATGTTTACCGGACCCAGTGAACCCGGAC
CGGCTTTAACCACGGCACGAATTTCTTCTTCGGTCGCGAAAGTCAGCGGGCTTGCAACCT
GCGGCAGTTTTTCTGCTTTAACTTCGTTCAGCTCGTGATCACCGCGCACCAGCAGCGCAA
CCTGCGGGAAGCTGCTGCCTTCAACCGCTTTAACCAGCAGAGTCTTAACCGTTTTCTCAA
TCGGCAGATTGAACTGTTCAACCAGTTCCGCGATGGTTTTCGCGTTCGGCGTATCAACCA
GCGTCATTTCCTGGGTAGCAGCAGCGCGCGGTTCTTTCGGCGCGATAGCTTCTGCCAGTT
CAATGTTCGCTGCATAGTCAGAGGTGTCGGAGAAGACCACATCGTCTTCACCGCTCTGCG
CCAGCACCTGGAATTCGTGAGAGGCGCTGCCGCCGATAGAACCGGTGTCGGCTTGTACGG
CGCGGAAATCCAGCCCCATGCGGCTGAAGATTTTGCTGTAGGCCGCATACATTGCATCGT
AGGTTTCCTGCAGGGATTCCTGAGAAGTATGGAAAGAGTAAGCATCTTTCATCAGGAATT
CGCGGGAACGCATGACGCCGAAACGCGGACGCACTTCGTCGCGGAACTTGGTCTGGATCT
GATAGAAGTTCAGCGGCAGCTGTTTGTAAGAGCTAAGCTCGTTACGAATCAGGTCAGTGA
TAACTTCTTCATGAGTTGGGCCGAGTACGAACGGACGCTCGCCACGGTCAACAAAACGCA
GCAGTTCCGGACCGTACTGTTCCCAACGACCACTCTCTTGCCACAAATCGGCTGGCTGAA
CCACCGGCATCGACACCTCGATCGCACCGGCGTTGTTCATCTCTTCACGCACGATGTTTT
CGACTTTTTTCAGAACGCGCACGCCGGTCGGCAGCCAGGTATATAACCCGGAGGCCAGCT
TGCGGATCATCCCGGCGCGCAGCATCAGCTGATGGCTGATCACCTCGGCGTCGGCAGGTG
TCTCCTTGAGAGTGGAGAGCAGGTATTGGCTAGTACGCATGTTGTTACGGTTCCAGTTGG
AAGGTAGAACAGGCTCAAGGCGAGCCTGGGACAAAAAAAAGTGATTTAGTTTACCAGTGC
AAAAGAAATGTCAAAAGAGAAGGGCGTGAATTTAACGCGGTTCCAGCGCAAAGACTTCAA
AACCTGCGTCGGTGACGCGCCAGCGAACGTTAAAATCATGTAGCCAGACGGCATAGGTTT
TGCCCGTTTCCTCACCTTTACGATAGGCCGGGCGCGGGTCCTGCGCCAGTACTTCGCGGA
TAAACAGCGTTAACTGCGGATAACGCTTCTCCAGCGTCAAAAGCTGCTTTTCGACCTCTG
CGGTAAAACTCACCGCCATCTCTGCAGCTGGCGCACTTTGCGCATAGCTGGCACTGGCAT
CGGGAAGCGATTCGGCAAAGGGGAGATACGGTTTGATATCCACTACCGGCGTACCATCGA
CCAGATCCAGACTGCCGAGCTTCAGAATCACGCTGTCTTTATGGCAAACAACCTCTTTCA
GCTCTACCAGCGACATGCCAATTGGGTTAGGGCGGAAAGTAGAGCGTGTTGCGAAAACCC
CCATTCTGGCGTTACCGCCGAGGCGCGGTGGACGCACAGTCGGACGCCAGCCGCCTTCCA
TCGTTTGATGAAAGACGAAAAGGATCCATAAATGGCTGAACGCTTCCAGGCCGCGAACGG
CGTCGGCCTGGTTGTAGGGAGCAATGAGATGCAGTTCGCCGTTGGCGCTTTTTACCAGAC
CTGGCTGGCGCGGAACGGCGAACTTTTCTTTATAGGGCGAGCGAATAACGCCTATTTGCT
CGAACTGGAAACTGCTCATTTCGCCGTAATGTTAAGCGCAGAACCGATACATACAGCCTG
ACGATAGCAGCCTGGCGTACCGCTGGTGACTTCGCAGCTATGCAGTAATACAGCATTGGC
TTTCATTTTAGAGGCGTTGATTTGCATCCGCTTACGTGCGGTTGGAATGCTCGGCGGAGA
GTCCTGATTAGAGGCCTGGCAAGAGTCGCCACTGACTTCACCGAGATCGCGGAACGGTTT
GCCGACTAATTCTTCTGCATTGGTATAAATTCGGACCGGCGTGGCGCGCGGCGCTTTCGG
TTTTGCAGGCTCCGCTTTCGGCTGGGGTGCAGTGCTTTGAACGGGTTCGACAGGGGATCT
GCTTAACATGGAACAGCCGCTTAGCATGAGTGCTACTAAACAGATCGGTAAAGCACGCAT
AGTATTTCCTCAATGTATGATCAAAACGTCAATATTGAATCAGGAGCTTGTAAAAATGAC
AAGACGGGCAAGCGCCCGTCCTGAATGATATTACAAATTGTGGAAACAGCCTAAAAATTA
CCAGCCTTTAACAGCTCCGCCGTTAAACACTTTGTTTGCTGCTTCGTAAACTTCGTCAGA
CTGATAAGCCTGGACGAATTTCTTCACGTTCTCGGCGTCTTTGTTATCTTCACGCGTCAC
GATCAGGTTTACGTACGGGGACTCTTTATCTTCAACAAAGATACCGTCTTTCGCCGGAGT
CAGGCCAATCTGGCTGGCATAGGTGGTATTGATAACTGCCAGAGCGATTTGCGCGTCGTC
CAGAGAACGCGGCAGTTGCGGTGCTTCCAGTTCAACAATTTTCAGATTTTTGGGGTTCTC
AACAACATCAAGAACGGTCGGCAGCAGGCCAACGCCATCTTTCAGTTTGATCAAGCCCAC
TTTTTGCAGCAGCAGCAGTGAACGACCAAGGTTAGTTGGGTCGTTTGGCACGGCAACCTG
CGAACCATCCTGCAGTTCATCCAGTGATTTGATTTTCTTGGAGTAACCAGCAATCGGATA
AACAAAAGTGTTGCCTACTGCGACCAGTTTGTAGCCACGATCTTTCAGTTGCTGATCAAG
GTACGGTTTATGCTGGAAGGCGTTGGCGTCGATATCGCCTTTGCTCAATGCTTCGTTTGG
CAGAACATAGTCGTTGAAGGTTACCAGCTCAACGTCCAGGCCATATTTGTCTTTCGCAAC
TTTCTGCGCGACTTCTGCAACCTGCTGTTCGGCACCAACAATCACGCCGACTTTAATGTG
GTTTGGATCTTTTTCATCCTGACCGCAGCCTACCAGTGCCAGTGATCCGATCAGGGCTCC
CACTGCCGCAAAGGTTTTGAATTTGAACGCCATACCTTATTCCTTCTTCAATTATTTATG
TTGTGTTGAACGTTACTTGCGAGTGACAGCCCGGACGATGCGGTCGCCTGCGAACTGAAT
TAAATAAACCAGAATGACCAGCAATACCAGTACCGTATTCATCACCGTCGCGTTATAGCC
GATGTAGCCATACTGATAGCCAATCTGACCTAAACCACCGGCACCGACTGCACCACCCAT
CGCGGAATAACCGACCAGGGTAATCAGGGTGATAGTTGCCGCATTCACCAGACCCGGCAG
CGCTTCCGGTAACAGCACCTTACGGACGATCTGCATCGGCGTGGCACCCATTGCGCGGGA
AGCTTCAATTAACCCGGTTGGGATCTCCAGCAGAGCGTTCTCGACCATACGGGCAATAAA
CGGTGCTGCACCAACGGTTAACGGAACAATCGCTGCCTGCAAACCAATCGATGTACCGAC
AATAACGCGGGTAAACGGAATCATCCATACAAGCAAGATAATGAACGGGATGGAACGGAA
AATGTTCACAATCGCAGAAACGGTACGATACAGCTTCGCGTTAGCAATAATTTGCCCCGG
ACGCGTGACATAAAGCAGAACGCCAACCGGCAGACCAATCACAAAGCCAAAAAAACCGGA
TACGAAGGTCATTGCCAGCGTTTCCCATACGCCACGAACCAGCAGCCACATCATCGGCTC
AGACATAACCCAGTACCTCTACTTTTACATGGTGTTCCTGCAGCCAGGCAATGGCGGCTT
GCGTATCTTGTTGTGTGCCGTGCATTTCAGTCAGCATGATGCCGAACTTAACGCCACCGG
CGTAATCCATCTGCGCGCTAATAATGTTGTTGTTGACGTTGAAACGACGCGCGGTTTCAG
AAAGCAGTGGGGCATCGACCGATTGACCGGTAAACTCCAGACGCAGCATCGGCACGCAGT
CAGTAAATGGCTCCGCTTGCAGACGTTCCTGGTAATCTTCCGGGATATCCAGATGCAGGG
TCGACTGAATAAACTTCTGCGCCAGCGGCGTTTTCGGATGCGAGAACACTTCACTTACCG
TGTCCTGCTCGATCAGTTCTCCATTGCTGATGACCGCCACGCAATCACAAATGCGCTTCA
CAACGTCCATTTCGTGGGTGATCAACAGAATCGTCAACCCCAGACGGCGGTTGATGTCTT
TCAGCAGTTCGAGAATAGAACGTGTCGTTGCCGGGTCCAGCGCGCTGGTGGCTTCATCAC
ACAGCAATACTTTGGGATTGCTGGCTAACGCACGGGCAATTGCCACACGTTGTTTCTGCC
CACCGGAAAGATTCGACGGGTAGCTATCATGCTTATCGCCAAGACCAACCAATGACAGCA
ATTCCGTCACGCGACGTTTGACCTCGTCTTTCGGTGTGTTGTCCAGCTCCAGCGGCAGAG
CCACGTTGCCAAAAACAGTACGCGAAGAGAGCAGGTTAAAATGCTGGAAAATCATACCAA
TCTGGCGGCGAGCTTTGGTCAACTCGGATTCTGACAGCGTGGTCAGTTCCTGGCCATCGA
CCAGCACGCTACCCTCGGTTGGGCGCTCCAGCAGGTTTACACAACGTATAAGCGTACTCT
TACCCGCGCCTGAGGCACCGATAACGCCATAAATTTGTCCAGCTGGCACATGCAGGCTGA
CGTTGTTCAACGCCTGGATGGTGCGGGTGCCCTGGTGGAACACTTTGGTGATATTCGAAA
GTTTTATCATTGATTATTTATTATCGTCATTAAGTTAGTCGTGGCATCTCGAATGCCTGA
AACGGGCAACGCCGTCAATGAAATGGATGTTAAGGCATCCAGACGTCTAAATCAATCAGG
TTTATGCGAAGAGCACTTTCTTGCAGGTCGAAACATGCGATACTAGCGTCACATGCCTTA
TTAAGGAGCTATAAAAGGTGGCGAAGAGCGTACCCGCAATTTTTCTTGACCGTGATGGCA
CCATTAATGTCGATCACGGCTATGTCCATGAGATCGACAACTTTGAATTTATCGACGGTG
TTATTGACGCCATGCGCGAGCTAAAAAAAATGGGCTTTGCGCTGGTGGTAGTAACCAACC
AGTCTGGCATTGCTCGCGGTAAATTTACCGAAGCACAGTTTGAAACGCTGACCGAGTGGA
TGGACTGGTCGCTGGCGGACCGAGATGTCGATCTGGATGGTATCTATTATTGCCCGCATC
ATCCGCAGGGTAGTGTTGAAGAGTTTCGCCAGGTCTGCGATTGCCGCAAACCACATCCGG
GGATGCTTTTGTCAGCACGCGATTATTTGCATATTGATATGGCCGCTTCTTATATGGTGG
GCGATAAATTAGAAGATATGCAGGCAGCGGTTGCGGCGAACGTGGGAACAAAAGTGCTGG
TGCGTACGGGTAAACCTATTACGCCTGAAGCAGAAAACGCGGCGGATTGGGTGTTAAATA
GCCTGGCAGACCTGCCGCAAGCGATAAAAAAGCAGCAAAAACCGGCACAATGATTAAAAG
ATGAGCGGTTGAAATAAAAATGCATTTTTCCGCTTGTCTTCCTGAGCCGACTCCCTATAA
TGCGCCTCCATCGACACGGCGGATGTGAATCACTTCACACAAACAGCCGGTTCGGTTGAA
GAGAAAAATCCTGAAATTCAGGGTTGACTCTGAAAGAGGAAAGCGTAATATACGCCACCT
CGCGACAGTGAGCTGAAAGCCGCGTCGCAACTGCTCTTTAACAATTTATCAGACAATCTG
TGTGGGCACTCGAAGATACGGATT
>seq5
ATCGGCTCAAACATGAAGAAATGAAATGACTGAGTCAGCCGAGAAGAATTTCCCCGCTTA
TTCGCACCTTCCCTAATTGATGCTGTTCCTGTGCTGCCCGGATTGTCATTTTTGCCACTG
GCTAACGCCAGGTCGAGATTGTTACTACCTGAAAATGCATCGCTGGCGATCAGATTTAAT
GAACCATTCGGGCCAAATCCAAATCCGTTGTTGGAAATATTAGCGGTATTCAACTGAACA
CGAATATGAGCGTCCTGATCGCATTGCATTACCAGCGTGATTGTTCTGTCTGCTAATTGT
GTTGTTTTACCCCGGTCAACTTGGCGCATGGCAGCACTTCGTTTGCCATAGTCGATATTT
TGTATGCTACTGGAGATATTACACTCTGCCTGAGCGGCCATGGCGAAGTTCAGCAGCAGG
CATCCTGTTATTATCCGTTTCATTGGCACTCTCCTGTTGCTGTCTCATAGAACACATCTT
TTGGTGCATCTTCTGGGAATGTAAGGTGAATACGGCATGATTGCTGCTCATCTTTTATAT
CTAGCACCATGTCCGGTTTGATGTTATTGAGGAATACAACACCGTCATCCACTGATGTTG
TCAGATAGTTGCCTTCACTATCTTCAATCGCAACGCCTCTGGGCAGTTTTTTGCCGTCGG
AAAGTGTGATATTGAGTAATGCACGGCGTTGTGTTATCGCACTGAATCCGACTTTCCCTA
CTGCACCACGGCCTTGTTTGATCATTTTTGTGCCGTTACCGATATCGACATTTTTTGGCA
AGCTGGCGGTATCGATCTCAACTCCTGATGTTCGCCACGGCTGGATTGATGGAATGACGG
CATTACCCCGAAAATCTGTCCATACTGGGCCTGCCTGAGATGTAATTCTGACACCTGCAA
TATTGTTATCCATTTTTGCGATGGCGAAAGTGTCATTGATAGTCCACGGTGAAAAGGTCA
CTCCCTGATCATGTACGGCAATACCACCTGACATCGTACCGTTGTAAGTACGGCTATCAC
TGCCGCTTGCTCCTGCGGCAAGGCTGACTTGGGTGTAATGGAGATTGGAACTGATACTGC
CGTTCAAGCTCGTTTCACGTTCGTCGTGATCTCGTTCAGCATTCACATAGTAGGACATCT
CATCTGAGACGACTCCCATGACACCAGTACCATAGTGGGTTTTATGATCGTCATGGCGAG
TATACAGTGTGGCGGTGTTTGATCTGCCAAATGGAATACTGATGTTGACGTAGAACAGAT
CACCATCGTCTTCATTATTTTCTGAAGCACTAAGTTGATGCTGCCAGTTGACGGAAACCG
TGGCGTGTTTGAACGCTTTGTTCCAGTTAATATTAAGGTTGCTTGAGTCATTGTCACCGT
CGTAACTATATGTTTTATAGCCACTGATGTTGAAACCACCCAGAATGGAGTTAGACCAGT
TTAAACCAAGCGCATAAGTGCTTTTAGTCGGATCGGTATAATCATCATCAATCGCTTCAG
ACAGTTCGCGATAATGGCGATCAGATCGAGTGAGGCTGGTTGTTAGCCCAAGTGAAAATG
GGAGATTGTAGTTCGCGTCAAGACGATATTTCTGTCCTTGCAGTGAGTCTTTCGTATCCT
GCGATGTACTAATTTGGCTGCTCACTGTTAAATCGGGCAGGGGAACCAGACTCGACCGGA
TTGATGCCGCCTGATAATTTTCTGCTACGATAACGCCGCCGTTCATTGCACTCCAGCGTG
TCAGATTCCATCCGCTCGATGCACTAATTACCCAAGGTGATTCGTCATAGTCATCGTCTA
CCCGCCCTATCGCGAAGCGATAACCCTGGAAGCTTTCTACATGCTGATTAAACAGGGTGG
AGGGAACAATATAGTTGTGCGAACTACCGTCTGTTTCGACAACGGTGACATTAAGATCAC
TATTACCATTGCGAACAGGTACATCAGGGATAGTGAATGCGCCCGCAGGAACCAGAATGG
AATGAATTAAAACTCCTTGTTGACGAATCTCGACACGAGCCTGAGAGGTGTTGGCTATAC
CAGTAACTTGCACACCACTGCCGCTGGTTTGCAATGCGTTGTCCGGTGCGATTTCGATAC
CGTAAATACTGGCTCCTTCCAACACGCTATTATTGAGGTTAACTTCACCTGCTCGCATGA
GTGTTTTAAGATCTGTAAAGGTACGTTGAAGGTAGGTTGACGAGTTCTGGTTACTGAATG
TGCCATTTGTTTGTGTAAGGAACTGATGGCTGCGTAACATCCAGTCATTAATATTAATCC
CGCCTTCAAGTGCAGCCTGGGAGTAGTCCGAACTCCCATTAGAAAATTCTGCACGGCTGC
TCATCAGAGAGTAGTTTAGCAGCGCAGCTGTTCCACCAGTTGCTGCGTTTGTGAGATCCA
ACCCTATGGGAATGATCGCCTGTGGTGAAACGATAATATCTAACGCTTCCTGGTTAGGTA
ATGGTGTGATTGTGGTACCCGGGTAGGACAATATATAGTCGTAACAGCCATTTTTTTCTT
CAGAAGGAATTTTTAAACCGGCTTGTTGCAGAAATGCCTGATCAAGACAAATGTCGCCAT
TTTCATCAAAGCGCGTAGCAATGTTGCCTTTTTTTTCGCCATTTACTGATACTATCAGTG
AATATTCACCTGGCAAAAAACGGGCTGAACGGGAAAAATAATGCGATATATTAGGATCTA
CACCTAGTGATTTTAATGTTTCCCGATCAAAATCAACAGCGGCAATCTCTATACCATCTG
CATTGGCTGGGGGAGAAAAGGCAAAACCAATGGTGTAGGCCAGTAACGTTTTTTTTAACA
TCCTTGTCGCTCCAGGCAAAGTTATTTTAAGTCAGTGACATATTTATTACCGCGATAACC
ATATCGGCTGGCTGGGTAAAACTCGACTTTTGTATCCGTAGCGTTTGTTAATGCAGTAGT
TGTACTGGTGTGTGGTAGAAAATAGGTCTTATTTATAGCCCCCGTTTTTCCTGAAGGGAG
CGTTTTAAATTGTAAGGTCATACGAACGACATAATTACTGGGGTTGCTAATCTCAATTTG
GTCGCCATTTTTACGCCATTCCAGGAATTTCCAGGTCTCTCGCTCTTCCGGCAGGGAAGC
CGGGTGGATCAGTACAGGTAGATCCTGACGAATTGAAACAGTAACTCTGCTGCTCTTGTC
ATCTTTTGGTGGAATACCTTCGAACGTTACGCGTTTCAGCTCTTCTGATTGCAGAGGAAC
AGTCGCCTGAAGTAAAAATCGAACCTGTTGTACTTGACCGGCTTCAACACGAATAACGGG
CTGAGTCGGGATTAAACGAATTGATTTATTGCTTTCAGGCAAATCAACAATGGTGGTGTA
AAGCAATGAAGGATGATCATCTGTATTCTTAATATTAATACTAGCTTCACCACGCTTTTC
ATCAACCAGCAATACTGATGTTTCAGGAACCATCCCTGTGGCTAAGGTATTCATTGATGT
TGTTATAAATACAGTGAATGTAATGTGTCTGAGCATTTAAATTAAAACTCCTGTAATAAT
GATAAATAACGCAGAAACATATTGTTAATATATGTTATGCACTGTTTGCGATGAGATTGA
TTAAGACAGACCATGTCATAGGGCATAATCTGTCCGAGTTATAGCTAACTGGTTAATGCG
TAAAAATAAAAACTGTATTACAAGTTCTTATAAATACTGAACGCTGATAGTGACGTTACC
ATCCAGTTTGATCGTTTCATCAGAACCAAGAATAGTATTGTCATTTACCGCAGCATCAAT
CAGTAACGGGAAGGTGACCGCTGTAATAGCAACAGGTGTCAGTTCCCCTGTTTTTGCAAC
AGAATAACCGCGCTCGATTGCTGAGCAACTTGTCAGCGAGCAGAATGCGCCATTAGATGA
GGCTTTCCATGTGGGGGTCGCTGCTGACCAGTGGTCAGTTTGAATCAGGTCGACAGGAAT
TTCACCTGTATCGTCCGCCGCGTGAATCCCACCATTAGACCTGTCAATACCAATGGATGC
AGCGCCAATTTTTTGTCCATTAGGCGCAGAACCTAAACCAAAGGCGTTTTTCGTTCCCTT
CATATCTACGAGAGTATCATAAGCTTTTTCAATATAGGATGTGTCGTTTAACGCTACAAT
GGTCGACTGACGGTTATCCTTGGAGGTTACAGCAATTAGCGTTGGTGCTGTGCAGGTTAT
ATTTAATGTGCTGTTTTTGCGGCCCAGTTGAACCAGTTTATTACTTTTACCGGTCGGATT
CAGCGCACTGTTATGATGTTTCCCATAGTCAACAATGCCGCCGCCCGTAACAACTGGGGT
ACATGCACCAGGGGTATACTCGCCGATGATAGTTAATTCTGTATCAGTTGAATCTGTTGC
CATGGCACTGAATGCTGCAACAGAAAGTGCTGCACAAATAGCAGCTGTTGTGAGGTTCTT
TTTGAAAAACATATGAACATATCCTTAATAACAAATTTATTTTTTAAAATAAAAAGCTGA
AGCAGTATATATATCTGTTTGTGAATGTAAATAAATAACTCGTTCAGAAATAGCCAACTT
GCTGGGATGTATTTATTTAATGAATTTTATAGTTACGATCATGTGAATAATAAGGTGCTG
GTGAGGTGGTTTGTGGTGATAATTATTCATTACATGAATGTTTGCGCTGAAAAATAGGAA
AATATATAGATAATTAAGGATAATATATTGGTTTTTTATATTCATATTTTGTATATTAAT
ATCGAGACAATTTACATGGAATGAAAAGACTGAATAGCTTGCAGAATCGGTATTGTCAGA
GGTGTTAACAAGTAATTGAGACGGATTGTAAATGAGAAATTGCTTGATGTGCTTCACTCA
TCAGACTTGGTGAACAAAGCACAATTTATTGAAAATTATCCCTATTATAGGAAAGGTCAA
ACGCTCATGCCGCATTTGCCAGAAAACAACGCGCACTTCGTCAGTAATTTGATTCGCCAG
ACACAGTCTGGCGAATTCATTGTTACCTCGCTTAAACTTCCAGCCAGTTCATAATACCGT
CTGCCGCCTTACGACCTTCGGCAATAGCGGTCACCACCAGATCGGAACCACGGACGATAT
CGCCGCCAGCAAAGATTTTCGGGTTGCTGGTCTGGAAGGCGTTGTCGCTGCCTTCCGGGG
CGATGATGCGGCCTTGTGAATCCAGCTCGACGCTGTGTTTTGCCAGCCATTCCATGTTGT
GTGGACGGAAACCAAACGCCATGATCACCGCATCTGCCGGAACGATATGTTCGGAACCTG
CAACGATCTCCGCGCGGCGACGGCCTTTGGCGTCCGGTTCGCCCATTTCGGTACGCACCA
TTTTTACGCCGCTGACTTTGCCGTTACCGTTCACTTCAATACCCAGCGGCTGGACGTTGA
ATTTGAACTCTACGCCTTCTTCCCGCGCGTTTTTCACTTCGCGGCGGGAACCCGGCATGT
TCTCTTCATCACGACGATAGGCACAGGTAACGTGCTTCGCTCCCTGGCGCACGGACGTAC
GCACGCAGTCCATCGCAGTGTCGCCACCGCCAAGGACCACCACGCGTTTGCCTTCCATGC
TGACGAACGGTTCGTCGCGGGTTTCACCAAAGCCCATTAACTGTTTGGTGTTGGCGATGA
GGAACGGCAGCGCTGCGTACACGCCATCGGCGTCTTCGTTTTCCAGCCCGCCGCGCATTG
ACTGATAAGTCCCGACGCCAAGGAACACGGCATCGTAATCACTCAGCAGATCGTCCAGCT
GTACGTCGCGGCCCACTTCGGTATTGAGTTTGAATTCAATACCCATGCCGGTGAAGATTT
CACGGCGACGCGTCATTACCTCTTTTTCCAGCTTGAAGGCCGGAATACCGAAGGTCAGCA
GCCCGCCAATTTCTGGATGACGGTCGAAGACAACGGCTTTTACGCCGTTACGCGTCAGGA
CATCCGCACACGCCAGACCTGCCGGGCCTGCGCCGATAATCGCCACTTTTTTACCGGTCT
GTTTCACACCAGACATATCCGGACGCCAGCCCATCTCGAACGCTTTATCGTTGATATAGC
GCTCAATGTTGCCGATGGTCACCGCGCCAAACTCATCGTTCAGAGTGCAGGAACCTTCGC
ACAGACGGTCTTGCGGGCAGACTCGTCCGCAAACTTCCGGCAGGGTGTTGGTCTGGTGCG
ACAGTTCCGCCGCTTCAAAAATACGCCCCTCGTTGGCGAGCTTCAGCCAGTTCGGGATGT
AGTTGTGTACCGGGCATTTCCACTCGCAGTATGGGTTGCCGCACGACAGGCAGCGGTCAG
CCTGCGCTTTGGCCTGGCCTTCGGAAAACGGCTCGTAAATTTCAACAAACTCAATTTTGC
GGATCTTCAGCGGTTTCTTTGGCGGATCAACGCGCTGCAGGTCGATAAATTGATAAACAT
TCTGACTCATTGTTGCTACCCCTTACTGCGCCTGCACGCGCAACTCAGCTGCGCTACGAC
TACGGTGACCCAGCAGTGCTTTTACATCACTGGACTTCGGTTTAACCAGCGCAAATTTAG
TGGCGAAGGTTGACCAGTTCGCCAGAATCTCTTCACCGCGCTGAGAGCCGGTATGCTGCA
CATGCTCGGTGATAAGACCACGCAGATGCTCTTCATGGATCGCCAGAGCGTCAACGCTTA
AGACCTCGACCAGTTCCGGGTTAACGCGTTTGCGGAAATCGCCGCTTTCATCGAGAACGT
AAGCGAAACCGCCGGTCATGCCCGCACCGAAGTTAACGCCGGTTTTACCCAGAATGCAGA
CGATACCACCCGTCATATATTCACAACCGTTGTCGCCAATGCCTTCTACCACGGTGATAG
CACCGGAGTTACGCACGCCGAAACGTTCACCCGCGCGGCCTGCGGCATACAGACGACCAC
CGGTCGCGCCATACAGGCAGGTGTTGCCGATAATGCTTGCTTCATGGCTGCGGAAGGCGG
AACCAACCGGAGGACGAATGGCGATTAAGCCGCCCGCCATGCCTTTACCGACATAGTCGT
TGGCATCACCGGTCAGGTACAGTTCCACGCCGCCCGCGTTCCACACGCCGAAGCTCTGGC
CTGCGGTGCCGTTGAAGTACGCTTTGATAGGATCGGCTGCCAGCCCCTGATCGCCGTGCG
TCTGGGCGATATAGCCTGAAAGCGACGCGCCGACAGAACGGTCGGTGTTGCGAATATCGA
ACCAGAAGGTTTTGCTCTGGCGCTCATCGACAAACGGTTTCGCCTGTTGCAGCAACTGCG
CGTTCAGCAGGCCGTTATCAAACGGCGGGTTGTTTTCGGTGCAGTAGAGTGCCTTACCTG
GATGCGGTTCGGCAGTCTCCAGCAGCTTCGACAGCGCCAGCTTCTGCTGTTTGGCGGTGA
AACCGTCCAGCTCTTTCAGCAGGTCGGTGCGACCAATCAGATCCACCAGACGTGTTACGC
CAAGCTGTGCCATCAGCTCGCGGGTTTCACGGGCGATAAACTCAAAGTAATTCGTCACCT
TGAATGGCAGGCCGTGATAGTGGTTCTTACGCAGTTTGTCATCCTGAGTTGCTACACCCG
TTGCGCAGTTGTTCAGATGGCAAATACGTAGATATTTACAGCCGAGCGCCACCATCGGGC
CAGTGCCGAAGCCGAAGCTTTCTGCGCCGAGAATCGCCGCCTTGATGATATCGACACCCG
TTTTCAGGCCGCCATCGACCTGCAAACGGATCTTGTGACGCAAGCCGTTAGCAACCAGCG
CCTGCTGGGTTTCAACAAGCCCCAGCTCCCACGGACAGCCTGCGTATTTCACCGATGAAA
GCGGACTTGCGCCGGTGCCGCCGTCATAGCCTGCGATGGTGATCAAGTCCGCATAAGCTT
TTGCCACGCCAGTCGCGATGGTGCCTACTCCCGGTTCGGAAACCAGCTTCACGGAGATCA
TCGCTTTCGGGTTAACCTGCTTGAGGTCGAAAATGAGCTGCGCTAAGTCCTCGATAGAGT
AGATATCGTGGTGCGGCGGCGGGGAGATCAGCGTCACTCCGGGCACCGAATAGCGCAGTT
TGGCGATGTAAGGCGTGACTTTATCACCCGGCAACTGACCGCCTTCGCCTGGCTTCGCGC
CCTGGGCGACTTTAATCTGAATGACGTCGGCATTGACCAGATACGCCGGAGTAACCCCAA
AGCGACCGGAAGCCACCTGCTTGATGCGCGACACTTTGTTGGTGCCGTAGCGCGCCGGGT
CTTCGCCGCCTTCACCGGAGTTCGAATTACCGCCGATGCTGTTCATCGCTTCCGCCAGCG
CCTCGTGGGCTTCCGGGCTTAACGCGCCGATAGACATCGCGGCGGTATCAAAGCGTTTAA
ACAGTTCGCTTGCCGGTTCAACATCAGCAATGTTGACCGCGTTTTCACCCGGCGTAATTG
CCAGCAGATCGCGCAGCGTGGTTGCCGGACGCTCATTAACCAGCTTCGCGTATTCCTGAT
AGTCGCTGTACTCGCCGCTTTGTACCGCTTGTTGCAGCGTGCGCACCACGTCCGGGTTGT
AGGCGTGGTATTCGCCGCCGTGGACGTATTTCAGCAGACCGCCCTGGCTGATGGGCTTAC
GCGCCAGCCAGGCACGTTTCGACAGATTCAGCAGATCCTGCTGGAAGTCTTCAAAGCTTG
CTCCACCAATGCGGCTGACCGCCCCCTGGAAGCACAGGCCCACTACATCATCGTGTAGAC
CGACCGCTTCAAACAGTTTCGAGCAGCGGTAAGAGGCGATGGTGGAGATGCCCATTTTGG
ACATGATTTTGTACAAGCCTTTGTTGATGCCGTTACGGTAGTTGAGCATCACGGTACGAT
AATCTTTGGCAATCGCATGGGTGTCTACCAGGCGGCCCAGCGTTTCATAGGCAAGGTATG
GATAAATAGCCGTCGCGCCGAAGCCCAGCAACACGGCGAAGTGGTGCGGATCGCGGGCGC
TGGCGGTTTCGACGATGATGTTGGCATCGCAACGCAGGCTTTGATCGACCAGACGGGTCT
GGATCGCGCCAACCGCCATCGGGGCTGGAACCGGCAGGCGATCTTTAGCGATATTCCGGT
CGGAGAGCACCAGCAGCACGGTGCCGCTACGTACCATTTTTTCGGCTTTGTCGCACAGCT
CTTTGACTGTCGCTTCGAGCGTGGTTTTAGTGACGTCAAAGGTGATATCCAGCGTATCTG
CGCGGTAGTGCTCCTCTTTCATCGTCGTGAGCTGTTTGAAATCGGAGTAGAGCAGAATCG
GCGATTTAAAGCTTAAACGGTGCGCCTGGCCCTCTGCTTCGCAAAAGACGTTCATTTCAC
GACCGATACTGGTGGCGAGCGACATAACATGCGCTTCACGCAGCGGGTCGATTGGCGGGT
TAGTCACCTGGGCAAACTGCTGGCGGAAGTAGTCGTAAATAATGCGCGGCTGACTGGAGA
GCACGGCGAATGGGGTATCATCGCCCATCGAACCGACCGCTTCCTGACCGTTTTCGCCCA
GTACGCGAATTACGGAGTCCAGCTCTTCCGCGCTGTAGTTAAACTGTTTCTGGTAGCTGG
CAAGCGTGTCGTCGTCCAGTTCGCGGCTACCCACTTCTTCATCGGGCAGATCTTCAAACG
GTACCAGTCGGCGGACGTTTTTCTCCATCCACTCTTTATATGGATGGCGGCTTTTCAGAT
CGTCATCGGTTTCTGCCGAGTGCAGAATACGCCCACTGCGGGTGTCGATAACCATCAGTT
CGCCTGGCCCGACGCGGCCTTTTTCGACCACTTCGTCAGGCTGGTAATCCCAGATACCGA
CTTCAGAGGCGCAGGTGATGAGCTTATCTTTGGTGATGACGTAGCGCGCCGGACGCAGAC
CGTTACGGTCGAGGTTACAGGCGGCAAAACGACCGTCGGACATCACGATGCCCGCCGGGC
CATCCCACGGCTCCATATGCATGGAGTTAAAGTCAAAGAAGGCACGCAGTTCCGGGTCCA
TATCCGGGTTGTTCTGCCAGGCGGGTGGTACTAATAGACGCATGGCGCGGATGATATCCA
TCCCGCCTGCCAGCAGCAGTTCCAGCATGTTATCCATCGAACTGGAGTCAGAGCCGGTTT
CGTTGACGAACGGTGCGGCGTCGTGCAGGTCAGGGATAAGCGGTGTCTGGAATTTATAAG
TACGCGCACGCGCCCATTGGCGGTTACCGGTGATGGTGTTGATTTCACCGTTATGCGCCA
GATAGCGGAACGGTTGCGCCAGCGGCCAGCGCGGTACGGTGTTAGTGGAGAAGCGCTGGT
GGAACAGGCAAATGGCCGATTCCAGACGCAGGTCCGCAAGATCCAGATAAAAGCGCGGCA
GATCCGTCGGCATACACAGACCTTTATAGATGTTCACCAGATTCGACAGGCTACAGACGT
AGAAGTCTTTGTCGGCTTCGAGACGCTTTTCAATGCGGCGGCGGGCGATAAACAGACGGC
GCTCCATATCGCGTGGACGCCAGCCTGCCGGGGCGTTCACAAAAATTTGCTCAATGCGTG
GCAGAGAGGAGAGGGCGATTTCACCCAGCACGCCTTCGTTAGTGGGGACATCACGCCAGC
CCACAATCGACAAGGTTTCGCGTTGCAGTTCTTCTTCAACGATGCGGCGTGCGGCAGCGG
CGAGTTCAGGATCTTTATTCAGGAAGAGCATCCCGACAGCGTAGTTTTTTGCTAAACGCC
AGCCGCGCTCCTGCGCAACGATGCGAAAAAAGCGATCCGGTTTTTGTAACAGCAAGCCGC
AACCGTCGCCGGTTTTACCATCGGCGAGAATCGCGCCACGGTGCTGCATGCGGGCCAGTG
CGTGTATTGCAGTACGCACTACCTTGTGGCTAGGTTCGCCTTCTATGTGGGCGATCAGGC
CGAAACCACAGTTATCCCTCTCAAGGGATTTATCGTACAACATATCGTGAACCTCCCCCA
GGCTCTGCGGGAACCCCACTTCCGAACCGCTGCGCACGGGCACAGAAAGAGCGTGGCGAC
GGGGTTTGCGTGTCATACGCGCGCCTCGCATTCGCCCCCTTGTTGTCCTTTTCGCATCGG
TTAATACGGTGAAGAGGGGATCTCAATTACTGCATAAATATGATGAGCAGGCTGCTCATC
CAGAAAGCTTCCAGCGGATTTCCAACTTATCGGGAAAGCTGATACAGGTCAAATGGCAAG
CTTATTGGTACAGAAATGTGCTTTAGCGCAAAATTCTTTATTAAATGACTGAAATTAAAA
TGGATTTTATCTTTAAGGCTAAAAGGGAAGTCGTTAGAGAAACAGTCAATTCCTGACTGT
CATAAAGGTGTGTTAACCCTTATCCTGCCTTGAACTGACGACAAAACCAGCATTTTATAC
TGCCTTAATTGGTAATGACGTTTCATGCTACTGTTTTTGCCTAAAATCCATCAGGAGATA
AAAAAATCTGACACAAGATAAGCAAAAGTGATTTATGTGATTATGCATGAAATTTCGGTA
ATTTTGATTGATTATGCAGTTGATAAAAGCAGGCCGGGACGATTGATCCAGGTCATCGCC
GAATTGAGCTAAAAATGGCAGGCTTTGGCCTCTTTTCAAGGCGCGGTCTATCAGATTATG
CAGTTACAGAAATTAGTCAATATGTTTGGTGGTGATCTCACCCGTCGTTATGGGCAAAAG
GTGCATAAGCTGACGCTGCACGGCGGTTTTAGCTGCCCTAACCGTGACGGTACCATCGGG
CGTGGTGGCTGCACATTCTGTAATGTTGCCTCGTTTGCCGATGAAGCGCAGCAGCATCGT
TCCATTGCCGAGCAACTGGCGCACCAGGCGAATTTAGTTAACCGCGCTAAACGCTATCTG
GCCTACTTTCAGGCGTATACCAGCACCTTTGCGGAAGTTCAGGTGCTGCGTTCTATGTAT
CAGCAGGCGGTGAGCCAGGCCAATATTGTCGGTTTGTGTGTGGGTACCCGCCCGGACTGC
GTGCCGGATGCGGTGCTGGATCTGCTTTGCGAATATAAGGACCAGGGTTACGAAGTGTGG
CTGGAGCTGGGGCTACAAACCGCCCACGACAAAACACTGCATCGCATCAACCGCGGCCAT
GATTTTGCCTGTTATCAGCGTACAACCCAGCTGGCACGTCAGCGCGGGCTGAAGGTGTGT
TCCCACTTAATTGTCGGCCTGCCTGGCGAAGGGCAGGCTGAATGTTTGCAAACGCTGGAG
CGAGTGGTTGAAACCGGCGTGGACGGCATAAAGCTGCATCCGCTGCATATTGTGAAAGGC
AGCATTATGGCGAAAGCCTGGGAAGCGGGGCGTTTGAACGGTATTGAACTGGAGGATTAC
ACGCTCACTGCCGGAGAAATGATTCGCCATACGCCACCGGAAGTGATCTACCACCGCATT
TCCGCCAGCGCCCGTCGCCCGACGCTGCTTGCTCCGCTGTGGTGCGAAAATCGATGGACG
GGAATGGTCGAGCTGGATCGCTATCTGAATGAACATGGCGTACAGGGATCGGCGCTGGGA
CGTCCGTGGCTACCTCCAACGGAGTAGGTCGTTGAGGGGAATTCCGCATTTCTCACACAA
TTTATAACGTAACTGTCAGAATTGGGTATTATTGGGGCAGGTTGTCGTGAAGGAATTCCC
TAATGAAGCAAATTCGTCTGCTGGCGCAGTATTATGTTGACCTGATGATGAAGTTAGGTC
TGGTGCGCTTCTCAATGTTGCTGGCGCTGGCCCTCGTCGTTCTTGCCATTGTGGTACAAA
TGGCGGTAACCATGGTGCTGCATGGTCAGGTCGAAAGCATTGATGTTATTCGTTCTATCT
TCTTTGGTTTGCTGATTACGCCGTGGGCGGTCTACTTTCTATCGGTGGTCGTCGAGCAAC
TGGAGGAGTCACGACAACGTCTGTCACGGCTGGTGCAAAAACTGGAGGAGATGCGCGAGC
GCGATTTGAGCCTCAACGTTCAGTTAAAAGATAATATTGCCCAGCTAAATCAGGAAATTG
CCGTTCGTGAAAAAGCGGAAGCAGAACTGCAGGAAACCTTCGGCCAACTGAAAATTGAAA
TCAAAGAGCGCGAAGAGACACAAATTCAGCTCGAGCAGCAATCCTCATTCTTACGTTCCT
TCCTTGATGCTTCACCCGACCTGGTTTTTTATCGTAACGAAGATAAAGAGTTTTCCGGCT
GTAACCGCGCGATGGAGCTGCTGACCGGAAAAAGCGAAAAACAACTGGTTCACCTGAAAC
CTGCTGATGTTTACTCACCGGAAGCCGCCGCAAAAGTCATTGAAACCGATGAAAAAGTGT
TCCGTCATAATGTGTCACTGACCTATGAACAGTGGCTGGATTACCCGGACGGGCGCAAAG
CCTGCTTTGAAATCCGTAAAGTGCCGTACTACGACCGCGTGGGTAAACGTCACGGTTTGA
TGGGCTTTGGTCGCGACATTACCGAGCGTAAGCGGTATCAGGATGCGCTTGAACGGGCCA
GCCGCGACAAAACGACGTTTATCTCCACCATCAGTCACGAATTGCGTACACCGCTGAACG
GTATCGTCGGTCTGAGCCGCATTCTGCTGGATACCGAACTCACCGCCGAGCAGGAAAAAT
ATCTCAAGACCATCCATGTTTCGGCCGTCACGCTGGGGAATATCTTTAACGATATTATCG
ACATGGATAAGATGGAACGGCGCAAGGTCCAGCTTGATAATCAACCGGTTGATTTCACCA
GCTTCCTTGCCGATCTGGAAAATCTCTCCGCATTGCAGGCGCAACAAAAAGGATTGCGCT
TTAACCTGGAGCCGACGCTGCCATTACCGCATCAGGTCATTACCGACGGGACGCGTTTAC
GGCAGATCCTGTGGAACCTCATCAGTAACGCCGTCAAATTCACCCAGCAAGGCCAGGTTA
CCGTGCGCGTGCGCTACGATGAAGGCGATATGCTGCATTTTGAAGTGGAAGACTCTGGTA
TCGGCATTCCGCAGGATGAGCTGGATAAAATTTTCGCCATGTATTACCAGGTGAAAGACA
GTCATGGCGGTAAACCTGCCACCGGCACCGGTATTGGTCTGGCCGTTTCTCGTCGTCTGG
CGAAAAATATGGGCGGCGATATTACGGTTACCAGCGAACAGGGCAAAGGTTCAACCTTTA
CGTTGACGATCCACGCACCGTCGGTAGCAGAAGAGGTCGATGATGCGTTTGATGAAGACG
ATATGCCTTTACCGGCGCTGAATGTGCTGCTGGTGGAAGACATTGAACTGAACGTGATTG
TTGCGCGTTCTGTGCTGGAAAAATTAGGTAACAGCGTTGATGTCGCCATGACCGGCAAGG
CGGCGCTGGAGATGTTTAAACCGGGCGAATACGACCTGGTGTTGCTGGATATTCAGTTGC
CAGATATGACCGGGCTGGATATCTCTCGTGAACTGACGAAACGTTATCCGCGCGAGGATT
TACCGCCGCTGGTGGCCTTAACCGCTAACGTGCTGAAAGACAAACAAGAGTACCTCAATG
CTGGAATGGATGATGTGCTGAGTAAGCCGCTTTCTGTTCCGGCGCTAACCGCGATGATCA
AGAAATTCTGGGATACCCAGGATGATGAGGAGAGTACGGTGACGACAGAAGAGAACAGTA
AATCAGAAGCATTGCTCGATATTCCCATGCTGGAACAGTATCTCGAACTTGTAGGACCGA
AGCTGATCACCGACGGGTTAGCGGTGTTTGAGAAGATGATGCCGGGCTATGTCAGCGTGC
TGGAGTCGAATCTGACGGCGCAGGATAAAAAAGGCATTGTTGAGGAAGGACATAAAATTA
AAGGTGCGGCGGGGTCAGTGGGGTTACGCCATCTGCAACAGCTGGGTCAGCAAATTCAGT
CTCCTGACCTTCCGGCCTGGGAAGATAACGTCGGTGAATGGATTGAAGAGATGAAAGAAG
AGTGGCGTCACGACGTAGAAGTGCTGAAAGCGTGGGTGGCAAAAGCCACTAAAAAATGAC
CCCGGCTAGACCGGGGTGCGCGAATACTGCGCCAACACCAGGGAAATCTTGGCTGCGCCG
TAAATTATTATGATGAGTTACAAGGGCACAGCACTGTTTTTCAGGCCGCACGCAGTTAAG
ATAGCAAAACTTAAATGATTTGTTACATGAATCAGTTAAATGTGTGATGCGTACCATTTT
TATTAAAAAAATTAATGTGTTTCAGTCAATTGCGAAAGGATGATCACAATGAAGAAAATT
GGCGTAATTCTGAGCGGATGCGGCGTCTATGACGGTTCTGAAATTCATGAAGCGGTGTTG
ACGTTGTTAGCTATTTCACGCAGCGGTGCGCAGGCGGTCTGCTTTGCACCGGATAAGCAG
CAGGTTGATGTTATCAACCATTTAACTGGCGAAGCGATGACGGAAACGCGCAATGTGCTG
ATTGAAGCGGCACGAATAACGCGCGGTGAAATCCGTCCTCTGGCCCAGGCCGATGCCGCT
GAACTGGATGCGTTGATTGTGCCGGGGGGGTTTGGCGCGGCGAAGAATTTAAGCAATTTT
GCCAGTCTTGGTAGCGAATGCACCGTTGACCGTGAATTAAAGGCGCTGGCACAAGCGATG
CATCAGGCCGGAAAACCGCTTGGTTTTATGTGTATTGCCCCGGCGATGCTGCCGAAAATT
TTCGATTTCCCGCTGCGTTTGACCATCGGTACTGATATCGATACCGCAGAAGTGCTGGAA
GAGATGGGCGCGGAGCATGTGCCGTGTCCTGTCGATGATATCGTGGTTGATGAAGACAAT
AAGATTGTCACCACCCCAGCATATATGCTGGCGCAGAACATTGCAGAAGCGGCGAGCGGC
ATTGATAAGCTGGTTTCCCGCGTGCTGGTTCTGGCTGAATGAGTAAAAGCCGCTTAACGG
TGTTTAGTTTCGTTCGCCGTTTTCTTTTGCGGTTAATGGTTGTCCTCGCCGTTTTCTGGG
GCGGGGGCATCGCGTTGTTTAGCGTTGCGCCTGTTCCCTTCTCAGCGGTAATGGTCGAGC
GACAGGTCAGCGCCTGGCTGCATGGCAATTTTCGTTACGTGGCACATTCTGACTGGGTCA
GTATGGATCAAATCTCGCCGTGGATGGGACTGGCGGTGATTGCCGCAGAAGATCAGAAAT
TTCCTGAGCACTGGGGCTTTGATGTCGCTTCCATTGAGAAAGCCCTGGCGCACAACGAGC
GCAATGAAAACCGTATTCGCGGTGCTTCAACGATTTCTCAACAGACAGCCAAAAATCTCT
TTTTATGGGATGGGCGTAGCTGGGTTCGAAAAGGGCTGGAAGCCGGATTAACGCTGGGGA
TAGAAACGGTCTGGAGCAAAAAGCGTATCCTGACGGTTTACCTGAATATCGCCGAATTTG
GCGACGGTGTGTTTGGCGTCGAAGCTGCGGCACAACGTTATTTCCACAAACCCGCGAGCA
AACTTACCCGGTCGGAAGCTGCATTACTGGCAGCTGTATTACCTAATCCACTTCGTTTCA
AAGTCTCCTCGCCATCGGGCTACGTGCGTAGCCGTCAGGCGTGGATTTTACGGCAGATGT
ATCAGTTAGGCGGTGAGCCGTTTATGCAACAACACCAGCTGGATTAAGCTTCGCGCGAAG
TGAGGGCCAGCGTTTTGCTCTCACGAGGTTGCAGATCTTTCTGCAGGGCAATAGCCAGCG
CCGGTTGGGCGATAAATCGTTTCCATAACCGCTCTTGCTTACGCAGACAACACCACTTCG
ACCAGGTCGCCAGTGGAATCAATGTGCTTTCACCAATGTTGTCGCAGACGACCGGGATAA
CCTCTGACTCACTGATGCGGTGACAGAGGATATTCTGCGGCTTCAGCGACATCGTCACGA
TACGGTTATCCTGCAAATAACGCTTCAGCTGTTTCAGTAGCTGGCGCAGTTGTGCAATGT
CTTCTTCGTAACGGCATTGTTCAGCAAATTCGGTCAGCGTAATGGAAGGCTTGCCGTCAA
AATCTGCAATCACATCGTAGACATAACCGGTTCCGCAATCCGTCTCAACGGTACCGTGAT
AGCGCGGTATTCCACTCCAGTCTTTTAACCGGCGACCAAGATGCGCGTAGTACTTTAACT
CACGGCGGATCTCTTTATCGCCACCATCGCCACGATGGTAGACAATCTTGATACAGCGTT
GGGCATCTTCCGGATGCGCATAACATTTCCGATGTCTTCCGGTGCCCAGGGGACTTTGTT
CAGATAAGCGAATCATGCCATCTCCTGGAAATATTTTCTGACGATCTCCAGTATGGTCGA
TTAACTTAAACAAAACCTAAACAATGCCTCTTAAGGTTTTCTTAAGGTTCTTCTGAAAGT
GAAAAGCGCACAAAATGTACAAATGACGTTGATTGAGAACGATTTCAGTACGTGATTTTC
TTATTGTCGGGGGGAGTTTGAAGGGAGTTGTATGTCAAAGTGATGAAGATTAATCTTCAT
CAAAACCAGAATTAAAGAGGGCGATAACGGCGGCCAGTGCTTCCTCTTCCTGTGGACCGG
TCGCTTCAACTTCAATCTGCCGTCCTTTGGCAGAATCCAACATCAGCAGCGCAATAACGC
TGTTGGCTTCAGCCTCGGTGCCTTCGTCATTACGTAAGAGCACTTCAGCGTCAAAACCCT
GCATTAATTCAAACAGCTTCATTGCAGGCCGGGCATGCATGCCCAGCTTGTTTGTGATTT
CAACAGTTTGCTTGACGGTCATGGTTTACGTTTTTCCAGCGTACGATGGCGTGACTGGAC
GTTTTTACCGCGCGAGCGGAAGTAGTCTGCCAGTTGCTCTGCAATATACACCGAACGGTG
CTTCCCGCCGGTACAACCAATGGCGACCGTCAAGTAGCTACGGTTGTTGGTTTCCAGCAT
AGGTAACCATAGCTCAAGATAGCTTCGCGTCTGGTAGATAAAATTGTGTACTTCTGTGTG
GCGGTCGAGGAACGCGGCGACAGGTTTATCAAGACCTGTCATTGGACGCAGTTTCGGATC
CCAGTGCGGGTTCGGCAAGAAGCGCACGTCAAAGACGTAATCTGCATCGATAGGGATACC
GTGTTTGAAGCCGAAAGACTCAAAGACCATGGTCAGTTCGCGTTCACGTTTACCCAGCAG
ACGGGTACGCAGCATTTCAGCCAGCTCGTGAACGGACATTTCTGAGGTATCGACAATCAG
ATCCGCTCGCGAACGCAGAGGCTCCAGCAAATCGCTTTCTTTGTCGATAGCACTTTCCAG
CGACAGGTTTTTGCTGGAAAGCGGATGCAGTCGGCGCGTGTCACTGTAACGACGAATTAA
GGTATTACGGTCGGCATCCAGGAACAGGAGTTGCGGTGAGAAAGCGTCAGGCAGGTTACT
CATCGCCTGTTCGAATATTTCTGGTGACTCCGGCATATTACGAACATCAATGCTGACGGC
GGCAGAAATCTCGCGATCGGCCAGGGTTCGAGCCAGATCGGGTAACAACACTACGGGAAG
GTTATCCACGCAGTAAAAACCCATATCTTCCAGCGCACGCAGGGCGACAGATTTACCTGA
ACCTGAACGTCCGCTGACGATCATCAGTACCATGTACTGTTTCTCCTCACAACGTCTAAA
AGAGACATTACCGAATAACTACGCTTCATCCGGAGTACCTTCGGTATCCGTAATGATTTG
ATACAGCTCTTCATCGCTCTGGGCTGCGCGTAAACGGCGGCAGATGGTTTTGTCCGCCAG
ACGTTTCGCCACCAGCGACAGAGTATGCAGGTGCGTTTTAGTTTGGTCTGCCGGCACCAG
CAGGGCAAAAAGTAAGTCCACCGGTTGGTTGTCGATGGCATCGAAAGCTATAGGCGTTTC
GAGCTGAACGAAAACGCCAACGGCGCGCAGAGTATCTTCTTCCAGTTTGCCATGCGGAAT
GGCAATACCATTGCCGATACCGGTACTGCCCATTTTTTCCCGCGTCAGGATAGCTTCAAA
AACCACCTGAGGCGGCAGGCTAAGTTGTTTCGCCGCCAGCTCGCTGATGATTTCCAGGGC
GCGTTTTTTGCTCTGACAGTGGACGCGGCTTCGCGTACATTCCCTGTTAAGAACACTGCT
AAGCTGTAGAGTTGTATCATTATTTGTCATAATTTCACCTAAGAACCTGCCCACTCAAAC
AGTGGAACAGGCTCGGAGCATTAACCGTACAAATGGCCCGTTGTGCCGCACAACAGACCG
CCATGCACATGCTAATTGCCCGGACAATTAGTGTTGTTTCAGTTTATCTTTATGTTTGGT
CAACTGGCGTGCCAGCTTATCAATTAAGCCATCAATGGCAGCGTACATGTCCTGACCTTC
CGCGCTGGCATGAATTTCACCACCGTTTACATGCAGTGTTGCATCTGAGGTGTGGGTGAC
TTTCTCCACTTTCAGAACAACATAGACCTGGTTGATTCGGTCAAAATATTGCTCAAGTTT
GGCAAATTTGGCTGTAACAAATTCGCGCAGTGCCTCGGTGATCTCGACGTTATTTCCGGT
AATGTTGAGCTGCATAGTGTCTTCCTTATCGGTTGGGTCAAACGAGTTGTTTACGCTGGT
TTGACGGCGGAATGGATAAAGACTCTCGGTACTTCGCAACAGTGCGGCGTGCCACCATGA
TACCTTGTTCCGACAGCAAAGAGGTTAACTTGCTGTCGCTCAACGGTTTCGCTGGGTTTT
CCGCCGCGATTAATTTCTTCACCAGCGCACGAATCGCCGTGGAGGAAGCTTCGCCGCCGC
CCTCGGTATTGACGTGACTGGAAAAGAAATACTTCAGTTCAAAAATGCCTCGTGGACTAT
GCAGGTATTTTTGCGTGGTCACGCGAGATATCGTCGATTCATGCATTTCGACAGCCTGGG
CGATATCGGCCAGTACCATCGGTTTCATATATTCTTCACCTTGCTCAAAGAAGGCTTGCT
GCTGTTCAACGATACAGCGACTCACGCGCAGTAGCGTATCGTTACGGCTTTCCAGACTCT
TGATCAACCATTTGGCATCCTGCAGATTGCTGCGGATAAACTGGCTGTCACCATCGTTGC
GCGCGTTATTGCACATCGAGGCGTAGTGCTGGTTGATTTGCAGACGCGGAATGCTGTCAC
TGTTGAGTTCTACCGTCCAGTGACCGTTATGCTTACGCACCAGCACATCTGGAATGACAT
ACTCAGGTTCGCCAGTCTGGATCGACTGCCCGGGGCGCGGATCGAGCGACTGGATCAGAT
TGACGGCTTCTTTCAGCACATCTTCTTTCAGACGCGTGACGCGCATTAAAGTGCGGAAGT
CGTGATTGGCTAACAGATCGAGATGATCGCTAATGATCAGTCTGGCCTCTTCCAGCCACG
GCGTGGTCTTATCGAATTGGGAGAGTTGGATCAGCAGACAGTCACGCAGATCTTTTGCCG
CCACACCGACCGGATCAAACCGTTGGATCCGCTTAAGGACGGCTTCAACTTCGTCGATGT
CGATCTCTTCATCGCCTATACTTTCGAGAATATCTTCCAGCGGGACAGTCAGATAACCGG
TTTCATCAACGGCATCGACGATAGAGGTAGCAATAGCGCGGTCAGTGTCGGAAAACGGTG
TCAGCTCAACCTGCCACATCAGGTAATCCTGCAAGGTCTGCGTCGTTTCGCCCTGGTAGA
CCGGCAGCTCGTCGTCAATGTAGTCACCGCTGGTGCCGGATGGTGTACCAGCGGTGTAAA
TGGTGTCCCAACTGGCATCGAGCGGCAGCTCTTCCGGCATCTCTTTTTGTTCGAGCGCGT
CGGCGGTGTCCAGCGTTTCACTGTCTTGCGTTTCGCGGGTGTCGATTTCTTCATGAGTGT
CGATTTGCTCAAGCAGCGGATTACTCTCCAGCGCCTGCTGTAGCTCCTGCTGAAGTTCCA
GCGTCGACAACTGCAACAGACGAATTGCCTGTTGGAGCTGTGGCGTCATCGCCAGTTGTT
GGCTAAGCCTGAGTTGCAAACCTTGCTTCATGTTCAGAATCGTACTCTCCTGCTAAAACG
TCGCAAACTTCTACCCTATCAGAGTCTGAAGTCTTCCCCAAGGTATACACGCTTAACGTG
TTCGTCTTGTAAGATTTCTGTAGGCGTGCCGTGGGCGATCAAATGCCCCTGACTGACGAT
ATAAGCGCGTTCACAAACCGCCAGTGTTTCACGCACGTTGTGGTCAGTGATCAGCACGCC
CAGGCCGCTGTCGCGCAGGTGCTCAATGATGCGTTTAATGTCGATAACCGAGATCGGGTC
AACCCCGGCAAACGGTTCGTCGAGCAGAATAAATTTCGGATTCGCAGCCAGTGCGCGGGC
AATTTCTACACGGCGACGTTCACCCCCGGAGAGTGACTGCCCCATGCTGTCACGCAGGTG
CTCAATGTGAAACTCTTCCATCAGCTCGTTCGCGCGGTCTTCACGTTGTTCAGCAGACAA
GTCGTCACGAATTTGCAGTACCGCCATCAGGTTATCGTAAACGCTGAGGCGACGGAAAAT
GGAGGCTTCCTGTGGCAGATAGCCGATACCGCGGCGCGCGCGTGCATGCAGAGGCAGCAG
ACTGATATCGTCATCATCAATAATGATGTTGCCCGCATCGCGCGGCACAATGCCTACAAC
CATGTAGAAAGTGGTGGTCTTACCGGCACCGTTTGGCCCCAGCAGACCGACAATTTCCCC
GGAGTTGACGGTCAGGCTGACGTCTTCTACCACGCGACGGCCTTTATAGGCTTTTGCAAG
GTTCTTTGCAGTTAATGTTGCCATAACGAATTAATTACCCTTCTTCTGTGCCGGGGTCTG
GCCTTTGTTGTTTTTGTCCTGCAGCTGCGACGGCACCAGAACGGTTGTTACGCGCTTGCC
TTTGTCGCTGAAAGCCTGCATTTTCTGCTCTTTCACCAGGTAAGTGATCTTATCGCCCTT
AATGTTGCTATCGACCTGCTGCAGATAAGCATTACCCGTCAGAACGACAAAATCTTTTGC
CAGTTCGTAGTGCATCTGGGAAGCGTGACCTTCAACGGGTTTACCGTTGTCCTGCATCTG
GTAGAACGTTGCCGGTTTACCGTAGCCGTCAATCACTTCTTTACCTTGTTCGCCGCCCGG
ACGGGTAACGACCACTTTGTCGGCATTAATTTTGATGGTGCCCTGGGTGACGATGACATT
ACCGGTAAAGGTAACCACGTTGCCTTGCATATCAAGAGATTGCTGGTCCGATTCAATGTG
GATCGGCTGATCAGTGTCTCCGGTTACGGCAAATGCCGGAATGCTGGCGGCCAGAAGTGA
GCTGGCAAGCACAAGATTAAGGCTGAGTTTGTTTGTTTTGAATTTCATAGGATGTTCTAA
CCTTTTCAATCAGCTCGGCGTTCTTGCTGCGTAAGTTGCCGCGCATTTTCAGACCGCTGG
AGTTAAATGTTGTTCCGTATAACGTGACGAGGTCTTCAGAGGTAACATCCTGCGTCACCA
GATTGATCTGCGCGTTATCCGTCGTGATTCTGCGAAGTTGAGAGTCTGGCACAAGTGCGT
TGACTTCAACGTGTCCATATAAATAGAGCATCCGGTCATTGGTCAGCTTGGCTTTATCTG
CTTTTACGGACCATGTCGGGATTTTATCCTTATCAAACGTGGTAAGTACCGGCTGCGTAA
ACCACGAAACGGCCTGATCGGAATAATATTCAACGTGTTGAGCAATCAATCGATAGCTTA
GTGCCCCTTCTGGGTTATAGACGAGCGTGTCCGTATGCTCGCTTTTATAGGTGGGATCAT
TGTTGTTGACGACCACCTGGGCGGTATCGTCTTTTTCGGCCATATTAATGCCGATCATCA
CCAGAACCGCCAGTGATAGCACAATGATAACCCAACGTCTGGCTTTACTCATATCGATTG
CCCTTTGGCTTCATCCAGTTTGCCCTGCGCCAGGAGTAATAAGTCGCAAACTTCGCGCAC
TGCGCCACGACCGCCAGCAATGCGCGTCACGTAATCGGCGCGCGGGATCAACAGTGGATG
CGCATCGGCCACGGCGACGCTTAAACCCACTTTTTCCATTACCGGCCAGTCGATGAGATC
ATCGCCGACATAAGCCACATTTTCCGGGGCAATCGCCAGTTTTTCCAGCAGATCGCTAAA
GGCGATCAGTTTGTTTGACTGCCCCTGATACAAGTGAGTGATCCCCAATGTGGCACAACG
ATCTTCTACCAGTTTAGCCTTTCGCCCGGTAATGATAGCGACTTCAATATCAGAGGTGAG
CGCACAACGAATGCCATAACCGTCACGAACATTGAACGCTTTCAGCTCTTCGCCATTATT
GCCCATATAAATCAGGCCATCTGACAGTACGCCATCGACATCGAGGATCAGCAGACGAAT
GTTCTCTGCTTTTGCTATAACGTCGGCGCTGACAGGGCCGTAACAGGTCGCAAGCGACGC
ACCTGCTTTGCTCATTGTTGTTTATCCTTGAATCTTTACACTACGCCTGCACGCAGTAAA
TCATGCATATGTAACACACCGAGTAAATGGTCGCCATCGGCAACCATCACGGAGGTGATA
TGGCGGGACTGCATTAAGTTCAGTGCCTCAACGGCCAGAATGCCAGGGCGCACACGTATT
CCCCCCGGCGTCATCACATCGGCAATACTTAACTGACGAACATCCACGCCCATATCGAAG
ACACGGCGTAAATCACCGTCGGTAAAGATGCCTTCAATCATCATATTGTCATCGCAAATG
ACAGTCATACCAAGATTTTTGCGGGTAACTTCCAGCAACGCGTCACGCAGACTGGCCGTT
TTCTTAACATGCGGGATCTCATCGCCCGTATGCATAATATCGTTTACGCGCAGCAGAAGT
TTACGACCCAGTGCGCCGCCTGGGTGTGAGAGCGCAAAATCTTCAGCAGTAAAGCCGCGT
GCTTTTAACAGCGCGACAGCGAGGGCATCGCCCATAACCAGCGTGGCGGTGGTGCTGCTG
GTCGGTGCCAGCCCTAACGGACAGGCTTCTTTCGCTACTTTAACACACAGATGCACATCT
GCGGCGCGCGCCATGCTGCTCTCCGGGCGACCGGTGATGCAGATTAACGGTACGTGAAGA
CGCTTAAGCACTGGAATTAAGGCCGTGATTTCGCTGGATTCACCAGAGTTAGAGATAGCA
ATCACCACATCCTGTGGGGTAACCATGCCTAAATCACCATGCGCGGCTTCACCAGGATGG
ACGAAAAATGAAGGTGTACCGGTGCTGGCAAACGTTGCCGCCATTTTTCGCCCAATATGC
CCCGATTTTCCCATCCCCATGACGACAACTTTCCCTTTACACCAGAACATCTTTTCACAG
GCAAGCGTGAAATTCTGATTGATGTATTGATCAAGCTCCGCCAGGCATTCACGTTCAATC
GCCAGGACTTCTTTACCTGCTTGCTGAAAGTCAAAACCCGGTTGTAACTCTACGTGCGAC
ATAATGCGTTTCCAGTTATTCAACGAGTATTGGCGATAACCAGTACAACATCGCCAGCCA
TACGATAAATCCGCCAGTTAATAATACCCCTACACCACGGCCCGGTTGCGGGGAGCGCCG
CCAGCACAGCAACGCAAAAATAATGCTCACCAGCAACATCACGCTGTAGTCACGACTGTA
CGCCAGTGGATCAATCTCTCCTGGCGTTATCAGCGCGGGTAAACCCAACACGATGACAAT
ATTAAAAATGTTTGCGCCAATGATATTTCCGACAGCAATGTCGTTTTCACCTTTGCGAAC
CCCCGCTATTGCGGTTGCCAGTTCCGGCAGGCTGGTTCCGATAGCAATTGCCGTCAGACC
CATCGTCAACTCGCTGATGGCAAAGTAATTCGCCAGCACCGTGGCGTTATCAACCACCAT
CCGCGTGGCCACTGGCATGATGATAAGCGCAATGCCGAGCCATAAAAACGCGACGGGCAA
TCCGCCGTCACGCGGCAGCTCTGCAAGCTGCTCTCTGGTCAGGCTGTCAGTCCCCTGACG
TTCAGCCTGACGTGCAAGTTTAACAATGAACAGCAGCCATAGCACAGCCAGAAAGAGGAG
AAAGATACCATCGCTGCGACTAAGTTGTCCGTCATAGAGTACGGAACCGGCCACCACGCT
GACCAACAACATTAAGGGTAATTCACGGCGTAGAACATCAGAATGGACGGTAAAAGGACG
AACCAGCGCAGCCAGACCGAGGATCAGCAATATATTGATAATGTTTGAGCCGAGGGCTGT
ACCAACGGCTAAATCGCGTTGTTCGTGCAGAGACGCGGCAAGCGAGACGATGACTTCTGG
TAACGATGTACCAATACTGACCACCGTCATGCCGATGATCAGCGGCGGGATGCCAAAGGT
TCGGCAAAGAATAGACGCGGCAAAAACCAGGCGGTCGGCACTGTAAACGACCAAAAGTAA
ACCAACAATTAACAGTGCCGTAGCTAAAAGCATCTAACGTCCTTTCTTCAGGTATACTCG
CCGGTCCGCTGAAGATTTTCAGAAAGCCGTAACGGATGCTTAATTTTGACTTTATGCGGC
TAAAAAGTAAAACAAATGCCAGCTTTCGCTAACCACGGCGGGTAATATTCTGTAAATATG
TTGGGTTCAAGGTTAAATTGAGCGCCATGCTTAGAAAATCAACGCAAGACGAAGGGTGAA
TTATGGAGCAGTCTGTGGCGAATTTAGTCGATATGCGCGATGTCAGTTTTACGCGTGGCA
ATCGCTGCATCTTCGATAATATTTCCCTGACCGTGCCGCGAGGGAAGATCACGGCGATCA
TGGGGCCATCGGGCATCGGTAAAACGACGCTACTCCGTCTGATTGGCGGGCAAATCGCAC
CAGATCATGGTGAGATCCTTTTCGATGGTGAGAATATTCCGGCGATGTCTCGTTCGCGCC
TGTATACAGTGCGCAAACGGATGAGCATGTTATTTCAGTCCGGGGCGTTGTTCACTGATA
TGAACGTATTTGACAACGTCGCCTATCCACTGCGCGAACATACCCAACTTCCCGCGCCAT
TGTTGCATAGTACGGTGATGATGAAGCTGGAGGCCGTGGGGCTGCGTGGAGCGGCTAAAC
TAATGCCTTCTGAACTTTCCGGTGGGATGGCGCGGCGTGCAGCGCTGGCGCGTGCGATTG
CGCTGGAGCCGGATCTCATCATGTTTGATGAACCTTTTGTTGGGCAAGATCCCATCACCA
TGGGCGTACTGGTGAAGCTGATTTCTGAGCTGAACAGCGCGCTGGGCGTGACTTGTGTGG
TGGTTTCTCACGATGTGCCGGAAGTGTTAAGTATTGCGGATCACGCCTGGATCCTGGCGG
ACAAAAAAATTGTCGCTCATGGCAGTGCCCAGGCGTTGCAGGCGAATCCTGATCCGCGCG
TACGTCAGTTTCTGGACGGGATAGCTGACGGGCCTGTTCCGTTCCGCTATCCTGCCGGCG
ATTATCACGCTGATCTTTTACCAGGGAGTTAAGCCACTCATGCTGTTAAATGCGCTGGCG
TCGCTCGGACATAAAGGGATTAAAACCCTGAGAACGTTCGGGCGGGCCGGGTTAATGTTA
TTCAATGCGCTGGTCGGCAAACCGGAATTTCGCAAACATGCGCCGCTGCTGGTGCGCCAG
CTCTATAATGTCGGCGTCCTGTCGATGCTGATTATTGTGGTTTCTGGCGTGTTCATCGGA
ATGGTGTTGGGGCTGCAAGGTTATCTGGTTCTGACCACTTATAGTGCGGAAACCAGTCTG
GGTATGCTGGTGGCGTTATCGCTACTGCGTGAACTGGGGCCGGTGGTTGCCGCGTTGTTG
TTTGCCGGGCGTGCTGGTTCGGCGCTAACCGCAGAAATCGGCCTGATGCGCGCTACAGAG
CAACTCTCCAGTATGGAGATGATGGCGGTGGATCCGCTGCGTCGGGTTATTTCTCCCCGT
TTCTGGGCTGGGGTTATTTCATTACCACTGTTGACGGTTATTTTCGTCGCCGTGGGGATC
TGGGGCGGATCTCTGGTCGGCGTCAGTTGGAAAGGCATTGATAGCGGGTTCTTCTGGTCG
GCAATGCAAAATGCCGTCGACTGGCGTATGGATCTGGTCAACTGTCTGATTAAGAGCGTG
GTGTTCGCCATCACGGTGACGTGGATTTCGTTGTTTAACGGCTACGACGCCATCCCGACG
TCTGCCGGGATTAGCCGGGCAACCACTCGCACCGTTGTCCACTCGTCTCTGGCTGTTCTG
GGGCTGGATTTTGTGCTGACCGCATTGATGTTTGGGAATTGAGTTCATGCAAACGAAAAA
AAATGAAATTTGGGTGGGTATCTTTTTATTAGCAGCACTGCTGGCGGCGCTGTTTGTTTG
CCTGAAGGCGGCGAACGTGACGTCCATACGTACTGAACCGACCTACACGCTTTATGCGAC
GTTCGATAACATTGGCGGCCTGAAAGCGCGCTCTCCGGTCAGTATTGGTGGCGTTGTTGT
GGGTCGGGTGGCGGATATTACGCTGGACCCGAAAACCTATCTGCCGCGCGTAACGCTGGA
AATTGAACAACGTTATAACCACATTCCAGATACCAGTTCGCTGAGCATTCGTACTTCCGG
CCTGCTGGGGGAACAATATCTGGCATTAAACGTCGGTTTTGAAGACCCGGAACTGGGGAC
TGCTATCCTGAAGGATGGCGATACAATTCAGGACACTAAGTCTGCGATGGTGCTGGAAGA
TCTCATTGGTCAGTTCCTTTACGGTAGTAAAGGCGATGACAATAAGAATAGTGGCGATGC
GCCAGCTGCTGCGCCAGGTAATAATGAAACCACTGAACCTGTGGGTACAACGAAATAATT
TCAGGAGAACCGACGCATGTTTAAACGTTTAATGATGGTCGCTTTGCTGGTGATTGCACC
TCTGAGTGCGGCAACCGCGGCAGACCAGACCAATCCGTATAAGCTGATGGACGAGGCGGC
GCAGAAAACGTTCGATCGCCTGAAGAATGAGCAACCGCAAATTCGGGCCAACCCGGATTA
TCTGCGTACCATTGTTGATCAGGAACTGCTGCCATACGTACAGGTGAAATACGCCGGTGC
GCTGGTGCTGGGCCAGTATTACAAGAGTGCGACCCCTGCTCAACGTGAAGCCTACTTTGC
CGCTTTCCGTGAGTACCTGAAGCAGGCTTACGGTCAGGCGCTGGCGATGTATCACGGTCA
AACCTATCAGATTGCGCCAGAACAGCCGCTGGGCGATAAAACCATTGTGCCTATTCGCGT
TACCATTATTGACCCGAATGGCCGTCCGCCGGTGCGTCTGGACTTCCAGTGGCGTAAAAA
CTCCCAGACGGGCAATTGGCAGGCTTACGACATGATTGCTGAAGGCGTCAGTATGATCAC
CACCAAACAAAACGAGTGGGGAACGCTGCTGCGTACCAAAGGTATCGACGGCCTGACTGC
GCAACTGAAATCGATTTCTCAACAGAAAATCACTCTGGAAGAGAAAAAATAATGAGCGAG
TCACTGAGCTGGATGCAGACGGGTGACACGCTGGCGTTATCCGGAGAGCTGGATCAGGAC
GTTTTGCTACCGCTTTGGGAAATGCGTGAGGAAGCGGTGAAGGGGATTACCTGCATCGAT
CTTAGCCGTGTCTCCCGCGTGGATACGGGGGGACTGGCACTGCTGCTCCATCTTATCGAT
CTGGCGAAAAAGCAGGGCAACAATGTGACGCTTCAGGGGGTAAACGACAAAGTGTATACC
CTGGCGAAATTGTATAATTTGCCTGCTGATGTTCTGCCTCGTTAAATTTTTTCAGGCCGG
ATATGGCGTTAACCGCCTGTCCGGCAAACCTGCCTGCAAGTCGAGCCTTGTCTGATTTAT
CAGCGAGGCTTTTTGCTTATTTATGCCAGCGCAACTTTGCTCTAAGATGTTTCGCTGGTT
TATTAACTGATGATTGAAGATCCCATGGAAAATAATGAAATTCAGAGCGTGTTGATGAAC
GCTCTCTCCCTCCAGGAAGTCCACGTTTCCGGCGATGGCAGCCACTTTCAGGTTATTGCC
GTGGGTGAGTTGTTTGACGGCATGAGTCGGGTTAAAAAACAGCAGACGGTCTATGGTCCG
CTGATGGAATATATTGCGGATAACCGCATTCATGCTGTGTCGATCAAAGCGTATACCCCT
GCGGAGTGGGCGCGCGATCGCAAACTGAACGGCTTTTGAGCTATGGGCGATTCGCCGGTA
GCGGATATGAATTGTTAACTGAGAACAAACTAAATGGATAAATTTCGTGTTCAGGGGCCA
ACGAAGCTCCAGGGCGAAGTCACAATTTCCGGCGCTAAAAATGCTGCTCTGCCTATCCTT
TTTGCCGCACTACTGGCGGAAGAACCGGTAGAGATCCAGAACGTCCCGAAACTGAAAGAC
GTCGATACATCAATGAAGCTGCTAAGCCAGCTGGGTGCGAAAGTAGAACGTAATGGTTCT
GTGCATATTGATGCCCGCGACGTTAATGTATTCTGCGCACCTTACGATCTGGTTAAAACC
ATGCGTGCTTCTATCTGGGCGCTGGGGCCGCTGGTAGCGCGCTTTGGTCAGGGGCAAGTT
TCACTACCTGGCGGTTGTACGATCGGTGCGCGTCCGGTTGATCTACACATTTCTGGCCTC
GAACAATTAGGCGCGACCATCAAACTGGAAGAAGGTTACGTTAAAGCTTCCGTCGATGGT
CGTTTGAAAGGTGCACATATCGTGATGGATAAAGTCAGCGTTGGCGCAACGGTGACCATC
ATGTGTGCTGCAACCCTGGCGGAAGGCACCACGATTATTGAAAACGCAGCGCGTGAACCG
GAAATCGTCGATACCGCGAACTTCCTGATTACGCTGGGTGCGAAAATTAGCGGTCAGGGC
ACCGATCGTATCGTCATCGAAGGTGTGGAACGTTTAGGCGGCGGTGTCTATCGCGTTCTG
CCGGATCGTATCGAAACCGGTACTTTCCTGGTGGCGGCGGCGATTTCTCGCGGCAAAATT
ATCTGCCGTAACGCGCAGCCAGATACTCTCGACGCCGTGCTGGCGAAACTGCGTGACGCT
GGAGCGGACATCGAAGTCGGCGAAGACTGGATTAGCCTGGATATGCATGGCAAACGTCCG
AAGGCTGTTAACGTACGTACCGCGCCGCATCCGGCATTCCCGACCGATATGCAGGCCCAG
TTCACGCTGTTGAACCTGGTGGCAGAAGGGACCGGGTTTATCACCGAAACGGTCTTTGAA
AACCGCTTTATGCATGTGCCAGAGCTGAGCCGTATGGGCGCGCACGCCGAAATCGAAAGC
AATACCGTTATTTGTCACGGTGTTGAAAAACTTTCTGGCGCACAGGTTATGGCAACCGAT
CTGCGTGCATCAGCAAGCCTGGTGCTGGCTGGCTGTATTGCGGAAGGGACGACGGTGGTT
GATCGTATTTATCACATCGATCGTGGCTACGAACGCATTGAAGACAAACTGCGCGCTTTA
GGTGCAAATATTGAGCGTGTGAAAGGCGAATAATCGTCTGAGAGCTGGCAGCCCCGTTCG
CGGGGCTACCGCCAGACCACTCATTTTTTCGGTTTAGTGTAGCTACGCATCAACTGCGTT
CTGTCGATAAACTCATGGGTCTGCGGATCATGGTAGCGTGATGGCCAGATAACCCAGGGG
TCAGTTCCCAGGGCTTTCGCAATAATCATCTCTCCTTTCGGCCATGGGCGCGATAATGCA
TTCGCCAGCGTTGAGGAACTCAAACCATTTCTGCGAGATTCCGCCGCCATTGACGTTCCC
TTCTTGCGCAAACCCGCAATGATGTCAGCGGGATGCCAGTCAATGAAATTACTTTCCATT
TTTCCTCACTCCTTAAGTTAGTCGCTTTCATTCAGAACACTTCTTCTGTCGAGCATCACT
ATACTCCTGATGGCCTATTGCTCTAAAAAGTTCCTGTAAAGAGTGTGAATATTCAGAATA
TATAAAGATGCACATCCCTATTTTTCAGGTGTTATAGAGCTGAATAAGTGTTTTTATGGA
ACTTACTGGAACCATCCCGCGCGCTGCGCGGGATGAGGGGAGGGGATTAACGATCGCGTT
GAACAGCGATGTGCGCGAGGCCGATGAGTGCTTCTCGCCAAGGGGTGTCCGGGAGCACCT
GTAACGCTGCGATGGCTTTGTCTGCTTCTTCCTCGGCACGCTGACGCGTCCATTCAAGAG
ATCCACAAGCGTTCATTGCTTCCAGAACCGGTTCCAGAAGATGGCGACCGTTACCCTGTT
CGATGGCGGTACGGATCATCTGTGCCTGTTCTGGTGTGCCATGATGCATCGCATGCAGCA
GCGGCAGCGTCGGTTTACCTTCGTTCAGATCGTCGCCGACATTTTTACCTAACTGTTCGC
CATCGGCATTGTAATCGAGTAAATCGTCGATCAACTGGAAAGCAGTGCCGAGATAGCGCC
CATAATCCTGCAGGCCTTTCTCCTCCTCCGGCGTACAGCCAGCCAGAATCCCGGAACACT
GCGCGGCAGCCTCAAACAGACGCGCGGTTTTGCTATAGATAACGCGCATGTAGTTTTCTT
CAGTGATGTCCGGATCGTTAACGTTCATCAGTTGCAGAACTTCACCTTCTGCGATGACGT
TTACGGCTTCTGACATGACTTCCAGCACTTTGAGCGAACCGAGGCTGGTCATCATCTGGA
AAGCGCGGGTATAAATAAAATCGCCTACCAGCACGCTGGCGGCATTGCCAAATGCGGCGT
TGGCGGTAGCTTTACCCCTGCGCATATCTGATTCATCCACAACGTCGTCGTGTAGCAGAG
TCGCCGTGTGGATAAACTCGATCAGGGCAGCAATGGTGACATGCGCATTTCCCTCATAGC
CAACAGCTCGTGCAGCCAGTACAGCAATCATCGGACGAATACGTTTACCGCCGCCGCTGA
CGATGTAATAGCCTAACTGATTGATCAGTTGGACGTCGGAATTAAGCTGCTCAAGGATTG
CCGCATTAACACCCGCCATATCTTGCGCGGTTAACTCATTGATTTTTTCTAAATTCATCG
CAAAAGCCGGGCTTTTCGCCCCGATTACCTTACTGTGAACAAAGGCAACTTAGGGTTTAT
GGTTAGGAATATAGGGTGATTGTACTGAAAAAATGGCACAGATAAACGTTACCGTACAAG
TTGTGTTTTTTTTCTTCGTGTATTGACTGTAGCACTTGTCAAAGGCGTGCGTTTTGCGTA
ATATTCGCGCCCTATTGTGAATATTTATAGCGCACTCTGAATCATTGAAAAGGTGTGCGC
GGAAGCGGAGTTTTATATGTACGCGGTTTTCCAAAGTGGTGGTAAACAACACCGAGTAAG
CGAAGGTCAGACCGTTCGCCTGGAAAAGCTGGACATCGCAACTGGCGAAACTGTTGAGTT
CGCTGAAGTGCTGATGATCGCAAACGGTGAAGAAGTCAAAATCGGCGTTCCTTTCGTTGA
TGGCGGCGTAATCAAAGCTGAAGTTGTTGCTCACGGTCGTGGCGAGAAAGTTAAAATCGT
TAAGTTTCGTCGTCGTAAACACTATCGTAAGCAGCAGGGCCATCGTCAGTGGTTCACTGA
TGTGAAAATTACTGGCATCAGCGCCTAAGACCTGAGGAGAGATTTCAAATGGCACATAAA
AAGGCTGGCGGCTCCACACGTAACGGTCGCGATTCAGAAGCTAAACGCCTGGGCGTTAAG
CGTTTCGGTGGCGAATCCGTTCTGGCGGGTAGCATCATCGTTCGTCAACGTGGTACCAAA
TTCCACGCTGGCGCTAACGTAGGTTGCGGTCGTGACCACACTCTGTTTGCTAAAGCAGAC
GGTAAAGTGAAATTCGAAGTTAAAGGCCCGAAAAACCGTAAATTTATCAGCATCGAAGCT
GAATAAGTTTTTCGCGTCCCGGTAACGGATGAAAGCCCCGCAACACGTTGCGGGGCTTTT
TACATTCGATAACCGGTAAAAATGCGCATGGTGCGACGTTAATCCGCAAATGCGCTTTGC
AGGGAATACGGTATGAAGCAGCAGGCAGGCATTGGCATTCTTTTGGCGCTCACCACAGCA
ATTTGCTGGGGGGCGTTGCCAATCGCAATGAAGCAGGTGCTGGAGGTGATGGAACCTCCG
ACAATCGTGTTTTACCGTTTCTTGATGGCGAGTATTGGCCTGGGTGCCATTCTTGCGGTG
AAGAAGAGGTTGCCGCCATTACGCGTGTTTCGTAAGCCACGCTGGTTGATTTTGTTGGCA
GTGGCGACCGCCGGGCTGTTTGGGAACTTCATCCTGTTCAGCTCATCCTTGCAATACCTG
AGTCCGACCGCTTCGCAGGTGATTGGGCAACTCTCGCCAGTTGGCATGATGGTTGCCAGC
GTATTTATCCTCAAAGAGAAAATGCGCAGCACTCAGGTTGTAGGGGCATTGATGCTCCTG
AGCGGCCTGGTGATGTTTTTTAACACCAGTCTGGTCGAGATATTTACAAAGCTCACCGAT
TACACCTGGGGAGTTATCTTTGGGGTCGGTGCGGCGACGGTTTGGGTGAGTTATGGCGTG
GCGCAAAAGGTTTTATTGCGTCGGCTGGCCTCACCGCAGATCCTGTTTTTACTGTACACT
TTATGTACAATTGCGCTCTTCCCTCTGGCAAAGCCTGGAGTGATAGCGCAGCTTAGCCAC
TGGCAGCTCGCATGTTTAATTTTTTGCGGACTGAATACCTTGGTAGGATATGGCGCCCTG
GCGGAAGCGATGGCTCGCTGGCAGGCAGCGCAGGTGAGCGCGATCATCACGCTCACCCCA
CTGTTTACGCTGTTTTTTTCAGATCTTTTATCACTGGCCTGGCCCGATTTCTTCGCCAGA
CCGATGTTAAACCTTTTAGGTTATCTCGGTGCGTTTGTCGTGGTTGCGGGCGCGATGTAT
TCCGCCATTGGTCATCGTATTTGGGGCGGATTACGTAAGCATACAACGGTGGTATCGCAA
CCCCGCGCAGGCGAATGATTTACGGAGAATAAAATGAAGTTTGTTGATGAAGCATCGATT
CTGGTCGTTGCAGGTGATGGCGGTAATGGTTGCGTGAGCTTCCGCCGCGAAAAGTATATT
CCGAAAGGCGGCCCGGATGGCGGCGACGGCGGTGATGGTGGTGACGTATGGATGGAAGCC
GACGAGAACCTGAACACGCTTATCGATTATCGTTTTGAAAAATCTTTCCGTGCAGAGCGC
GGTCAGAATGGCGCAAGCCGCGACTGTACCGGTAAGCGCGGTAAAGACGTGACGATTAAA
GTGCCGGTAGGTACGCGTGTAATCGACCAGGGTACTGGTGAAACCATGGGCGATATGACC
AAACACGGTCAGCGTCTGCTGGTTGCTAAGGGCGGCTGGCACGGTCTGGGCAATACCCGT
TTCAAATCGTCCGTTAACCGTACACCGCGGCAGAAAACCAACGGCACGCCGGGCGATAAG
CGCGAGCTGCTGCTGGAGCTGATGCTGCTGGCTGACGTCGGTATGTTGGGGATGCCAAAC
GCGGGTAAATCGACCTTTATTCGTGCGGTATCGGCGGCTAAACCGAAAGTGGCGGATTAT
CCGTTTACCACTCTGGTGCCAAGTCTGGGTGTGGTACGAATGGACAACGAAAAGAGCTTC
GTTGTTGCCGATATTCCAGGACTGATTGAAGGCGCTGCGGAAGGCGCAGGTCTGGGCATT
CGCTTCCTGAAGCACCTGGAACGTTGCCGCGTCCTGTTGCACCTCATCGATATCGATCCG
ATTGACGGCACCGATCCGGTTGAAAACGCGCGTATTATTATCAGCGAGCTGGAAAAATAC
AGCCAGGATCTGGCGACGAAACCGCGTTGGTTAGTGTTCAACAAGATCGATCTGCTGGAT
AAGGTAGAAGCCGAAGAGAAAGCGAAAGCGATCGCTGAGGCGCTGGGCTGGGAAGATAAA
TATTATCTGATCTCTGCGGCGAGTGGACTGGGCGTGAAAGATCTCTGCTGGGATGTGATG
ACCTTTATCATTGAAAACCCGGTCGTGCAGGCTGAAGAAGCGAAACAGCCAGAGAAAGTC
GAATTCATGTGGGATGATTATCATCGCCAGCAGCTTGAAGAGATTGCTGAAGAGGATGAT
GAAGACTGGGATGACGACTGGGACGAAGACGACGAAGAAGGCGTTGAGTTCATTTACAAG
CGTTAATCACTGATGATAAACGCCAAATCAGCCTGATGCGCTACGCTTATCAGGCCTACA
AGAGAATTGCAATATGTTGAATTTGCACGATTTTGTAGGCCGGATAAGGCGTTTACGCCG
CATCCGGCATAAACAAAGCGCACTTTGTCAATAATCTGAAGCCCCGGCCATGTGCCGGGG
TTTCTTTTTGACTAATTGTTCTGATAAATATCTTTATACAAACGGCTTTCAAAACGCACT
AACGGAATACGGCGATTACGCTGATCCGCAGGTTCTACTGCATAGCCAGAAAGATATTGC
ACAAACGCCATTCGTTGCCCGCTCGCTGTGGTAATGAATCCCGCCAGGTTATATACCCCC
TGCAACGAACCGGTTTTCGCTGAGACTTTTCCATCCACGCCCGCCTGATGCAGACCTGCA
CGGTACTGCAAAGAGCCGTCATAGCCCGCCAGCGGCAGCATGGAGATAAAGTTAAGTTCA
TTGTCGTGTTGGGCAATGTATTGCAGCACCTGCATCATGGTGGCGGGGGCAATCAGGTTA
TGCCGCGAAAGCCCTGAACCATCGGCAATAATGGTGTTTCCAATATCGACACCGGCTTGC
TGGCGCAGGATCTGACGCACGGCGTCCGACCCGGCCCGCCATGTTCCAGGCACATTGAAG
CGCGCATGGCCTATCATGCGGAAAACCGTATCGGCGATCATGTTGTCCGACTTTTTCAGC
ATAATCTTAAGCAGATCGTGCAGCGGGGCCGACTGTTTACTGGCAACTACCGTTCCAGGT
TCGTTAACCTGAGTCTGGCGCAGCAGTGTTCCGCTCCAGGTGATACCCGCCTGTTTTAAC
TCATCTTTCAGAATTGCACCGGCATAGCTGGCTCCATCCTGCACGGCAAAAGCCAACGGG
AGCGGCTCAGAACGTTGTGGCAGGCATCCCGTCAGCGTAAAGCGGTTCAGGTCGCCTGGC
ACCACATCCAGTTCGCAGTATTGCGCTTCGGCAGAACCACGGGGGAGGGTGCGTACCTGG
CTGAACATCGTAACGGGGTAATAAGATGCCACGCGTATAAAAGCCATATCACCAGGCTTT
GGGGCACTGTAGAGCGAGACGGAGAAACAGTTGCGGTCAACTATGGCGGCGGCAGGCGGA
GCGCTAAAGCATTGTGTCATGTCATTCCATGGCCAGCCGGGGGCTTTATCGTGGCTGGCG
AAAATGGAGGTATCTATCAACACATTGCCATCGATTTGGTTGACGCCAGATTTTTTCAAA
GTCGCGACCATATTGCGAATATCCTGACGTTTTAACGTCGGATCGGCACCAAATCGCGCC
ACTAAGTCACCCTTAAGTACGCCGTTTTCCACATTGCCTTTGGTTTCAAGCGTCGTGGTA
AAACGAAAATCGGGGCCGAGTTGAATCAACGCCGCCAGCGCAGTAATCACTTTCTGGGTA
CTGGCAGGCAGCGCCATCTGCTGACTGTGGTAATCAATAGCGGGGGCCGACGCGCCGACT
TTTTGCACCATCAGGGCAAGGTTGGCACCAGCGGGGAGTTGAGTAATGTACTCATCAACA
TTTGCGGCCTGAACACTGAACGCTATACAGCTGGTCAATCCGATGATAAATCTGGAAAAT
CGCATAATCTCGCGCTAACAACCTGGAATCGAGCCGTCATACTACGGCGCAACGCCCTAT
AAAGTAAACGATGACCCTTCGGGAACTTCAGGGTAAAATGACTATCAAAATGTGAATTGT
AGCTGACCTGGGACTTGTACCCGGGTCGGTATTTTTTTGCTTCTGGTCCCGGTAAGGAGT
TATGCCGGGCAGGCCGAACAGCCGGGGTGGGTGAAGACTTGCCCTATCAGGAATATTCAA
GAGGTATAACAAATGCAAGCTATTCCGATGACCTTACGCGGCGCTGAAAAATTACGCGAA
GAGCTGGATTTTCTGAAATCTGTGCGCCGTCCTGAAATCATTGCTGCTATCGCGGAAGCG
CGTGAGCATGGCGACCTGAAAGAAAACGCCGAATACCACGCAGCTCGTGAACAGCAGGGT
TTCTGCGAAGGCCGTATTAAAGACATCGAAGCCAAGCTGTCGAACGCGCAGGTGATTGAT
GTCACCAAAATGCCCAACAATGGGCGCGTTATTTTTGGTGCTACCGTAACGGTGCTGAAT
CTGGATTCTGACGAAGAACAGACTTATCGCATCGTTGGCGATGACGAAGCTGACTTTAAA
CAAAACCTGATTTCTGTAAACTCGCCTATTGCTCGTGGCCTGATCGGCAAAGAAGAAGAT
GATGTTGTGGTCATCAAAACGCCGGGCGGCGAAGTAGAATTTGAAGTAATTAAGGTGGAA
TACCTGTAAGAATTACCCAATACTCAAGATGTTGATGTATTGTAAAGAAAGGAAAAAGGC
CGCTATGCGGCCTTTTATCAACGAACAGAGCGTGGCATTTTGCTCTCCTGCCTGCGGAAA
ACCCCTCGTTTTACACAGCAAATGTGTGTAACTTTAGGATAATCTTAGCGTGGCAGCGAG
ATTTTACGTTCTTTAGTTGGGCGATAAAGCACCAGCGTTTTACCGATGACCTGTACATTA
CAGGCGCCGGTTTCGCGCACGATAGCTTCCACGATCAAGGTTTTAGTTTCGCGATCTTCG
GTGGCGATTTTCACCTTGATGAGTTCATGGTGCTCTAACGCTTGTTCAATCTCGGCCAGC
ACCCCTTCGGTCAAACCATTACTGCCAAGCAGAACAACTGGCTTGAGCGGATGTGCCAGA
CCTTTCAGGTGCTGTTTTTGTTTAGTACTCAGATTCATCGTATTTTTTGCTTACGTTGGG
ATTGAAAACGGGTCATTCTACCGCCATCTCCCATATATCACCAAATAGGCGCGTAAAAAT
TTACGCAATTGGTTACGATGAGTTATCCCCATGGGAAAGTTAAATGACAGGTAAGAAGCG
TTCTGCCAGCTCCAGCCGCTGGCTTCAGGAACACTTTAGCGATAAATATGTTCAACAGGC
ACAGAAAAAGGGGTTACGTTCCCGTGCCTGGTTTAAACTTGATGAAATACAGCAAAGTGA
CAAACTCTTTAAACCGGGAATGACGGTTGTCGACCTTGGTGCTGCTCCGGGTGGTTGGTC
ACAATATGTGGTCACCCAAATTGGCGGCAAAGGCCGCATCATCGCTTGCGATCTTTTACC
TATGGATCCTATCGTTGGTGTGGACTTTCTTCAGGGCGATTTTCGTGATGAACTGGTGAT
GAAAGCACTGCTGGAGCGCGTTGGCGACAGCAAAGTCCAGGTTGTCATGTCCGATATGGC
ACCAAACATGAGCGGAACACCGGCGGTGGATATCCCCCGTGCCATGTATCTGGTGGAACT
GGCGCTAGAAATGTGTCGTGATGTATTAGCGCCAGGTGGCAGTTTTGTAGTGAAGGTGTT
CCAGGGCGAAGGTTTCGATGAGTATCTAAGGGAAATTCGCTCCCTGTTTACGAAGGTCAA
AGTTCGTAAGCCGGACTCTTCTCGTGCACGTTCGCGGGAAGTGTATATTGTAGCGACCGG
GCGTAAACCCTAACCGGGAGATTTCAGACGAAAGTTTGAAAGATGCTGGATATAGAGTAT
CCTGACGCTGTTTTTAACACAGTTGTAATAAGAGGTTAATCCCTTGAGTGACATGGCGAA
AAACCTAATACTCTGGCTGGTCATTGCCGTTGTGCTGATGTCAGTATTCCAGAGCTTTGG
GCCCAGCGAGTCTAATGGCCGTAAGGTGGATTACTCTACCTTCCTACAAGAGGTCAATAA
CGACCAGGTTCGTGAAGCGCGTATCAACGGACGTGAAATCAACGTTACCAAGAAAGATAG
TAACCGTTATACCACTTACATTCCGGTTCAGGATCCGAAATTACTGGATAACCTGTTGAC
CAAGAACGTCAAGGTTGTCGGTGAACCGCCTGAAGAACCAAGCCTGCTGGCTTCTATCTT
CATCTCCTGGTTCCCGATGCTGTTGCTGATTGGTGTCTGGATCTTCTTCATGCGTCAAAT
GCAGGGCGGCGGTGGCAAAGGTGCCATGTCGTTTGGTAAGAGCAAAGCGCGCATGCTGAC
GGAAGATCAGATCAAAACGACCTTTGCTGACGTTGCGGGCTGCGACGAAGCAAAAGAAGA
AGTTGCTGAACTGGTTGAGTATCTGCGCGAGCCGAGCCGCTTCCAGAAACTCGGCGGTAA
GATCCCGAAAGGCGTCTTGATGGTCGGTCCTCCGGGTACCGGTAAAACGCTGCTGGCGAA
AGCGATTGCAGGCGAAGCGAAAGTTCCGTTCTTTACTATCTCCGGTTCTGACTTCGTAGA
AATGTTCGTCGGTGTGGGTGCATCCCGTGTTCGTGACATGTTCGAACAGGCGAAGAAAGC
GGCACCGTGCATCATCTTTATCGATGAAATCGACGCCGTAGGCCGCCAGCGTGGCGCTGG
TCTGGGCGGTGGTCACGATGAACGTGAACAGACTCTGAACCAGATGCTGGTTGAGATGGA
TGGCTTCGAAGGTAACGAAGGTATCATCGTTATCGCCGCGACTAACCGTCCGGACGTTCT
CGACCCGGCCCTGCTGCGTCCTGGCCGTTTCGACCGTCAGGTTGTGGTCGGCTTGCCAGA
TGTTCGCGGTCGTGAGCAGATCCTGAAAGTTCACATGCGTCGCGTACCATTGGCACCCGA
TATCGACGCGGCAATCATTGCCCGTGGTACTCCTGGTTTCTCCGGTGCTGACCTGGCGAA
CCTGGTGAACGAAGCGGCACTGTTCGCTGCTCGTGGCAACAAACGCGTTGTGTCGATGGT
TGAGTTCGAGAAAGCGAAAGACAAAATCATGATGGGTGCGGAACGTCGCTCCATGGTGAT
GACGGAAGCGCAGAAAGAATCGACGGCTTACCACGAAGCGGGTCATGCGATTATCGGTCG
CCTGGTGCCGGAACACGATCCGGTGCACAAAGTGACGATTATCCCACGCGGTCGTGCGCT
GGGTGTGACTTTCTTCTTGCCTGAGGGCGACGCAATCAGCGCCAGCCGTCAGAAACTGGA
AAGCCAGATTTCTACGCTGTACGGTGGTCGTCTGGCAGAAGAGATCATCTACGGGCCGGA
ACATGTATCTACCGGTGCGTCCAACGATATTAAAGTTGCGACCAACCTGGCACGTAACAT
GGTGACTCAGTGGGGCTTCTCTGAGAAATTGGGTCCACTGCTGTACGCGGAAGAAGAAGG
TGAAGTGTTCCTCGGCCGTAGCGTAGCGAAAGCGAAACATATGTCCGATGAAACTGCACG
TATCATCGACCAGGAAGTGAAAGCACTGATTGAGCGTAACTATAATCGTGCGCGTCAGCT
TCTGACCGACAATATGGATATTCTGCATGCGATGAAAGATGCTCTCATGAAATATGAGAC
TATCGACGCACCGCAGATTGATGACCTGATGGCACGTCGCGATGTACGTCCGCCAGCGGG
CTGGGAAGAACCAGGCGCTTCTAACAATTCTGGCGACAATGGTAGTCCAAAGGCTCCTCG
TCCGGTTGATGAACCGCGTACGCCGAACCCGGGTAACACCATGTCAGAGCAGTTAGGCGA
CAAGTAAGTTCCCGCATCAGATGACTGTATTTGTACCGAAAACCCCGGGGCGTGCTCCGG
GGTTTTTTCTTATCAATTCATACCAGGGATAACATCATGAAACTCTTTGCCCAGGGTACT
TCACTGGACCTTAGCCATCCTCACGTAATGGGGATCCTCAACGTCACGCCTGATTCCTTT
TCGGATGGTGGCACGCATAACTCGCTGATAGATGCGGTGAAACATGCGAATCTGATGATC
AACGCTGGCGCGACGATCATTGACGTTGGTGGCGAGTCCACGCGCCCAGGGGCGGCGGAA
GTTAGCGTTGAAGAAGAGTTGCAACGTGTTATTCCTGTGGTTGAGGCAATTGCTCAACGC
TTCGAAGTCTGGATCTCAGTCGATACATCCAAACCAGAAGTCATCCGTGAGTCAGCGAAA
GTTGGCGCTCACATTATTAATGATATCCGCTCCCTTTCCGAACCTGGCGCTCTGGAGGCG
GCTGCAGAAACCGGTTTACCGGTTTGTCTGATGCATATGCAGGGAAATCCAAAAACCATG
CAGGAAGCTCCGAAGTATGACGATGTCTTTGCAGAAGTGAATCGCTACTTTATTGAGCAA
ATAGCACGTTGCGAGCAGGCGGGTATCGCAAAAGAGAAATTGTTGCTCGACCCCGGATTC
GGTTTCGGTAAAAATCTCTCCCATAACTATTCATTACTGGCGCGCCTGGCTGAATTTCAC
CATTTCAACCTGCCGCTGTTGGTGGGTATGTCACGAAAATCGATGATTGGGCAGCTGCTG
AACGTGGGGCCGTCCGAGCGCCTGAGCGGTAGTCTGGCCTGTGCGGTCATTGCCGCAATG
CAAGGCGCGCACATCATTCGTGTTCATGACGTCAAAGAAACCGTAGAAGCGATGCGGGTG
GTGGAAGCCACTCTGTCTGCAAAGGAAAACAAACGCTATGAGTAATCGTAAATATTTCGG
TACCGATGGGATTCGTGGTCGTGTAGGGGATGCGCCGATCACACCTGATTTTGTGCTTAA
GCTGGGTTGGGCCGCGGGTAAAGTGCTGGCGCGCCACGGCTCCCGTAAGATTATTATTGG
TAAAGACACGCGTATTTCTGGCTATATGCTGGAGTCAGCACTGGAAGCGGGTCTGGCGGC
AGCGGGCCTTTCCGCACTCTTCACTGGCCCGATGCCAACACCGGCCGTGGCTTATCTGAC
GCGTACCTTCCGCGCAGAGGCCGGAATTGTGATATCTGCATCGCATAACCCGTTCTACGA
TAATGGCATTAAATTCTTCTCTATCGACGGCACCAAACTGCCGGATGCGGTAGAAGAGGC
CATCGAAGCGGAAATGGAAAAGGAGATCAGCTGCGTTGATTCGGCAGAACTGGGTAAAGC
CAGCCGTATCGTTGATGCCGCGGGTCGCTATATCGAGTTTTGCAAAGCCACGTTCCCGAA
CGAACTTAGCCTCAGTGAACTGAAGATTGTGGTGGATTGTGCAAACGGTGCGACTTATCA
CATCGCGCCGAACGTGCTGCGCGAACTGGGGGCGAACGTTATCGCTATCGGTTGTGAGCC
AAACGGTGTAAACATCAATGCCGAAGTGGGGGCTACCGACGTTCGCGCGCTCCAGGCTCG
TGTGCTGGCTGAAAAAGCGGATCTCGGTATTGCCTTCGACGGCGATGGCGATCGCGTGAT
TATGGTTGACCATGAAGGCAATAAAGTCGATGGCGATCAGATCATGTATATCATCGCGCG
TGAAGGTCTTCGTCAGGGCCAGCTGCGTGGTGGCGCTGTGGGTACATTGATGAGCAACAT
GGGGCTTGAACTGGCGCTGAAACAGTTAGGAATTCCATTTGCGCGCGCGAAAGTGGGTGA
CCGCTACGTACTGGAAAAAATGCAGGAGAAAGGCTGGCGTATCGGTGCAGAGAATTCCGG
TCATGTGATCCTGCTGGATAAAACTACTACCGGTGACGGCATCGTTGCTGGCTTGCAGGT
GCTGGCGGCGATGGCACGTAACCATATGAGCCTGCACGACCTTTGCAGCGGCATGAAAAT
GTTCCCGCAGATTCTGGTTAACGTACGTTACACCGCAGGTAGCGGCGATCCACTTGAGCA
TGAGTCAGTTAAAGCCGTGACCGCAGAGGTTGAAGCTGCGCTGGGCAACCGTGGACGCGT
GTTGCTGCGTAAATCCGGCACCGAACCGTTAATTCGCGTGATGGTGGAAGGCGAAGACGA
AGCGCAGGTGACTGAATTTGCACACCGCATCGCCGATGCAGTAAAAGCCGTTTAAAGCGT
TAGATAACTGGCTAAAAAGGCGGCGATTGTCGCCTTTTTTCTCAGCGAACACATCGGTTT
TGCTGTTTTTTTCCGCAGTTGATACAATGCGATAAAATTGCCCTTGCGAAGGTCATTCGC
TTTGGTTAGTATTCACACCCGCTTCAGTGGGAAAGATTAAAAACTCCCGCTTTATTGGTT
GAAGCATTGGTACGCGGCAACTCCGCAAGGAACAGGTTGATTATGTATGAAGCTCTTTTA
GTAGTTTTCCTTATTGTGGCAATTGGCCTTGTTGGTCTGATCATGCTGCAGCAAGGTAAA
GGCGCTGATATGGGAGCCTCCTTCGGAGCAGGCGCTTCCGCTACGCTGTTTGGTTCAAGT
GGTTCTGGTAACTTCATGACCCGCATGACGGCGCTGCTGGCAACGTTATTCTTCATCATC
AGTCTGGTGCTGGGTAACATCAATAGCAACAAAACCAATAAAGGTAGCGAATGGGAAAAT
CTGAGTGCACCGGCGAAAACCGAACAAACTCAGCCAGCTGCTCCGGCTAAGCCGACCAGC
GATATCCCGAACTAAAAAGTAGTATCCGTGCCGAGGTGGTGGAATTGGTAGACACGCTAC
CTTGAGGTGGTAGTGCCCAATAGGGCTTACGGGTTCAAGTCCCGTCCTCGGTACCAAATT
CCAGAAAAGAGACGCTGAAAAGCGTCTTTTTTCGTTTTGGTCCTGGTCTGAGGAATGGTT
GTCAGGTATCTGTATCTCGTCCAGTTGCTTTACTCGTAGCTGGTACCTTGAAACGATGGT
GCCGGTACGCCTTAGTTATAAATTTTTCCCTTCTACTGACATAATTGGCACTTTATTGTG
TCAACTCCAGTTCCGGTACGAATACGGATATGTTTACTTCTCGATAAACCATCCTGCTCC
TGTCAGTATAACGACTGATGGCTACGTTCTGCGTAATGTTTAGAGACGCATTGATAATGT
TATTTAATTACTGAGAACGCAATGGCCGCATCATTTAAAAAGAAAAAACTAACAGTGTTT
CGTTCTGATATGGATCAGAGTTGAAAAACATGTCTGATATAAAATTAAACATTGTTGATA
ATTGTTTATATTGGTTGTGAACTTGGATTTCTGGATGACAGTATTCAACAAATTTGCTAG
AACTTTTAAATCTCATTGGTTGTTGTATCTTTGTGTTATTGTTTTTGGTATTACGAACTT
AGTCGCTTCTTCCGGAGCGCATATGGTTCAGCGCTTGCTGTTCTTCGTTCTGACCATCCT
GGTTGTAAAACGTATATCATCCCTTCCGCTTCGCCTGCTTGTTGCCGCACCATTTGTGTT
ACTGACTGCGGCAGACATGAGTATTAGCCTCTATTCATGGTGTACCTTTGGTACAACTTT
CAATGATGGATTTGCGATTAGTGTGCTCCAGAGTGATCCGGATGAAGTTGTCAAAATGCT
GGGGATGTATATCCCTTATCTATGTGCCTTTGCTTTTTTATCCCTTCTTTTTTTGGCAGT
AATAATAAAATATGATGTTTCCTTGCCGACAAAAAAAGTGACAGGAATATTATTGCTGAT
TGTCATTTCGGGCAGTTTATTTTCCGCTTGTCAATTTGCTTATAAAGATGCAAAAAATAA
AAAAGCGTTCAGTCCATATATACTAGCGTCGCGATTTGCTACCTATACGCCGTTTTTCAA
TCTCAACTATTTTGCTTTAGCAGCGAAAGAGCATCAAAGATTACTCTCAATTGCAAACAC
GGTGCCGTATTTTCAATTATCAGTCAGGGATACAGGTATTGATACCTACGTGTTGATTGT
GGGGGAGTCTGTACGTGTCGACAATATGTCTTTGTATGGATATACACGCTCTACGACACC
GCAAGTTGAAGCACAAAGAAAACAGATCAAACTGTTTAATCAAGCAATAAGCGGCGCACC
TTACACTGCGCTGTCGGTTCCCCTTTCTTTAACTGCTGATTCTGTTTTGAGTCATGACAT
TCATAATTACCCCGACAACATTATTAATATGGCTAATCAAGCAGGATTTCAGACTTTCTG
GCTAAGCTCGCAATCCGCTTTTCGGCAGAATGGTACAGCAGTTACCAGTATCGCCATGCG
CGCCATGGAAACAGTTTATGTCAGAGGATTTGATGAATTGTTGTTGCCGCATTTATCGCA
AGCATTACAGCAAAATACGCAGCAAAAGAAACTGATTGTTCTTCATTTAAATGGAAGCCA
TGAACCGGCTTGTAGCGCCTATCCGCAATCCAGCGCCGTGTTTCAACCGCAGGACGATCA
GGATGCCTGCTATGACAACTCCATTCATTACACAGATAGTTTGCTAGGTCAGGTTTTTGA
ATTATTAAAAGATCGCCGCGCCTCGGTCATGTATTTTGCCGACCACGGCCTGGAACGTGA
CCCTACGAAGAAGAACGTCTATTTTCATGGAGGCAGGGAGGCTAGCCAGCAGGCATATCA
TGTCCCGATGTTTATCTGGTATAGCCCCGTTCTTGGGGATGGCGTGGATCGCACAACGGA
AAACAACATCTTTTCGACAGCTTACAATAATTACCTTATTAATGCGTGGATGGGGGTAAC
AAAGCCGGAACAGCCGCAAACGCTTGAGGAAGTGATTGCACACTATAAAGGAGACTCACG
GGTTGTGGATGCAAACCATGATGTTTTCGATTATGTGATGCTCAGAAAGGAGTTTACAGA
GGATAAGCAAGGTAACCCCACCCCTGAAGGGCAGGGTTGATGTCGAATTACTGGCCTTTG
TTTTCCAGATTCTCCACCTGCGGCACGCCTGAAGCGGCAGAGGAGGAAAGCAGGCCAGTT
TTGGCATAACCGAAAAGTTTCTCGCGGGTATCAGTGATATCCAGGTTACGCATGGTCAAT
TGACCAATACGATCATCTGGCGAGAACACCGAGTCGCCTTTTTCCATCGTCAGACGCTCT
GGCTTGTAGGTCAGGTTCTCTGAGACGGTATTCAGGATTGAATAATCGTTCCCACGGCGC
AGCTCCAGGGTAACTTCACCAGTGATCTGGCTGGCAACCCAGCGTTGCAGAGAGTCACGC
AGCATCAGCGCCTGGGAGTCAAACCAACGCCCCTGGTACAGCAGACGGCCCAACTGACGA
CCATGCGCGTGATACTGCTCAATGGTGTCTTCGTTGTGAATACCGGTCAACAGGCGTTCA
TACGCAATGTGCAGCAGTGCCATCCCCGGAGCTTCGTAAATACCACGGCTTTTCGCTTCG
ATGATACGGTTTTCAATCTGGTCGCTCATGCCCAGGCCGTGACGACCGCCGATGCGGTTA
GCTTCCAGCATCATTTCTACGTCGTCGCTAAAGGTTTTACCGTTCAGCGCCACCGGATGA
CCTTGTTCAAAGCGTACTGTGACTTCTTCTGCCGGGATCTTCACGCTCTCATCCCAGAAT
TTCACGCCCATAATCGGGTTGACGATTTTGACGCTGGAGTTGAGGTATTCCAGATCCTTC
GCTTCATGCGTTGCACCAAGCATGTTGGAGTCTGTGGAGTAGGCTTTTTCGACAGACATT
TTGTAGTCGAAACCGCAGGCAATCATAAATTCAGACATCTCATGACGGCCGCCCAGTTCA
TCAATAAAGTCAGTATCAAGCCACGGTTTGTAAATCTGCAGTTCAGCATTGGTCAGCAGA
CCATAACGATAGAAACGTTCGATATCGTTTCCTTTGTAGGTGCTACCGTCACCCCAGATA
TTCACGCCATCTTCTTTCATCGCAGCAACCAGCATGGTACCAGTCACGGCGCGGCCCAGC
GGCGTCGTGTTGAAATAGGTCAGGCCGCCGGTGGTGTTATGAAATGCGCCACACTGAATA
GCGGCAATACCTTCGGCCACCAGTTGTTTGCGGCAGTCGATCAGACGTGCGTTCTCCGCG
CCGTATTCCATGGCACGACGAGGGATCGCATCATAATCCTCTTCGTCTGGCTGGCCCAGG
TTTGCAGTATATGCATAAGGAACCGCTCCCTTTTGTCGCATCCACAGCAGTGCGGCACTG
GTGTCCAGACCGCCAGAAAAAGCGATACCAATACGTTGACCTACCGGGAGATGCTTGAGA
ATCGTCGTCATAAAATAACACCCTGCTTAATTAACTGATGATGAGCCTGGATTTCCGCTC
TCACTGAATTTTTATGCAAAATAAATGAGTTTTCATTTAATCATCTTTTATCGGAGACAG
GAAGAGTTTAGTGTGTTTTTTGTAAAATAATGCGCTTAAGGGAGAGCAGGAGAAGGCAAA
AGTATTCAACAAATGAAAGTGAACTGGATATTCATTCACATGATTAGCAATAAACGTTGA
CAAAATGTGGCGTGGATCACTATAATGCCTGCAGATTTTACGTCCCGTCTCGGTACACCA
AATCCCAGCAGTATTTGCATTTTTTACCCAAAACGAGTAGAATTTGCCACGTTTCAGGCG
CGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCATAACCCGAAGATCGTCGGTTCAAATC
CGGCCCCCGCAACCACTTTCCCTTAGAGTCCTTTTTCAAATATACTGTGAAGACTTCGGC
CTTCGTAGTGGGATTTGAAAAAATCCTTCTGGAAAGTGCTCCAGACCGCAGTTGCGGTTA
TAGGGTTCAGTTATATAAAGCCCCGATTTATCGGGGTTTTTTGTTATCTGACTACAGAAT
AACTGGGCTTTAGGCCCTTTTTTTATGTCTTGGGGGTGGGCTTGTCCACATTAGAGCAAA
AATTAACAGAGATGATTACTGCGCCAGTTGAGGCCCTGGGTTTTGAACTGGTTGGCATCG
AATTTATTCGCGGTCGCACATCCACACTGCGCATCTATATTGATAGTGAAGATGGCATCA
ATGTTGATGATTGTGCTGATGTGAGCCACCAGGTAAGTGCTGTGCTGGATGTTGAAGATC
CCATCACCGTTGCTTATAACCTGGAAGTCTCCTCACCGGGTCTCGATCGCCCACTGTTCA
CGGCTGAACACTACGCCCGTTTTGTCGGAGAAGAGGTGACTCTGGTTCTCCGTATGGCGG
TACAAAACCGTCGTAAATGGCAGGGCGTTATCAAAGCGGTAGACGGTGAAATGATCACAG
TTACCGTCGAAGGTAAAGATGAAGTGTTCGCGCTGAGTAATATCCAGAAGGCGAACCTGG
TTCCCCACTTTTAATAGTCTGGATGAGGTGAAAAGCCCGCGATGAACAAAGAAATTTTGG
CTGTAGTTGAAGCCGTATCCAATGAAAAGGCGCTACCTCGCGAGAAGATTTTCGAAGCAT
TGGAAAGCGCGCTGGCGACAGCAACAAAGAAAAAATATGAACAAGAGATCGACGTCCGCG
TACAGATCGATCGCAAAAGCGGTGATTTTGACACTTTCCGTCGCTGGTTAGTTGTTGATG
AAGTCACCCAGCCGACCAAGGAAATCACCCTTGAAGCCGCACGTTATGAAGATGAAAGCC
TGAACCTGGGCGATTACGTTGAAGATCAGATTGAGTCTGTTACCTTTGACCGTATCACTA
CCCAGACGGCAAAACAGGTTATCGTGCAGAAAGTGCGTGAAGCCGAACGTGCGATGGTGG
TTGATCAGTTCCGTGAACACGAAGGTGAAATCATCACCGGCGTGGTGAAAAAAGTAAACC
GCGACAACATCTCTCTGGATCTGGGCAACAACGCTGAAGCCGTGATCCTGCGCGAAGATA
TGCTGCCGCGTGAAAACTTCCGCCCTGGCGACCGCGTTCGTGGCGTGCTCTATTCCGTTC
GCCCGGAAGCGCGTGGCGCGCAACTGTTCGTCACTCGTTCCAAGCCGGAAATGCTGATCG
AACTGTTCCGTATTGAAGTGCCAGAAATCGGCGAAGAAGTGATTGAAATTAAAGCAGCGG
CTCGCGATCCGGGTTCTCGTGCGAAAATCGCGGTGAAAACCAACGATAAACGTATCGATC
CGGTAGGTGCTTGCGTAGGTATGCGTGGCGCGCGTGTTCAGGCGGTGTCTACTGAACTGG
GTGGCGAGCGTATCGATATCGTCCTGTGGGATGATAACCCGGCGCAGTTCGTGATTAACG
CAATGGCACCGGCAGACGTTGCTTCTATCGTGGTGGATGAAGATAAACACACCATGGATA
TCGCCGTTGAAGCCGGTAACCTGGCGCAGGCGATTGGCCGTAACGGTCAGAACGTGCGTC
TGGCTTCGCAGCTGAGCGGTTGGGAACTCAACGTGATGACCGTTGACGACCTGCAGGCTA
AGCATCAGGCGGAAGCGCACGCAGCGATCGACACCTTCACCAAATATCTCGACATCGACG
AAGACTTCGCGACTGTTCTGGTAGAAGAAGGCTTCTCGACGCTGGAAGAATTGGCCTATG
TGCCGATGAAAGAGCTGTTGGAAATCGAAGGCCTTGATGAGCCGACCGTTGAAGCACTGC
GCGAGCGTGCTAAAAATGCACTGGCCACCATTGCACAGGCCCAGGAAGAAAGCCTCGGTG
ATAACAAACCGGCTGACGATCTGCTGAACCTTGAAGGGGTAGATCGTGATTTGGCATTCA
AACTGGCCGCCCGTGGCGTTTGTACGCTGGAAGATCTCGCCGAACAGGGCATTGATGATC
TGGCTGATATCGAAGGGTTGACCGACGAAAAAGCCGGAGCACTGATTATGGCTGCCCGTA
ATATTTGCTGGTTCGGTGACGAAGCGTAATAAACTGTAGCAGGAAGGAACAGCATGACAG
ATGTAACGATTAAAACGCTGGCCGCAGAGCGACAGACCTCCGTGGAACGCCTGGTACAGC
AATTTGCTGATGCAGGTATCCGGAAGTCTGCTGACGACTCTGTGTCTGCACAAGAGAAAC
AGACTTTGATTGACCACCTGAATCAGAAAAATTCAGGCCCGGACAAATTGACGCTGCAAC
GTAAAACACGCAGCACCCTTAACATTCCTGGTACCGGTGGAAAAAGCAAATCGGTACAAA
TCGAAGTCCGCAAGAAACGCACCTTTGTGAAACGCGATCCGCAAGAGGCTGAACGCCTTG
CAGCGGAAGAGCAAGCGCAGCGTGAAGCGGAAGAGCAAGCCCGTCGTGAGGCAGAAGAAT
CGGCTAAACGCGAGGCGCAACAAAAAGCTGAACGTGAGGCCGCAGAACAAGCTAAGCGTG
AAGCTGCTGAACAAGCGAAACGTGAAGCTGCGGAAAAAGACAAAGTGAGCAATCAACAAG
ACGATATGACTAAAAACGCCCAGGCTGAAAAAGCCCGCCGTGAGCAGGAAGCTGCAGAGC
TCAAGCGTAAAGCTGAAGAAGAAGCGCGTCGTAAACTCGAAGAAGAAGCACGTCGCGTTG
CTGAAGAAGCACGTCGTATGGCGGAAGAAAACAAATGGACTGATAACGCGGAACCGACTG
AAGATTCCAGCGATTATCACGTCACTACTTCTCAACATGCTCGCCAGGCAGAAGACGAAA
GCGATCGTGAAGTCGAAGGCGGCCGTGGCCGTGGTCGTAACGCGAAAGCAGCGCGTCCGA
AGAAAGGCAACAAACACGCTGAATCAAAAGCTGATCGTGAAGAAGCACGCGCAGCAGTAC
GTGGCGGTAAAGGCGGAAAACGTAAAGGTTCTTCGCTGCAGCAAGGCTTCCAGAAGCCTG
CTCAGGCCGTTAACCGTGACGTTGTGATCGGCGAAACTATCACCGTTGGCGAACTGGCGA
ACAAGATGGCGGTTAAAGGCTCTCAGGTCATCAAAGCGATGATGAAACTGGGCGCAATGG
CAACCATCAACCAGGTTATCGATCAGGAAACCGCACAGCTGGTTGCTGAAGAGATGGGCC
ATAAAGTTATCCTGCGTCGTGAAAACGAGCTGGAAGAGGCGGTAATGAGCGACCGTGACA
CGGGTGCTGCGGCTGAACCGCGCGCGCCGGTTGTGACCATCATGGGTCACGTTGACCACG
GTAAAACCTCTCTGCTGGACTACATTCGTTCAACGAAAGTGGCCTCTGGCGAAGCGGGCG
GCATTACCCAGCACATTGGTGCATACCACGTTGAAACTGAAAACGGCATGATCACCTTCC
TGGACACCCCGGGGCACGCCGCGTTTACTTCAATGCGTGCTCGTGGTGCGCAGGCAACGG
ACATCGTAGTCCTGGTTGTTGCTGCCGACGACGGTGTGATGCCGCAGACCATCGAAGCAA
TCCAGCACGCGAAAGCGGCGCAGGTACCGGTGGTGGTTGCAGTGAACAAGATCGATAAAC
CAGAAGCTGATCCGGATCGCGTTAAGAACGAACTCTCCCAGTACGGCATCCTGCCGGAAG
AGTGGGGCGGTGAAAGCCAGTTCGTACACGTATCTGCGAAAGCGGGTACCGGTATCGATG
AACTGCTGGACGCTATCCTGCTGCAGGCGGAAGTTCTGGAGCTGAAAGCGGTACGTAAAG
GTATGGCGAGCGGTGCGGTTATCGAATCCTTCCTCGATAAAGGTCGTGGTCCGGTTGCTA
CCGTTCTGGTACGTGAAGGTACTCTGCACAAGGGCGATATCGTTCTGTGTGGCTTCGAAT
ACGGTCGTGTTCGTGCGATGCGTAACGAACTGGGTCAGGAAGTGCTGGAAGCGGGTCCGT
CCATTCCGGTGGAAATCCTCGGCCTGTCCGGCGTACCGGCTGCGGGTGATGAAGTTACCG
TTGTACGTGACGAGAAGAAAGCGCGTGAAGTTGCACTCTATCGTCAGGGTAAATTCCGCG
AAGTTAAACTGGCGCGTCAGCAGAAATCTAAACTCGAGAACATGTTCGCCAACATGACCG
AAGGCGAAGTTCACGAAGTGAATATCGTCCTGAAGGCAGACGTACAGGGTTCTGTCGAAG
CGATCTCCGACTCCTTGCTGAAACTGTCTACTGACGAAGTTAAAGTGAAGATCATCGGTT
CTGGCGTAGGTGGTATCACCGAAACCGACGCCACCCTGGCTGCGGCGTCCAACGCCATCC
TGGTTGGCTTTAACGTACGTGCTGATGCCTCTGCACGTAAAGTGATTGAAGCGGAAAGCC
TGGATCTGCGTTACTACTCCGTCATCTATAACCTGATTGACGAAGTGAAAGCGGCGATGA
GCGGTATGCTGTCTCCGGAACTGAAACAGCAGATTATCGGTCTGGCGGAAGTTCGTGACG
TGTTCAAATCGCCGAAATTTGGTGCCATCGCAGGCTGTATGGTTACCGAAGGTGTGGTTA
AACGTCACAACCCGATCCGCGTTCTGCGTGACAACGTGGTTATCTACGAAGGCGAGCTGG
AGTCCCTGCGCCGCTTCAAAGATGACGTTAACGAAGTCCGTAACGGTATGGAATGTGGTA
TCGGCGTTAAGAACTACAACGACGTCCGCACTGGCGATGTGATCGAAGTATTCGAAATCA
TCGAGATCCAACGTACCATTGCTTAAGGTTTTTAGGGTTCCATGCGGGATAAGGCGTTTA
CGCTGCATCCGGCATGGATTGCCTGATGTGACGCTGGCGCGTCTTATCAGGTCAACGTGA
ACAGCCCTTCCACCTGAAATTAATTTTAAAAAGGGGCTAACAGCCCCTTTTTTGTCAGGA
GAATTTATTATGGCGAAAGAATTTGGTCGCCCGCAGCGCGTAGCGCAGGAAATGCAAAAA
GAGATCGCTCTCATCCTGCAGCGTGAAATTAAAGATCCTCGCCTGGGCATGATGACCACC
GTTTCCGGTGTCGAAATGTCTCGCGACCTGGCGTATGCCAAAGTATATGTGACGTTCCTC
AACGACAAAGATGAAGACGCGGTTAAAGCGGGCATCAAAGCGTTGCAAGAAGCTTCTGGT
TTCATCCGCAGCCTGCTGGGGAAAGCGATGCGCCTGCGTATCGTGCCGGAACTGACCTTC
TTCTACGACAACTCTCTGGTTGAAGGGATGCGCATGTCAAACCTGGTGACCAGCGTGGTC
AAACATGACGAAGAACGTCGTGTTAACCCGGACGACAGCAAGGAGGACTAATGAGTCGTC
CTCGTCGTCGCGGTCGCGACATTAACGGCGTTTTGTTGCTGGATAAACCTCAGGGTATGT
CCAGCAACGATGCGCTGCAAAAAGTGAAACGTATATATAACGCCAACCGTGCCGGGCATA
CCGGTGCGCTGGACCCGCTGGCGACCGGCATGTTGCCGATTTGCCTCGGGGAAGCGACGA
AGTTTTCCCAGTATCTGCTGGACTCCGACAAACGCTATCGGGTCATTGCGCGTCTTGGAC
AGCGTACCGATACTTCTGATGCCGACGGACAGATCGTTGAAGAACGTCCGGTAACCTTTA
GCGCAGAGCAGCTGGCAGCGGCACTGGATACTTTCCGTGGCGATATCGAACAGATCCCTT
CGATGTATTCAGCACTGAAATATCAGGGCAAAAAACTGTACGAATATGCGCGTCAGGGCA
TTGAAGTTCCGCGTGAAGCGCGTCCGATTACCGTTTATGAATTGCTGTTTATTCGCCATG
AAGGCAATGAGCTGGAGCTGGAAATTCACTGCTCAAAAGGCACTTATATCCGCACCATCA
TTGATGACCTGGGTGAAAAACTCGGCTGTGGCGCGCATGTTATTTACCTGCGCCGTCTGG
CGGTAAGTAAATATCCGGTTGAACGGATGGTGACCCTGGAGCACCTGCGTGAACTTGTTG
AGCAAGCTGAACAGCAGGATATTCCAGCCGCGGAGTTACTTGATCCATTACTGATGCCAA
TGGACAGTCCAGCTTCGGACTATCCGGTGGTGAATCTTCCGTTAACGTCTTCTGTTTACT
TCAAAAATGGTAACCCGGTTCGTACATCTGGTGCGCCACTGGAAGGACTGGTTCGCGTCA
CGGAAGGTGAGAACGGCAAATTTATCGGTATGGGCGAAATTGACGATGAAGGCCGCGTTG
CGCCTCGTCGCCTGGTGGTTGAATACCCGGCGTAATGTTAACCGTCTTGCGATAACAGGT
CGCTACGAGTAGAATACTGCCGCTTAACGTCGCGTAAATTGTTTAACACTTTGCGTAACG
TACACTGGGATCGCTGAATTAGAGATCGGCGTCCTTTCATTCTATATACTTTGGAGTTTT
AAAATGTCTCTAAGTACTGAAGCAACAGCTAAAATCGTTTCTGAGTTTGGTCGTGACGCA
AACGACACCGGTTCTACCGAAGTTCAGGTAGCACTGCTGACTGCACAGATCAACCACCTG
CAGGGCCACTTTGCAGAGCACAAAAAAGATCACCACAGCCGTCGTGGTCTGCTGCGCATG
GTTTCTCAGCGTCGTAAACTGCTCGACTACCTGAAACGTAAAGACGTAGCACGTTACACC
CAGCTCATCGAGCGCCTGGGTCTGCGTCGCTAATTCTTGCGAGTTTCAGAAAAGGGGGCC
TGAGTGGCCCCTTTTTTCAAGCTGACGGCAGCAATTCACTGGAAACTAATGTATTGTTGC
TATGAATGATCTTCCGTTGCAGAGGTTCGCGCGGCTAATGAGAGGCTTTACCCACATAGA
GCTGGGTTAGGGTTGTCATTAGTCGCGAGGATGCGCAGAAGATCGGGTATTAACACCAGT
GCCGTAAGGTACTGTCTAAGAAAGAGAAAGGATATTACATTGCTTAATCCGATCGTTCGT
AAATTCCAGTACGGCCAACACACCGTGACTCTGGAAACCGGCATGATGGCTCGTCAGGCT
ACTGCCGCTGTTATGGTTAGCATGGATGACACCGCGGTATTCGTTACCGTTGTTGGCCAG
AAAAAAGCCAAACCAGGTCAGGACTTCTTCCCACTGACCGTTAACTATCAGGAGCGTACC
TACGCTGCTGGTCGTATCCCGGGTAGCTTCTTCCGTCGTGAAGGCCGCCCAAGCGAAGGC
GAAACCCTGATCGCGCGTCTGATTGACCGCCCGATTCGCCCGCTGTTCCCGGAAGGCTTC
GTCAACGAAGTTCAGGTTATCGCCACCGTGGTTTCTGTTAACCCGCAAGTTAACCCGGAT
ATCGTCGCGATGATTGGTGCTTCCGCAGCGCTGTCTCTGTCTGGTATTCCGTTCAATGGC
CCGATTGGTGCTGCCCGCGTAGGTTACATCAATGACCAGTACGTACTGAACCCGACTCAG
GACGAGCTGAAAGAGAGCAAACTGGATCTGGTTGTTGCCGGTACTGAAGCCGCTGTACTG
ATGGTTGAATCTGAAGCTCAACTGCTGAGCGAAGACCAGATGCTGGGCGCAGTAGTGTTC
GGTCATGAACAACAGCAGGTTGTTATTCAGAACATCAATGAACTGGTGAAAGAAGCCGGT
AAACCGCGTTGGGACTGGCAGCCGGAGCCGGTAAACGAAGCGCTAAACGCGCGCGTTGCT
GCACTGGCTGAAGCTCGCCTGAGCGATGCTTACCGCATCACCGACAAACAAGAGCGTTAT
GCGCAGGTTGATGTCATCAAATCTGAAACCATCGCGACGCTGCTTGCTGAAGACGAAACC
CTGGACGAAAACGAACTGGGTGAAATTCTGCACGCGATCGAGAAAAACGTTGTTCGTAGC
CGCGTACTGGCAGGCGAACCGCGTATCGACGGTCGTGAAAAAGATATGATCCGTGGTCTG
GATGTGCGTACTGGCGTGCTGCCGCGTACTCACGGTTCTGCGCTGTTCACCCGTGGTGAA
ACGCAGGCGCTGGTTACCGCAACGCTGGGTACTGCTCGTGACGCGCAGGTTCTTGATGAA
CTGATGGGCGAACGTACCGATACCTTCCTGTTCCACTACAACTTCCCTCCGTACTCCGTA
GGCGAAACCGGCATGGTCGGTTCTCCGAAGCGTCGTGAAATTGGTCACGGTCGTCTGGCG
AAGCGCGGCGTGCTGGCAGTCATGCCGGATATGGACAAATTCCCGTACACCGTACGTGTT
GTGTCTGAAATCACTGAATCCAACGGTTCCTCTTCTATGGCTTCCGTGTGCGGCGCGTCT
CTGGCGCTGATGGACGCAGGTGTGCCGATCAAAGCTGCCGTTGCGGGTATCGCAATGGGT
CTGGTGAAAGAAGGCGACAACTACGTTGTACTGTCTGACATTTTGGGCGACGAAGATCAC
CTGGGCGATATGGACTTCAAAGTTGCAGGTTCCCGCGACGGTATCTCTGCACTGCAGATG
GATATCAAAATTGAAGGTATCACCAAAGAGATCATGCAGGTTGCGCTGAACCAGGCTAAA
GGTGCGCGTCTGCATATCCTGGGCGTAATGGAACAGGCGATCAACGCGCCGCGTGGCGAT
ATCTCTGAGTTCGCACCGCGTATCCATACCATCAAGATCAACCCGGACAAGATCAAAGAT
GTTATCGGTAAAGGCGGTTCTGTAATCCGTGCTCTGACCGAAGAAACTGGCACCACCATC
GAAATCGAAGATGACGGTACTGTGAAGATTGCAGCGACCGACGGCGAGAAAGCGAAACAT
GCTATTCGTCGTATCGAAGAGATCACTGCAGAAATCGAAGTGGGCCGCGTCTACACTGGT
AAAGTGACCCGTATCGTTGACTTTGGCGCATTTGTTGCCATCGGCGGCGGTAAAGAAGGT
CTGGTCCACATCTCTCAAATCGCTGACAAACGCGTTGAGAAAGTGACCGATTACCTGCAG
ATGGGTCAGGAAGTACCGGTGAAAGTTCTGGAAGTTGATCGCCAGGGCCGTATCCGTCTG
AGCATTAAAGAAGCGACTGAGCAGTCTCAACCTGCTGCAGCACCGGAAGCTCCGGCTGCT
GAACAGGGCGAGTAAGGTTGCCATTTGCCCTCCGCTGCGGCGGGGGGCTTTTAACCGGGC
AGGACGCCTTGTTAGCAACCGGGAACAGGACGTTCATTCAACCGTGGTCTTCGGGAGTGG
GAAATGAAGCCTTTTTTGCGCTGGTGTTTCGTTGCGACAGCACTTACGCTTGCAGGATGC
AGTAATACTTCCTGGCGTAAAAGTGAAGTCCTCGCGGTACCATTGCAACCGACTTTACAG
CAGGAAGTGATTCTGGCACGTATGGAACAAATCCTTGCCAGTCGGGCTTTAACCGATGAC
GAACGCGCACAGCTTTTATATGAGCGCGGAGTGTTGTATGATAGTCTCGGTCTGAGGGCA
TTAGCGCGTAACGATTTTTCGCAAGCGCTGGCAATCCGACCGGATATGCCTGAAGTATTC
AATTACTTAGGCATATATTTAACGCAGGCAGGCAATTTTGATGCTGCCTATGAAGCGTTT
GATTCTGTACTTGAGCTTGATCCAACTTACAACTACGCGCACTTGAATCGCGGGATCGCA
TTATATTACGGCGGTCGTGACAAGTTAGCGCAAGATGATCTGCTGGCGTTTTATCAAGAC
GATCCCAATGATCCTTTCCGTAGTCTGTGGCTTTATCTCGCCGAGCAGAAGCTCGATGAG
AAGCAGGCTAAAGAAGTGTTGAAACAGCACTTCGAAAAATCGGATAAGGAACAGTGGGGA
TGGAACATTGTCGAGTTCTACCTGGGCAACATTAGCGAACAAACGTTAATGGAAAGGCTC
AAGGCGGACGCAACGGATAACACCTCGCTCGCTGAGCATCTCAGTGAAACCAACTTCTAT
TTAGGTAAGTACTACCTAAGTCTGGGGGATTTGGACAGCGCCACGGCACTGTTCAAACTG
GCGGTTGCCAACAACGTTCATAACTTTGTTGAGCACCGATACGCATTGTTGGAATTATCG
CTCCTGGGCCAGGACCAAGATGACCTGGCAGAATCGGACCAGCAATAGCTGACGTACACA
TCAGCCCGTAATCTTTTTTGATTGCCATCACCTTAACGGGTGAGGGCGTTGTTGTTCGTT
AATACACCTACTTTGAGCCGGTTCACACTTTTCAATGAAAATTGCTGATCAATTTCATGA
TGAGTTATGTAGACTGGCCGCCATTAATTTTGAGGCACACGTACTACATGGCTGAATTCG
AAACCACTTTTGCAGATCTGGGCCTGAAGGCTCCTATCCTTGAAGCCCTTAACGATCTGG
GTTACGAAAAACCATCTCCAATTCAGGCAGAGTGTATTCCACATCTGCTGAATGGCCGCG
ACGTTCTGGGTATGGCCCAGACGGGGAGCGGAAAAACTGCAGCATTCTCTTTACCTCTGT
TGCAGAATCTTGATCCTGAGCTGAAAGCACCACAGATTCTGGTGCTGGCACCGACCCGCG
AACTGGCGGTACAGGTTGCTGAAGCAATGACGGATTTCTCTAAACACATGCGCGGCGTAA
ATGTGGTTGCTCTGTACGGCGGCCAGCGTTATGACGTGCAATTACGCGCCCTGCGTCAGG
GGCCGCAGATCGTTGTCGGTACTCCGGGCCGTCTGCTGGACCACCTGAAACGTGGCACTC
TGGACCTCTCTAAACTGAGCGGTCTGGTTCTGGATGAAGCTGACGAAATGCTGCGCATGG
GCTTCATCGAAGACGTTGAAACCATTATGGCGCAGATCCCGGAAGGTCATCAGACCGCTC
TGTTCTCTGCAACCATGCCGGAAGCGATTCGTCGCATTACCCGCCGCTTTATGAAAGAGC
CGCAGGAAGTGCGCATTCAGTCCAGCGTGACTACCCGTCCTGACATCAGCCAGAGCTACT
GGACTGTCTGGGGTATGCGCAAAAACGAAGCACTGGTACGTTTCCTGGAAGCGGAAGATT
TTGATGCGGCGATTATCTTCGTTCGTACCAAAAACGCGACTCTGGAAGTGGCTGAAGCTC
TTGAGCGTAACGGCTACAACAGCGCCGCGCTGAACGGTGACATGAACCAGGCGCTGCGTG
AACAGACACTGGAACGCCTGAAAGATGGTCGTCTGGACATCCTGATTGCGACCGACGTTG
CAGCCCGTGGCCTGGACGTTGAGCGTATCAGCCTGGTAGTTAACTACGATATCCCGATGG
ATTCTGAGTCTTACGTTCACCGTATCGGTCGTACCGGTCGTGCGGGTCGTGCTGGCCGCG
CGCTGCTGTTCGTTGAGAACCGCGAGCGTCGTCTGCTGCGCAACATTGAACGTACTATGA
AGCTGACTATTCCGGAAGTAGAACTGCCGAACGCAGAACTGCTAGGCAAACGCCGTCTGG
AAAAATTCGCCGCTAAAGTACAGCAGCAGCTGGAAAGCAGCGATCTGGATCAATACCGCG
CACTGCTGAGCAAAATTCAGCCGACTGCTGAAGGTGAAGAGCTGGATCTCGAAACTCTGG
CTGCGGCACTGCTGAAAATGGCACAGGGTGAACGTACTCTGATCGTACCGCCAGATGCGC
CGATGCGTCCGAAACGTGAATTCCGTGACCGTGATGACCGTGGTCCGCGCGATCGTAACG
ACCGTGGCCCGCGTGGTGACCGTGAAGATCGTCCGCGTCGTGAACGTCGTGATGTTGGCG
ATATGCAGCTGTACCGCATTGAAGTGGGCCGCGATGATGGTGTTGAAGTTCGTCATATCG
TTGGTGCGATTGCTAACGAAGGCGACATCAGCAGCCGTTACATTGGTAACATCAAGCTGT
TTGCTTCTCACTCCACCATCGAACTGCCGAAAGGTATGCCGGGTGAAGTGCTGCAACACT
TTACGCGCACTCGCATTCTCAACAAGCCGATGAACATGCAGTTACTGGGCGATGCACAGC
CGCATACTGGCGGTGAGCGTCGTGGCGGTGGTCGTGGTTTCGGTGGCGAACGTCGTGAAG
GCGGTCGTAACTTCAGCGGTGAACGCCGTGAAGGTGGCCGTGGTGATGGTCGTCGTTTTA
GCGGCGAACGTCGTGAAGGCCGCGCTCCGCGTCGTGATGATTCTACCGGTCGTCGTCGTT
TCGGTGGTGATGCGTAATCATCGCTGAACAGCGAACACAATCTGTAAAATAATATATACA
GCCCCGATTTTTACCATCGGGGCTTTTTTTCTGTCTTTTGTACTCGTGTACTGGTACAGT
GCAATGCATAACAACGCAGTCGCACTATTTTTCACTGGAGAGAAGCCCTCATGGCAACAC
TAACCACCACCCAAACGTCACCGTCGCTGCTTGGCGGCGTGGTGATTATCGGCGGCACCA
TTATTGGCGCAGGGATGTTTTCTCTGCCAGTGGTCATGTCCGGGGCGTGGTTTTTCTGGT
CAATGGCGGCGCTGATCTTTACCTGGTTCTGTATGCTGCATTCCGGCTTGATGATTCTGG
AAGCTAACCTGAATTACAGAATCGGTTCGAGTTTTGACACCATCACCAAAGATTTGCTGG
GCAAAGGCTGGAACGTGGTCAACGGCATTTCCATTGCCTTTGTGCTCTATATCCTGACCT
ATGCCTATATTTCTGCCAGTGGTTCGATTCTGCATCACACCTTCGCAGAGATGTCACTAA
ACGTCCCGGCACGGGCGGCGGGTTTTGGTTTTGCATTGCTGGTAGCGTTTGTGGTGTGGT
TGAGCACTAAAGCCGTCAGTCGCATGACAGCGATTGTGCTGGGGGCGAAAGTCATTACCT
TCTTCCTCACCTTTGGTAGCCTGCTGGGGCATGTGCAGCCTGCGACATTGTTCAACGTCG
CCGAAAGCAATGCGTCTTATGCACCGTATCTGTTGATGACCCTGCCGTTCTGTCTGGCAT
CGTTTGGTTATCACGGTAACGTGCCAAGCCTGATGAAGTATTACGGCAAAGATCCGAAAA
CCATCGTGAAATGTCTGGTGTACGGTACGCTGATGGCGCTGGCGCTGTATACCATCTGGT
TGCTGGCGACGATGGGTAACATCCCGCGTCCGGAGTTTATCGGTATTGCAGAGAAGGGCG
GTAATATTGATGTGCTGGTACAGGCGTTAAGCGGCGTACTGAACAGCCGTAGTCTGGATC
TGCTGCTGGTCGTGTTCTCAAACTTTGCGGTAGCGAGTTCGTTCCTCGGCGTAACGCTGG
GTTTGTTTGACTATCTGGCAGATCTGTTTGGTTTCGACGACTCGGCTGTGGGCCGCTTGA
AAACGGCATTGCTGACCTTTGCCCCGCCAGTTGTGGGGGGGCTGTTGTTCCCGAACGGAT
TCCTGTACGCCATTGGTTATGCTGGTTTAGCGGCTACCATCTGGGCGGCAATTGTTCCGG
CGCTGTTAGCCCGTGCATCGCGTAAACGCTTTGGCAGCCCGAAATTCCGCGTCTGGGGTG
GCAAGCCGATGATTGCGCTGATTCTGGTGTTTGGCGTCGGCAACGCACTGGTGCATATTT
TATCGAGCTTTAATTTACTGCCGGTGTATCAGTAATCAGCGGTGCCTTATCCGACATTTC
TGCTGCCTACACAATGCCTGATGCGCTTCGCTTATCAGGTCTATGTAGGACAGCGTTGCC
AGCTCGGATAAGGCTTCCCGCGTTAAGACACACTATCCCAACAACTCTTCCTTAACATCC
ATCGCCAGCTCAAACGAATGCAGCCGCGCCTGGTGGTCGAAAATCTGCCCGTTGACCATA
ATCTCATCGGCGTCGGTTTCGCGCAGGATCGACTGCAAGCCATGACGCACTTTCGCTTTA
TCACCTACCAACGACATACTCAGCGCCTGCTGCACGCCATACTGCTCAGACGGTGACCAG
AACTGATCCATATTTTGAATCGGCGGCGGCAGTTGCCCGGTTTCGCCACGGCGCAGCTTC
ACAAAGGCTTGCTGCATTGAGGTAAACAGAAATTCAGCGTCGCGGTTGCTGTCGGCGGCG
ATAATATTGATGCACACCATCGCGTATGGTTTTTCCAGCCGTGCTGACGGTTTGAAGTTG
CTGCGATAAAGATGCAGCGCCTGGAACAGCATATCCGGCGCGAAGTGTGAGGCAAACGCA
AACGGCAGACCAAGCTGCGCCGCCAGTTGCGCGCTGTAAAGGCTGGAGCCTAACAACCAC
ACGGGGATTTTCTCGCCATAGCCTGGTACCGGGCGCACATGCGGATTGGGATCGCGGGCG
TCAAACCAGTCCACCAGCTCCGCCACATCGCGGGGGAAATTATCAATATCGCCGCTCATA
TGACGACGTAGCGCCATCATTGTCCGTTGGTCACTACCCGGAGCACGACCCAGCCCCAAA
TCGATTCGCCCCGGATAGAGTGTATTAAGCGTGCCGAACTGTTCTGCAATGACCAACGGT
GAGTGGTTAGGCAACATCACGCCGCCAGACCCCAGATGCAGCGTGGTGGTATTCGCCGCC
AGATAGCCGATCAATACCGACGTGGCAGCACTGGCAATGCCAGTCATATTGTGGTGTTCT
GCCAGCCAGTAGCGATGATAGCCGCGCTTTTCAGCCAGACGGGCGAGATCGAGAGAGTGG
GAGAATGCTTCTCGCGCTGAAGAACCTTCGGGAATGGGGGCCAGATCGAGTAGCGAAAAC
GCAATGGTTTTATCAGTCATAACAGCTCACTTTGTTACCGATTAATCTTTAATACTGCAT
TAAAGAGTAGTTAAAGTTGTTAACAAAGTGAGCTATTTACTTAGGCTTGCAGCTCCAGTC
CTGCCAGCCGCCGCCAGTAGCCGTTACAGTCGCTGTTCGCCGTCAACGGCAGTGGTGCAG
CGCCATTTTCATTAGCGCGGAAGGCGTCGAGCATCGCGAAAGTGTCAGTACCCTGCGGTG
ACAGGCGGACCACATCAACCAGGCCCTGCATGGATGCCAGCTCGTTACCGAGGTTGTAAA
CGTAGCCGCTCATGGTCTGAATGCCATTGAGTACAAACACTTGTTGGTTTTCCTGCGACA
GCACGTTGCGCCCGTTCGGATACTTAATGCAGCAGGTTTCACACTCATCTTTCGGGCGGT
CTTCCGAACGCGCGGTAAAGCAGCGGGCGGAGTAGGCCAGCGGCAGATGACCGTAGCTCA
GGACTTCCACTTCAAACTGGTTACGAATGCCCAGCTCATCGCACTGATTAAGCAGATTCA
CCAGCCAGTCGCGGGAAAGCTCCACTGGCATACACCAGCGCATCATGCCCTGTTTGAGCA
ATATTTTCAGTGTCACCGCGTTGTAGCAGTTCAGCGCGTGCCCGGCGACGAACGGCAGTT
TGCGTTCAGCGCACATATTCACCACGCCGAGATCGCTGGCTTCAATCAGAAACTCACCGT
TCTCAACATAGCGTTTCAGTTCGCCCAGTTCAGATGATGCCTGCACCAGCGCCAGCGTGG
AGAGCACAATCTGCTTACCACTCCCGGCGAGCGATTTTGCCATCTCCAGCCAGTCGCCAA
CTTTGGTTGCCCGACGCTTGCTGCATACCGCTTCACCAAGATAAATCACGTCGGCGCTGC
TGGTGGCGGCCTGCTGATAAAATTCTTCCAGCGTCTCTTTTGGCCAGTACCACAGCACTG
GCCCTAAGGAATATTTCATTGCTTTTCTCACTGCCATTTACGGTGATATGCGCCAAGAGT
GGTTTGCGTGCCTTCGGACATCGACCCGAGCGTCTCCATCCACGCGCTTTGCGGTACAAA
GTTTTGCGGATCGGCCTTACAACGGTCGATAGCCTGACGCCAGACTTTCGCCACCTGGCT
GACATACGCCGGGCTACGCTGGCGGCCTTCAATTTTCACCGAAGCAATATTCGCCGCCAT
TAACTCCGGCAGCAGTTCCAGGGTATTGAGACTGGTTGGTTCTTCCAGCGCGTGATAGCG
CTCGCCGTCCACCAGATAACGCCCTTTACATAGCGTCGGATAACCTGCGTTTTCGCCGTC
CTGATAACGGTCGATCAGCACTTCGTTCAGGCGGGATTCCAGCCCCTGCGGCGTTTGTTG
CCAGCGCACGAAACGGGCCGGAGAACACGCGCCTATGGTGTTGGGCGACTCACCCGTCAG
ATACGACGACAGATAGCAACGACCTTCCGACATAATGCACAGGCTGCCGAAAGCAAAGAC
TTCCAGTGGTACAGGTGTGACCCGTGCCAGTTGTTTCACCTGATGAATCGACAACACGCG
CGGCAGCACCACGCGAGCAACGTCAAAATGGCGATGATAAAAGTTAATCGCCTCTTCATT
GGTCGCCGAAGCCTGCACCGATACGTGGCGCTCAATATGCGGATAACGCTCGGCGGCGTA
CTCCAGCATGGCGAGGTCGGCGAGGATCAGCGCGTCGGCACCCAGCTGCGCCGCCATATC
CACGGCGCGCTGCCAACGGGCGTAACCGTCCGGATGCGCAAAAGTGTTAATCGCGATGTG
AAGTTTGCGGCGATGTTGATGGACAAAACTCACCGCTTCCTGCAATTTTTTCTCGGTAAA
GTTAAGGCCGGCGAAGTGACGGGCATTGGTATCATCTTTTAGCCCGATATAAACAGCATC
TGCGCCGTTTTCGATGGCCGCCTTAAGCGCCGGGAGATTTCCGGCAGGGCAGAGCAGCTC
CATAATTTTTCCTGAAGGTTGCGCTATCAAAACGCAAAAATGTTAACGAACTGGGATTTT
AGTTAACCTTGCTGCGACAATTTTTGATTTAAGGCAGTTAAAGTTGTATTGGTGGTAGCA
GCAATTTCATATGGAATTGTTGATTTATACCGCTATGTTATTTTTCTGATATGGCAAAAT
AGGATGATTGTTGAAACAGGGAGTAAAACTCGTGTTGGATAAACTGCGTTCCCGTATTGT
GCATTTGGGGCCATCTCTGTTGAGTGTACCGGTAAAACTGACGCCATTTGCGCTAAAACG
CCAGGTTCTTGAGCAGGTCTTAAGCTGGCAATTCCGCCAGGCGCTGGATGATGGCGAGCT
GGAGTTTCTTGAAGGCCGCTGGTTAAGTATTCATGTGCGTGATATTGACCTGCAATGGTT
TACCTCGGTGGTGAATGGCAAACTGGTCGTTAGCCAGAACGCGCAAGCTGATGTGAGTTT
TAGTGCCGACGCCAGCGATCTGCTGATGATTGCGGCGCGTAAACAAGATCCGGATACGCT
CTTCTTCCAGCGTCGGCTGGTGATTGAAGGCGATACGGAGCTGGGGCTGTATGTGAAAAA
CCTGATGGACGCCATTGAACTGGAGCAAATGCCGAAAGCCTTACGCATGATGCTGCTGCA
ACTGGCGGATTTTGTTGAGGCGGGAATGAAAACCGCGCCTGAAACCAAACAGACATCGGT
AGGTGAACCATGCTAATTCGAGTAGAAATTCCCATTGATGCGCCGGGTATTGATGCCCTG
CTGCGTCGCTCATTCGAAAGTGATGCGGAAGCGAAGCTGGTTCACGATCTGCGTGAAGAT
GGCTTTCTGACGCTGGGGCTGGTGGCGACAGATGACGAAGGTCAGGTCATTGGCTATGTG
GCATTTAGTCCGGTTGATGTGCAGGGCGAAGACCTGCAATGGGTCGGCATGGCACCGTTG
GCGGTTGATGAAAAATACCGTGGACAGGGGCTGGCACGCCAACTGGTCTATGAAGGACTC
GATTCGCTTAATGAGTTCGGCTATGCCGCAGTGGTGACGCTGGGCGATCCGGCGCTGTAC
AGTCGTTTCGGCTTTGAACTGGCGGCGCATCACGATCTGCGTTGCCGCTGGCCGGGCACT
GAAAGCGCCTTCCAGGTACATCGTTTAGCGGATGACGCGCTGAATGGCGTTACCGGCCTG
GTTGAGTATCACGAGCATTTCAATCGCTTTTAATCTCCGGGGTTTGCAGACTGCTTAACA
GCTCTGCAAACCCTGCGCCTTCCGCTACCAGACGCTCTTTTTGCCGTTTGGTCAGTTGCT
TAACGCGATATTCCGCCCGTAACGCCAGCGAACGATCGCCCACTGGCGCGGAAAACACCA
GCGTTAGTTCTCCTTTCCCGCGCAGTGCTTTCGCCCCTTTGCCGCTTTGGTGCTGCTGAT
AGCGGCGTTCGACATCCGTGGTGATCCCGGTATAAAGCTTATTGTCGGCGGTACGGATCA
AGTAAAGAAACCAGGGTGTCATCGTCTGCGTCGCATGTTAAGGTCAGGCCCACAGTATAA
AAGAGAACAGCAATGGAAACACTCATCGCCATCAGCCGTTGGCTGGCAAAACAACATGTT
GTCACTTGGTGTGTGCAGCAGGAAGGGGAACTCTGGTGCGCTAATGCCTTTTATCTTTTT
GATGCGCAGAAAGTCGCCTTCTACATTTTGACGGAAGAAAAAACGCGCCACGCGCAGATG
AGTGGGCCGCAGGCTGCGGTTGCCGGAACGGTAAACGGTCAGCCGAAAACGGTAGCGTTA
ATTCGCGGTGTGCAGTTTAAAGGTGAGATCCGCAGGCTGGAAGGTGAGGAAAGCGACCTC
GCGCGCAAGGCGTACAATCGTCGCTTTCCGGTTGCCAGAATGCTGTCGGCCCCGGTGTGG
GAAATCCGGCTCGATGAAATCAAATTCACCGACAACACGCTGGGCTTTGGTAAAAAAATG
ATTTGGCTACGCGACTCAGGCACCGAGCAGGCGTAACGCCTCGCGGTTAAACGCTGGCAG
ATCGTCCGGTGTCCGGCTGGTAACCAGCTGATCTTTATCAACCACGACTTCCTGATCGTA
AAATTCCGCGCCCGCATTTTTAACATCAATAATGATCGGTTTAACTGCGGTCAGTTTGCG
CCCCCGAATCACATCGGCGCTGATCAGCAACTGCGGGCCGTGACAGATGGCAAACACCGG
TTTGCCACTATTCACAAAATCACGGGTAAAGGTGACAAAACGGTTGTCCCCACGCAGATA
ATCCGGTGAATGGCCGCCCGGTAGCAGCAGGGCATCAAACTCCGCAGGCGTCACTTCATC
GATGGATTTATCGATGGTCACGCTGGCTTCTCCTTTTTTGCCTTTCACCGTTTTACCCGC
TTGTTTTTCAATGGTAATCACTTCGTGTCCGGCTTTACGGAACTCGTCTGCGGGTGAAGT
AAATTCTGAATCCTCAAATTCATCAGTGATTAAAACGGCAATTTTCTTACTCATGCTTCC
TCCGCGTTGTTGCATTGGATGAGGCGAATTTCCCACAATCGGGGATAATTACCTCATGGT
CTATTAAGCCTGGTGCATGAGCCGTGGAGCGCAAGGCAGACAATTCTGTAAAGGAGCGAA
GATGAGTCAGGTACTGATTACAGGCGCAACGGGGCTGGTGGGCGGTCACCTGCTGCGGAT
GTTGATTAACGAACCGAAAGTTAACGCCATTGCTGCGCCGACGCGACGTCCGTTGGGCGA
TATGCCCGGGGTGTTTAATCCCCATGATCCGCAACTGAGTGACGCGTTGGCGCAGGTCAC
CGATCCCATCGACATTGTGTTTTGTTGTCTCGGCACCACGCGGCGAGAAGCGGGGAGCAA
AGAGGCGTTTATTCATGCCGATTACACGCTGGTAGTGGATACCGCATTAACCGGGCGGCG
ACTGGGCGCGCAGCATATGTTGGTAGTCAGTGCGATGGGTGCCAATGCCCACTCGCCGTT
TTTCTATAACCGCGTCAAAGGGGAGATGGAAGAAGCATTAATCGCCCAGAACTGGCCGAA
ATTGACCATTGCTCGCCCGTCGATGTTACTGGGCGATCGTAGCAAACAGCGGATGAACGA
AACGCTTTTTGCGCCGCTGTTCCGTTTGTTACCAGGTAACTGGAAATCCATTGATGCGAG
AGACGTGGCGCGGGTCATGCTGGCAGAGTCGATGCGGCCTGAGCATGAAGGCGTGACGAT
TTTAAGCTCTTCAGAATTACGCAAAAGAGCTGAATAATTATTCCCAAGAATTGATAGTGA
GCGTAATATTCACGCGCTCAATTATCATAACTTATTCCTGGGGAATGCTATGACTGGTCA
GTCTTCATCTCAGGCGGCAACGCCCATTCAGTGGTGGAAACCCGCGCTTTTCTTTCTCGT
TGTCATTGCCGGTCTCTGGTATGTGAAATGGGAACCTTACTACGGCAAAGCGTTTACTGC
TGCCGAAACCCACAGTATCGGTAAATCTATCCTTGCGCAGGCGGATGCTAACCCATGGCA
GGCGGCGTTGGATTACGCGATGATCTATTTCCTCGCGGTATGGAAAGCGGCGGTGCTGGG
GGTGATCCTCGGTTCGTTGATTCAGGTGCTGATCCCGCGTGACTGGTTGTTGCGTACGCT
TGGGCAATCGCGCTTTCGCGGCACGCTGCTGGGAACGCTGTTTTCGTTGCCGGGCATGAT
GTGTACCTGCTGTGCGGCTCCGGTCGCGGCGGGAATGCGTCGCCAACAGGTGTCGATGGG
CGGTGCGCTGGCATTCTGGATGGGCAATCCGGTGTTAAACCCGGCGACGCTGGTGTTTAT
GGGCTTTGTCCTCGGCTGGGGTTTTGCGGCGATTCGTCTGGTGGCCGGGCTGGTGATGGT
GTTGCTGATTGCGACGCTGGTGCAAAAATGGGTGCGTGAAACACCGCAAACGCAGGCACC
GGTCGAAATTGACATACCGGAAGCACAGGGCGGGTTTTTTAGCCGCTGGGGCAGGGCGCT
ATGGACGCTTTTCTGGAGTACGATCCCGGTTTACATCCTTGCAGTACTGGTGTTGGGTGC
CGCTCGCGTCTGGTTATTCCCCCATGCCGATGGTGCTGTCGATAACAGCCTGATGTGGGT
GGTGGCGATGGCGGTAGCAGGATGCTTGTTTGTCATTCCCACGGCAGCAGAAATTCCGAT
TGTACAAACGATGATGCTGGCAGGTATGGGAACCGCTCCGGCGCTGGCATTGTTGATGAC
GCTCCCGGCAGTGAGTTTGCCGTCACTGATTATGCTGCGCAAAGCGTTCCCGGCGAAAGC
CTTATGGCTGACAGGGGCGATGGTGGCAGTGTCTGGTGTGATTGTCGGCGGGCTGGCGCT
GTTGTTCTGATTTGAGGGAAAACATGTCGGATGCGGCGTAAACGCCTTATCTGACCTACG
GTTTGTATCGTTGTAGGCCTGATAAGACGCGGCAAGCGTCGCATCAGGCATTACAAGGGG
CTGCTATTTAATAAACGTAAACGCCGTAGTTACCCGCTTCACGCCGCTCACCCGGCTGGC
AATATCTGCCGCCGCTTTCGCTTCACGTTCAGTCACCAGCCCCATCAGGAACACTTCACC
GTTTTCGGTGGTCACTTTCACGTTGGACGATTTCACCAGGTCGCTGGTTAAGAGCTGCGA
ACGCACTTTGGTGGTGATCCACGTATCGTTAGATGCTTCGCCCAGACCAATCGGCTGGCC
CTGACGAATCTCGTTATACACTTCGTTGGCACCGTCTACGCCCATAGCAATCTGTTTGGC
GCGAGCCGAAAGTTCAGCATTTGGTGACTGCCCAACCAGCAGCACTTTGCCCTGATAGGC
CGTTACATTAATGCGCGCTTCTTTCTTAATCTGTTCGTCTTTCGACAATGCGCTGTTCAC
GCGCACTTCCAGGGTACCATCGTCCACCTGGGTGCCGACACTGCGTGGGTCAGTTGCGGC
TTTGGTACCCACAGCAGCGGTACCCACTACGGCAGCGGCAACACAACCTTGCAACAGCAG
CGCGGAAATAAGGACTGCGATTGGCGATAATGCCTTCATGTATTCTCCTTAATCATCCTG
GTGAGGGAAAAGCGTGTTATCGATCAGATCGCACAGGCAATTTACCGTCAGCATATGCAT
TTCCTGAATGCGAGCACTACGATGCGAAGGAATGCGGATCTCCACATCCTGTGGCCCTAA
CAAACCTGCAAGTTCGCCGCCGTCATAGCCGGTCAATGCCACAATGGTCATATCACGCGT
AACGGCGGCTTCAACTGCTTTAACAATATCGCGGCTGTTGCCACGGGTGGAAATGGCTAA
CAATACATCTCCCGCATGACCCAGCGCCCGCACCTGTTTTGCATACACTTCATCATGTAA
GCGATCGTTGGCAATCGCCGTTAAGACAACATTATCAGTATTTAGTGCAATGGCAGGTAA
GCTGGGCCGCTCCGTTTCGAAACGGTTGATCATGCTGGCAGCAAAATGCTGTGCATTGGC
AGCGGAAGTTCCATTACCACAACAGAGGATTTTGTTGCCATTGAGCAGAGACTGAACCAG
CGTCATGGCTGCACGGGAGATGGCATCCGGAAGCGCCTCTGCCGCCGCAATTTGAGTTTG
AATGCTTTCAGTGAAGCAAGCTTTAATTCTTTCTTGCACGCTAATCCTTAAACCTTAATT
ATGAGTGGTCATTAAAGGCATCCTTAATCCACTCAACCTCATTCCCGGTGAAGGCTACCA
CATCGAACCGGCAATCCACAGTATCAAAACTCCCATTATGACGCGCGAGCCACAAGCGGG
CAGTCTGTAATAATTTGTGTTGTTTGCTGCGGGTCACACTGGCTGCCGCGCCGCCATAAA
GCGCAGAGCGGCGATAGCGTACCTCGACAAAAATGGTGGTCCGGCCTTCACGCATTATCA
GATCGATCTCGCCGCCACGCTCGTTCACGTTAGCGGCGATAAACCGCAGTCCTTTGCCTT
CCAGCCAGCGACGCGCTTGTGCTTCCCACGCATCGCCGGTCTGTTTGGTGGTTAACTGAC
GGGGACTACCTGACCTTGTTGGTACTGTAGCCATGATAAGTTCCTGTTAATCACGCAATC
CGGGTTAGCCGTCAGGCTTCCGGTATTACCGTTGATTTCAAAACCCTGAACCTGGCGCAT
TTGTGAGAAATGATTTGCCAGCGACCAGGCATCGACGCCCATCGCATACATGCGAGCCAG
TGAATAATCGTTATTCACCGCGCTGAGTGCCTGCTGCATTAACGGTAGATTACCGCCTGC
CAGCATCGGGATTTCGCTGTACTGCAAGCCTTCCATCTCCAGTCGGAAATCCGGGCCAGC
GGTCCCTTGCGCACTGCGGGAGCTGGCGTACAGCGTTGCACCGCTCTGGCTACCGTTACG
CATGGCGATCATCGGTTTGATAAAAGCGATTTCACCCGGCGTTGCCACAATGTACACCGC
ATCGACACGACCGCCATTATTGGTGAACTGGTCATCGGTTGGCGTGGTTTGCAGCGTTGG
ATTGTTGGTCGTCATGCCGGAGTCGGTTGTCGCTCTGAGAGTAATCGGGCTACCCGTTAA
AGCAATACCAGAACCGCCGTTAACACCCGCGCGTAATTCGCTGGTGGAACCAAATTTTTG
TTGCAGAACGGTGCCGCCGCCCAGTTTCTGCCACTCTTGCGCAAACGCATTGGCTACGCG
ATCGCCCAATGAACTGCGTGGGATCAGCACCAGCGGCGCTTGTTTACCCTGGTCACGAAT
ATGACGCGCTGCATCGCGCGCTTCGTCTTCCGGTGAAAGCGCGAAGTAACAAATATTGAC
GCGATTTTCGATATTCTCCGGCTGGTTCAGTGCCAGTACGTTCAGCGGAGTGTTGCTCTT
CAGCAACTCTTCAACGTTATTTTTCAGCAACGGACCGACCACAATACTCGCGCCATCCTG
CTGAACCTGGCTTAAGATCTGGCTAAGTGGTTGTGATGAGGTATCGTAGATTTTCAGCTC
TGCGGATGGATTTGCGGGTGCGCTTACCGCTGCGGTGCTTGTCGCCGGGGCGCTTACAGG
CACCGGCTGGGCTGCAGGCTGTTCACCGGTCAGATCGCTAACCGAGGCTTGTGCCGGGCT
GGCAACGCCATCCACGGTTTGCGGCTGAGGTTGTTCAGCTACGTCTGCGGCAGGTGCGGC
AGCTACCTGCTGAATAGTGCGACCAAATACCGCTGCCTGGCCATTCAGTGGCAACAGCAG
GGCGATTTTGTTGGTCGAGGCTGGTTTAAACGCTTTTACGTTAACCAACTGCGTTGGCAG
CATTTTCGCGCCCGGATTGTTCGGATAACGTTTCTGCCAGTCGGCGATCCCGGCTTTCAT
CATGTCGGGATCGTTACGGTTATCAAACCAGACGCGCTGCAGATCCAGCCAGCCTTGCAG
AATATTTTCGTCGGCGTTGATCACCAGCGTATTCGCCTGTTCCTGAGTCATGGAGGAGAG
CGCCTGCCAGGTGGCATCAATATTCTGCTGTTTTTCTTTCGCGCCAAGCAGCGGTTCCTG
AGCAATTAACGCGCGCAGTAAATCAATGGAAGGACGCCCCTGGCTGGCATCGATTTTTGC
CTGCCAGTAACGCGCTTGCTGGTTTTGTTCTAAATCGGCAGGTGTGATTTTCGCCAGCAA
GTTTTGCGCGCCAGCAAAATCTTTCTGCGCCAGTTTAATCTCTACCGCCAGCAGTGTTTT
CTCGCGACGCTGAGCATCGTTCAGTTCTTGCGGTAGTTGGTTAAACAACTCAACCGCCTG
CCCGGTTTTACCTTCTTTCACCAGTGCACGAATGGCGAGTAATTGCCAGTTGATCCTGGT
ATCATCAGAGCTTTGCTGCATCTGCTGAAGATAAAAGGCAGAATCAGCCTGCGCCGTGCC
CTGCATATAAGCAGTGGACTGATCGGGAGTATGGGTGCCACAACCGGCGAAAATCAGGGC
TGCCAGAACAACAGGCAGACAACGCGCGGCTTTCAAACGAGAAAATGTTGAGGGTACCAT
AATGTATCCAGTGATATTTTTTTTACGCAATGCTCAATATTAAATCGGCAATACGGACGA
CACAATGAAACAACACCAATCGGCGGATAATTCTCAGGGCCAGCTTTACATTGTACCGAC
GCCAATCGGCAATCTGGCGGATATCACCCAGCGTGCGTTAGAGGTATTACAGGCCGTTGA
TCTGATTGCCGCCGAGGATACTCGTCACACCGGTTTATTGCTGCAACATTTTGGGATTAA
TGCCCGGTTGTTTGCGCTGCACGACCATAACGAACAACAAAAAGCTGAAACGCTGCTGGC
GAAGCTGCAAGAGGGGCAAAACATTGCGCTGGTTTCCGATGCCGGAACGCCGCTAATTAA
CGATCCTGGCTACCATCTGGTGCGTACCTGCCGTGAAGCGGGGATCCGCGTGGTGCCGCT
ACCCGGGCCGTGTGCTGCTATCACTGCGTTAAGCGCAGCGGGTTTACCCTCTGACCGTTT
CTGTTACGAAGGCTTTTTACCTGCCAAATCAAAAGGCCGCCGTGATGCGCTAAAAGCCAT
TGAAGCGGAGCCGCGCACGCTGATTTTTTATGAATCTACCCACCGTCTGTTAGATAGCCT
GGAAGATATCGTTGCGGTATTAGGCGAATCCCGCTACGTGGTTCTGGCGCGTGAGCTGAC
CAAAACCTGGGAAACCATTCACGGCGCGCCCGTTGGCGAGCTGCTGGCGTGGGTAAAGGA
AGATGAAAACCGTCGCAAAGGCGAAATGGTGCTGATTGTCGAAGGTCATAAAGCACAGGA
AGAAGACTTACCCGCCGATGCCCTGCGCACGCTGGCGCTGCTACAGGCAGAACTGCCGCT
GAAAAAAGCGGCGGCGCTGGCCGCAGAAATTCACGGCGTGAAGAAAAATGCGCTGTATAA
GTATGCGCTGGAGCAGCAGGGGTAACAGTGCCGAAGCGTTGCGTTAATCAAAACGCAACG
TCTTCTTTTACCGCACGATGACGGTAATGGTGGCTGTGCCCTGAAATTTTCCTGTTTCCA
GCTCACCACCGACCAGATTAACTGGCCAGGCGCGCATATTGACGGTGCCATGCCCGGAAG
GATCAACGGGAAGGATACCGTTCTGAAAAGGAATATTTGCAACTCCGCCGCCGAGATTTT
CAATACGAATACCGACATCGGGCACATTGTCTGAACTTCTTCGCCTGGCGACCAGGTTGT
ACTGGTCTACTACCCCAGTTGTACCGTCGATGCGCATTTGCAACGAGTTTTTAATCTTTG
AAGTATCACCACAGTCATAAGTGATATCAAAGTCTACTGGAGTAAAACCGTCTGGCATGG
CATTGCGGGTGGTAAACTTCTGACCATTGATGAATCCAAAATTAACCTTAATAACATCGC
CCTGATTAATTTTGCACGACTGTGGGGCGGTGAGATTTCCCTGAATCGATAACTTGACTA
AATCATGGAAGTCACCTGTAGACGGGCTTCCCATTCCATCGACCCACGCGCCTTTAATGA
CGGCAATATCCGTTTTCGGAATGGTCATCGAGCCGAGAAATGGCTTGGTGACATACAGGG
TAAAGGTGGTGTTCGCACCAATATTAACGGGTCCATAACGAGACGTATCACCCTGGCAAA
CACCCGTTTGGGTTGCAGCAGAATATACCGTGTTGTTTTTTATCTGTGTGAATCGGGTGT
TAACAGAGACAACCTGGTCGGTTGTGAGTCCTGGAATGTCGTTTGCCTGTAATGTGGTTT
TAATATCCAGGCTGTCATTGAGTTTGTAATATCCTGTCTGATGTCCAGTGGTGGTAAGTA
CGGGGCTGACCATATAGACAAGTTTAACTGCCTTACCCGCAGAGCAGGAACAGGCGTATT
GCCAGTTAGTGCTACTTAGCGTTGCAGAGGTAAACTCCCGTCCTGTCACGTTATCTGTCT
GGTTCACCGTAACATCATCAACCACACTGCTGTAATTTGTCGCACCGCTAGTGCTGTCGG
CTCCACACCCTCCTGAGGAGGCATAAGCGCAGGATGTGGATATCAACAAAAGACCTGTTA
TAAGAGGCGCTCTTTTCATTTTTTTATCCTTAATGGCACTGCGCTGTGCCTTGTAATACA
GAGGTTGTAGGTTCTGAATCCGGTGTACTGAAAGCAAACTGACATTGTTGATCTGCCTGA
TTTCCCCAGCGTACAGTCCAGCTTTGTGATTTACTCGATATCCCAGAGAGATATAGTATG
CCGCCCTCATCGACGATACTTTGTTGCCCCGTATCATCGTTGCTGGCAAGAGCGCCAAAG
GGCAACGGTTTACCGTTGCGATCGCTGACTGTAACAAGTACGCGATAACCGATATTGGCG
TTGAAACGCGCCGCTACCATTGCACCTCTGTTGGGCACCACAAACTGTGTTGTTTGTTCA
AGATCGACGTTATCGGGCAGCTGCGTAGTATCTACCGAGAGACGGTTTTCCTGATAAGTT
GTGAGATAAGGAACCACTGCATAGCCAAAAGGATCGGTAGCAATCCCCGGATAGTTTTGT
ATCCTCACGCCAGATGCTCCGTTAGCATCGATAAGCGCAAAAGCGTTGCCCAGATATTGC
GAGAGCGTCACGCCATGAGGATGGATAACCACGCCGCCGGTAACGCCGTAATTGTATTGG
CTGCTGTCATTACCGTAGCTGTATCCGGCACTGAAGGTGCCATAAGGTGAACGGTAACTG
GCGTTCAGGCTACTGTTATGGTTGTTATCGTCATCCAGACTTTGTTCCAGGCTATAGCTC
AGGCGACCATCATCCAGCAGTGAGCCATCAAGACGCATTTCATGTTGGGTTGGGCGATCT
TTCTGGCTGGTCATCTGATAGGAAACCCGGCTACGCGGTAACCAGCGTTCTAACGGAATA
CTGAGATTCAAAGAGAGTGCGCGGTCATTATTTTGATCAGTGTAGCGGCTGTATTGATAA
TTCAGGCTGTAACCAACTCCCCATTGCTGGCCGGAAACCCCAACAGAGATATTCCTGTTT
TTATCGTTATTGCCCCAATAGTCTTGCTGCGAACCGGAGGCATACAGACTTACCCCATCA
AATATTGTCTGGCTGATGTTGAATTGAATTTCACTTTTTTGGCGACTGTTATAGTCCCAA
TTGCGGGTATTGGCTTCATTAAAACTAAAATAGCCATCGTTGGTATAGCGATAGTAGCTG
ACAGCGATATTGGTGTTGGTTTCCGGGATATCTTTGATGTACTGCGTACGCCATTGATAG
CCATGAAAAGAGTGCTGGTTATCGAATTGGGTGTCAGCTCTGTTGATATCCATCGACAAC
GCGCCCAGTGCGCCAAGTGTGCCGCCGATACCGATCCCCAGCGCATAATAATCTTCAGAA
CCGAGCAGGCCGCCATACAGCGTAAAAGTATTATTCAAACCATATATTGCCGTGGCTTCA
GCAAATTCGGGTTCCTTGCTATCACTGTTTGCATCAGCGCGATAGCGTCCAGCGGTCGCG
CTATACTTTAGATGCCCAGGTCGCTGCATCATGGGTAATGAAGAATAAGGCTGGATAAAG
CGACGTTGTGTACCGTCACTTTCTTCAATCGTGACTTCTAAATCGCCGCTGTTGGAAGAG
GGGTAGAGATCGTTAATTTCAAAGGCACCCGCTGACACGTTGCTTTGATAGATCACATAA
CCATTTTGCCTGATAGTCACGATTGCACTACTGTTTGCGATACCGCGTACCGTTGGGGCA
AATCCGCGCTGGCTGTTTGGCAACATATTATCGTCGGAAGCGAGTTGCACGCCAGTAAAG
GTGTAGCTGGAAAAAATACTGCCGCTGGTGGCGCTTTCTCCCAGAAGCAACTGAGACTTC
AACGCCTTGATATCACGTTGTAAATAACTACTGATGGTATTCCAGCTTGATGTCTGATCG
TTGCGTGTCCATGTGGAATAGTTGCGTAATCGCCAGGGGCCAAAATTAGCACCATTTTGC
ATATTCAGGTACTGTCGTTGGCTACGATTGCCCTGGCGGTAACGGTTATCAGAACCTGTA
AACGAGTAGTTGGTAAACAGCGTTGGTATACCATCGTCCCAACGAGAAGGGGAGACGTAA
CCTCTTGCATCACGGTACAGTGCAATTTGGGGAATGCTCAAATTAAGTTGCTGATGATTG
AAATCAAATTCAGCAGCTGTACCGGGAATGATTTGTTCAAGCGAGTTGATCACGCTATCG
TCATCTTTTTCAGCCAGCGCCGGGATTTCATCCACCTTAATACCCAGCTCACGTAGTTGT
TCTACCGTAAACTGTGGCTGCAGAAGTTGCTCTGCATTGGCGGTAAATGTAATTTTTTTC
TGTGAAACCTTCTTTTTATTCAGCCAGATATCAACCTGATAAGTTCCTGGTAGTTGTGCA
TATTTTTTTGAAAAACGCGACAGATCGGTTGTTTGCATACCACTTTTTGTGGTTTCCAGC
ATAATGGGGTCGAAATAATACTCTTCGGCGTTAGCGGTAGTGCAAAGCATGCCGCTGCCA
GTGAGCACCATCGGCAAACAACGTTTGATGATGAGCGCCAACTGTTTCGGTGTGCGTTTA
TGTCCCTGGTGGTGTCGTTGTGGCATTCCCTGATGACCTGTGTTTTTATATTTTTTATTG
CAGTGGACGAGTTTCTGTCCCGGAACTGCCGCCATAATCATTGATCGCAGCCCATTTCAC
GTTCTTTCCGCCAGATGCAGGAAGTGGTAACTGTTTATGTTCTCCGGGCGCGATATATTC
AATTTTGCTTGTGAGATCGGTTTTATCGACTGCCAGTCCGGCAAATACGACGTAATATTC
AGTTGGGTTATATATATTGAGTGAATGGTCACTACGTTTAAATTCCAGTGATTTCCACGC
ATCGTTTACCCGTCCCTTCAGGTGTGCGGGGCGATAAAACATTTTGATCCGTGTTTTAAA
TACCAGCGTCAACTCGTTAGCATTAACATCATCTGATTTTTTCTTTGCTGGAATGGCACG
AACATTAATGTAGAACAGCGACTCTTTATTTTCAGGCAGGTTATCAGCTGTTTTAATAAT
TCGCAGTGATGAGTCATCGCCAGCCTCAAGACGAAATAGCGGTGGGGTTATAATAAATGG
GGCACGGCTTTTACCATCTATATTATCTACCCATGATTGCAGTAAATAAGGCGTTTCTGC
GCCTTTGTTTGCGACAGGTAACGCAGCCTCTTTGCGGCTGGCATCATAGATCACTCGCGT
TCGCTGTAAAACGATTCCTCCTGCAAGCGCCTGGCCAATACAGAAGCTACACAACAAGGT
TAATATCACCGCGAATGTTCGTTTTGACATAGTTATTTTTCAACCTGATACAACGAGAAA
GAGGAAGGAAAAGGGCGTTATCTGACAGGTCAGATAACGCCCTAACGTATTAACGGTAAT
CCAGCGTTACGTTAACGATAGCGTCTGCTTCCCCTGGGGTGATTTCTGATGGAACTACGG
TTGATACGTAGTAAGCGATGAGGTCAACATTGACAATACCATTGGATTCCGCCGGGATCT
GATAAACCGTGTTATCATTGCCCATAGCATTCAGTGGCATAATGTTTCCGCTTTCCGCAT
CGTCAATACGGATACCCACACCTGTTGCCGCTATGCCAGCAAAAGAGCCTACTTTTGCCA
GATTAGGGAAGTTAGGGACGGTGCCATTATCTCGCGTTTCCAGCCATAGACGGAAAGACG
CTTCAACGTTGCCGTTATCGTGCTCCCACCCAGTCATTGGGCAGTTAACTAAAGGAATAG
TGAATGGAATTTTTGGGCTACGCTCGCCAATATTACGAAACTGTTCGGCATTATAGTGAC
CAAGAGCAACTTCAATTTTCTTATCAGAGTCATTGATTTCACAAGCGGATTTTAAAATCT
CGCCATCAAAAACTATTTCACCATCGGTTGCAGCGGCATTACCTGCGAAAAGCGCAAGTA
AGCCCGCAATAGCTGTTTTTGTAACTTTATTCATATATAACCTTATCCTTGTAACAAGTA
CATAATCATATTTAATGTGAATATATGTTCAACATCTTTAAAGATTATACAGGCAGAAAT
ATTTCATTGAACATTAAATAGACTGAACTTTAAGATTATATTTATATGCAAATATTTGAT
ATTTTCATTATATTGATATCAATTTTCTATGTATTCAAAAGAGTATAAATGCCTGACTTT
GCTGCGCCAGGGGGCGAGTCAGAATACGAGGTGATTTATTAATAGAACAAGTTATATGTA
TATCTAAAATTAAATTGTTGAACATAACTCCTTTTGCTATCGGCGTTATGTTCAACCCAG
TCAAATGTTATTTAATATAATGCGTGACTGTTACATAAGTTAATTTAAACATTTTGAGCA
AATTTTTCATCTGGTTAGGTGTTAATTAAACAAATAAAGTTACTGTGCAGCCATAAAAAT
GAAGCCGGGATAGCGGTAGAGACTTTAGCCGTGAGAAAACGATCTGTCGCATCCTGCTTT
CCTTCGCCAGTCACCAGTAACAAAACTTCGCGGGCATTGAGAATATCCTTCAGGCCTAAG
GTGATCCCACGAGTCACGGGGCGACCCGCGGTTTTTAACATCTCATGTTGCTGTGTTCTG
GCATCAAGTTGACTGATATGGCAGGCCGGTTGCAGGCTTTCTCCCGGTTCGTTCAGCCCA
AGATGACCGTTTTTCCCCAATCCGAGAACGCATAAATCCAGACCGCCTTTGCGCGCAATC
AGGTTCGTTACCCGTTCGCACTCTGTCTCATTTATCTCTTCGGAGCGAAAGCTGATGAGC
TGGTCTTCACGTAGCCCCAGCGGCTGCACGATATGCTGTTGCAGGAAAGTTTCGCAGGTG
CCTGGCATCGTTAATGGCAGATCCACCCATTCGTCGAGCTTCACGAAGGTGAGCTGGCTG
ACATCAACCTGCTGCTGGTGGATTTTTTCTACCAGATAATGATACGTCAGTAATGGCGTG
GCTCCGGTCGCCAGGCAAATCACGGCATTCGGTTTGCTACGGATCACGGCCAATAAATAT
TCGCTGGCACGTTCACTTAACGCCGTATAGTTTTCAACTTGCTGAAGGGTTTGCACAGGA
TGAAATTCCTTAAGTAAAGAGGCACCACCAGACGCAGTGCCTCGTTCCATTTACAAAATG
CCGAATGCGGAACAAACAATAGAGAGCACAAAAGTCACGCCGATTAACAGCACCGGATGC
GCTTTTTTCACCCGCAGGAAGTAATACATCAGCAGGGTGTAGGCCATCGGTAAAATGTTC
GGGAAGACTTTATCGAAGAAATCCTGCTGCAGCGCAACGCTGTGGGTATTGTCGATGGCA
AACGATGTCACCACGTTAATATGCACATACGAAGCGATCAGCCCGCCGATTACCGTGATC
CCGAGGATGGTTGCCGAACGGGCAATCATCTGCGAGTTCTCTCGCACTTTATCGATCGCC
TTCACGCCGACTGAATAACCGACGTGGGTCCAGCCGACGCGCAGGAAAAAGATAAGCAGG
TAAACGGCGAAAAATAGAATCGGCCCCAGCAGGTTTCCCTGGCTGGCAAATGATGAGCAA
ATTCCCGCCATAATCGGCAACAAAGTAAACCAGAAAATCGCATCGCCAATCCCGGCGATT
GGGCCAAACAGTGCCACTTTGAGGCCTTTAATGGTGTCGCGGTTTTCTCCTTTTTCTTCC
ATCGAAATTAATAACCCCATCAGGAATCCGACCAGATTCGGGTGGGTATTAATAAATTCG
AGGTTATCTTTCATCGCCGCGCTTAAGCCCGGTTTGTCGTCCTTATAAATCTTTTTCAGG
ATCGGCAACATCGCCCAGGTAAAACCGCCCGCCTGCATCCTTTCGTAGTTAAAGCTCGCT
TGCAGCAGCGACGAACGAAAGCCCAGACGGGTGATATCTTTTTTACTGATTTCAGATCCC
ATTGCTGTAGTCCTCTTCTTCATTTTTACTGGCAACGGGCTGCGGTTGCGCTTGCTGCCG
GGATTTCGCATTGAAAAACTCATACACCGCAAAGCCTGCGCCCAGTACGGCAACCGGCAA
CAGGTTGCTGACCTGGATGTAGCAAACAAACAGGAAACCGGCGATCAGGTAAGGGATATA
TTGCGCTTTGAACATTACGCGCAGCAGCAAGCCAAAACCAACGGCAGGCAGAATACCGCC
AGCCACTTCAAAGCCGTGGGTCAGCCAGGCGGGCATCGCTTTCACCAGCGCCTGCATCGC
CCCCTGTGCCAGGTAAGTACAGAGGAAAGCAATCACCGCATACGCTGAAGCGACGATGAG
CATCGTTGTCCAGTTAAGCCGGGAAAACGCTGCCGTATCCGCCTCTTTCGCGCATTTATC
GGCTTTGGTCATAAATAATGAGAAAGCGGAATAGAAGAACAGAATGACGTACTGCATTAA
CAAACTAAACGGCAGGCCAAGACCAATTGCTGTTTTGGCATCAACGCCCGTAGACCATGC
AATGACGGTGGTCATCAGACCCGCCATAATCGGGTTGGGCGGCTGAACACCACCTGCAGG
GGTTAATCCGGCGAAAGCCAACTCTGTCAGACCACCGGTAATTAAGCCAGTCTGAATATC
ACCGAGAATAGCGCCAGTTAGGGTACAAACGATTATCGGGCGGAATAAAAATAAGGCTTC
CAGCCAAAAATCAATCCCCAGAACAAAAACTAACGCCGCCAGGGATAATCCCTGAAGTAG
GGTTATTTCATGCATTTTTATTACCTCAAACCAATATTAAGGCGATTTTAGATTTAGTCA
GGGATTTGTTCTTTTTGATCGCCAGGGACGTCCTGAATGAAAACATTCACGCCACGTTGT
TTAATAAAACGTAAGTCCGTGAGATCCTGGTCATCGACATAAACTTTACTGCTGATTTGC
TTTTTCCCTTCCGAGAAATGCATATTGCCGACGTTGACATCTTTCAGGTCAATACCACCT
TCTACCAATTTACGTACCGTTTGTGGCGTACGGCAAATCAGGAAGATCTTCTGATGTGGT
GCAGCTTTGCCGATGACGTTAATGGTTTTTTCGATAGTAAAGAAACGAATGCCAAAGCCG
TAGGTTTCCGCGGTAATACCCATTAATTTCTGTTGAATATCATCGTTAGCGACAACATCA
TCCACGACTACCAGCAGATTTGCACCGATGGTGGATGTCCAGGTCACGCCAACCTGACCG
TGAACCAGACGGTTATCAATACGGGTTAAGAGAATATTTGGACTGGTCATTGTGTAATCC
TCACCATAAAGTTGAATAATATAATTTTTTTAAATATATTATTGTTGCGATATTGTAGTG
ATGTATTTATTAAGGTTTAGTTATCTCCTTTTCCATTAAGGCACTCCCCGATATTAATCG
GGAAGTACATTGGGATAAATCATAAAAAACTAATGATTATGCTGAAATTCGATTCGCTGA
ACCACAGACATTAATTTTATTTCTGACAACTTCTTTCATCGCATCCATTCCGACGCGCAT
ATAATAACGAGGATCATTACCCTGCGGATTTTCCGCAAACCAGGCTTTAACCGCGCCAGC
GAAGGCTATTTTTAATTCTGTGGCAACGTTCACTTTTGTGACGCCAAGTTCAATAGTGCG
ACGGACAAATTCATCCGGAACATCGCTGGCACCATGCAGCACCAGAGGAACATCCACCAC
TTCACGAATTTCCGCCAGCCGCTGGAAATCAATCTTCGGCGTTTTGCTGTATAAGCCGTG
CGCCGTACCAATCGCTACCGCCAGGCTGTCGACGCCAGTCAGTTCGACAAAGCGTTTAGC
TTCTTGTGGATCGGTCAGGAATGCACTTTCGGCGTCAACGCTCATGTCATCTTCAACACC
GCCCAGGCGGCCCAGTTCTGCTTCCACGCTGCAATCTTGTGAGTGGCAGAAGTCAACAAC
CGATTTCACCAGCTTCACGTTCTCGGCAAACGGGAAGTGGCTGCCGTCGATCATCGCACT
GCGCACACCTGCGTGGACTTTACGGCGAATATCATCCAGCGATTCGTGGTGGTCGAGATG
CAGCGCCAGTGGCATGTTGTAGGTTGTGGAATAGGCGCTACACAGGGCGTAGATCTCTTC
CAGCGCGATGTGTTTAAAGGTCCCCGGCGTTCCGGCGAGGATCACCGGCGATCGCATTTC
ACTGCACACTTCGAGGATCGCTTGGATCGTCTCGGCGTTATGAATGTTAAAAGCAGGCAC
CGCGTAGCCATTGGCCTGGGCGTCCTGTAACAGATATTTAGTGGAGATAATGCTCATAAT
GCGATCCTCTTATGCCTGCCACGGATGAATGATTACGCCTTGCACCACGCGGTTAACGGT
GCCACTGGCTGATGGGGTATCCGGCGTATTGCCCATGTGCAGCGACTGCATCAGTGCAAA
CGTCTGGGCGTACATCAGGAAGCAAAATGCCTGCTCAACGTCGATAAAGTGACGTGACGG
TGGCAGGATGATATGTGGACCGGCAGCGACGATGTCGCTGCTTTCCGCGGCGATGGCGAT
TACACGCATTGCCTGGTTGTCACGGCGAAGTTCAGCCAGCAGATCAAGATCATACTGACG
GGTGTAAGGGTGGCTGGAGACAAATACCACCACCAGCGTTTCGTCATCGACCAGCGATTT
TGGTCCATGACGGAATCCGGTTGGAGAATCATAAAAGGCCGCCAGTTTACCCGCCGTCAG
TTCCAGCACTTTCAGCGCCGACTCGCGTGCTGCGCCCTGTAAGCCACCGCTACCGAGATA
AACGATCCGTTTCCACGGTGCGTAACCAAACACACCTTCGCTGAAATCGCCCAGTGAGGT
CAGGATCGCCTGGCAACGATCCGCCACGTCGCGGAAGGTTTGGCTGTTGATCGTCTCAGG
TGCGAAAACCGCGAGGCAGCTGGCCATCATGGTGGTAATGCTGCTGGTCATCGCAAAGCC
GCGATCGTGCGTTTCTGCGGGCATCAGCAGGGCAAACGCGTTATCGCTGTTGATCGCGTT
TTGGTAAAGAGCGCCCGCTTCGTTGCAGGTGATCGGCAGGTGATAGCATTCCGGTACAAA
TTGATTTGCCAGTTCCACGGCTGCGACGCTTTCCGGGCTGTTGCCGGATCGACCGAAGGA
GATCAACAGCAGCGGATGAGCTGGGTTCAGGTAGTCCATCGGATTGGTGACCAGATCGGT
GGTCGGTACGGCGCTGAAGTTTTTACCGGTATGGCTGGCGAGCCACGGCGCGATGATGTC
ACCGATAAATGCCGACGTTCCGGCTCCGGTCAGGATGATCCGCAGATTCTCTTTGCGCAG
TAACGGTTCAAGGAAGTTATTGAGCGCGGAACGTAGCGCGTCGATGTTGGTGAGTGAACG
GATCCATGCGCGAGGCTGATGGCGGATCTCTTCTTCAGTCCATGTACCGGTTGCGGCGGC
AGCAGGGGTGTAATTTTCTGGCATAACTCAATCCTTAGTCTGATGAACTTGACGTCGGGC
GTTGTCGCTTTCACTTGCCTTTCGTTTCATTTCACTTGGTGATGTCTTTCGTTGATTAAA
ATCTATAGAAAAGAAACTGAAAGTTCAATGGAGAAAAAAGAAATAAAACGAAATTTGTGA
TCGTTGAAAGAAAAGATAAAGGAAGCAAAAGGGATTGCTGGATGCGGCGCAAACGCTTTA
TCCGGCCTTGCGGTCACCAACTGTAGGTCGGATAAGACGCGTTAGCGTCGCATCCGACAC
CGCTGCACAGATCAAAACGAAAGAAAAAGAAAGGCCTTACGGGGGAAGTGAAGGCCCAAT
AAAGGAGCAAACTATCAAAACGAAGCTAATTGACCCTGAATCCAGATTTGTTGCACATGT
AGCCCGCTATCCAGCGCAACGACGCTGGCGCGTTTGCCCGGTTTAAGCGATCCCAGAACA
CCATCAACACCCAGCATTCGCGCCGGATGCAGCGACGCCATATGGATGGCTTCCGCAGGC
GTTACGCCCGTCAACTCGACCATATTGCGCACTGCCGCATCAACAGACAGCGTACTGCCC
GCCAGCCCACCAGACGCGGTACGGACAACGCCACCGTGCATCTGCACTTCTTCACCACAT
AACGTATAGCGACCATCCGGCATCCCAGCTGCCTGCATCGCGTCGGTGATCAGTACGATT
CTCTCTTTCGCACAGCAACAACACAGCGACATTGCCGCCGGATGCACATGATGACCATCG
GCTATCAGTTCCAGCCAGGCGCGCTTGTCCGTTAATCCCGCGCCAACCATTCCCGGTTCG
CGGTGATGTAAACCTGTCATCCCGTTATAGCAATGCACCAGGCCGTCGGCACCAGCATCA
AATGCGGCGCGGGTTTGTTGCCAGGTCGCAGCGAGACATCACGCCGGACATCACCGAGAA
CAGGAAGGTAATCCCCATCTGTACTGCGACAGCGAAAGGTACGGCGACACCTACTGCGAC
ATCGGGTTTCACGCCAGTAGTAATGGCAAACGCCGTGCCGACGATAGTACCGATAATCAC
GTTAGGCGGCTGTGCGCCCGCCAGCGGGGCCAGCCCCATCCACACCAGTTCCAGCGTACC
GCCGGTTAAAATTCCGGTATGCAGATCGCCAAGTACCAGCCCGACCAACGGGCCGAGGAC
CACCGGGCGGTGCATATGGGTTAGGCCGTTAAACATATCCAGGCCAGCGATAAAGGCGAT
AATGCCCAACGCAAATGCCTGCAACAGGCTGATTTCCATGATGAATCCCTCAAAGTAATT
TAAAGAGGTCCACAGCAGGCTCTGTCGGGACGCCCTGAACGAAGCATTCCACCCCAGCGG
TTTTCAGGTCGTTAAATGCTGCGATATCGCCCGCATCCACAGAAACCGTTTTGGCGATTT
GTTGTTTGCCATTGGCGTAGTGCATATTGCCAACGTTAATGCGATTCACCGGAACGCCAC
CTTTCACCAGCGTCAGGAAATCGGCGGGTGTTTTACAAACCAGCAGGATTTTCTGTCGAT
CGGCGGCGCGATGAATGTTGTCGATAACTTTTTGCAGCGTCCAGAAACGTACGGCGATCC
CTTCTGCCAGTACCATTTCCATCAGGTTTTGTTGTACCGGATCTTCGGCAACCTCATCGT
TGGCTACCAGCACCAGATTTGCCCCCGCAAATCCGACCCATTGAACGCCGACCTGACCGT
GAATCAAGCGTTCATCAATCCGGCTTAAAACAATATTTGGCATAGCGTGTTCCTCTTTGT
TTTGCTTATTGGCCTTCACAGGCTGTGTGGTACTGCGCCAGGATGTCCTGAATATGGTTG
ATAATGAGTTCCCGTGGCGTTGGCTGCAGCTCGCCGGAGCGAACTTTCACGTACTGCAGC
GGCAGATACTGGCTGATCAGCGGCAGCGGAATTGGTGAATCCGCCAGATTACGTACCAGA
TGAGCGAAAGCGTCATCAATCTGGCTGTCCGGCCAGTAATAGCGCACGCGATCCGAGTAG
CTATAACCACGCGCCAGACGACGCGCGTTGCCGTCACCGTGGTAGTGGCTTTGCCAGTAT
TCCGGGCGGTCGAGCATCACGTCTTCCAGCACCTGACGCAGACCAGAACAGGCTTTCGCT
GGCACCAGTTCTTCTTCAATCGCCGCCAGAGAGAACAGAGCTTCACGCAGGGCGAAGGTC
AGCGCTGGGCCAACTTTCAGAATGGCAAAGTGGTCAATCACCAGCTGGCGCAGCGATTGC
GGCGTTTGATAATCGGTAGAGTGCGCTTCGAAAATCAGCGTTTCGTAGTTTTCGACCATC
TGGCTTAAGGCGCTCGCTTTGGCGGGCTGATAATCAATAACGTTGGTGTGATCGAATTCG
ACGCCGGGTTGAACCACCAGGGCAATGATGCGTGGCCAGATGGCATTCAAACCTTGCTTT
TCAAAGGCGTGACGATGGGCTTCCAGCGTGGCGCGGGCGGCATCCGGCGTGGTGACCGCC
AGCTCGCTTAAGGTTTCATGCGCGCCGCCAGGTACCGGCACTTCGGTACCAATGACATAC
TCCAGATCGGCTTCGCCAAAGTGTTCAAGACAGGTTTCTTCCGCCACTTTCGCCAGACGG
GCGGCGCGTTCAGCCACGATGTCATCAGTTAAGGGAATCGGATCGTCCTGACAGGACATG
CTGCAATCAAGGTGGATTTTTTTGAATCCTGCCGCAACGTAGCTTTTAATCAAATCATCG
GCATTGGCCATTGCCTGAGCGGCCGGCAGGTTTTGCCAGCGGTTTGGCCCCAGATGGTCA
CCACCCAGAATCAACGCATCCTGCGGGAAATTCAACGAGTCGGCGAGCTGACAAACAAAG
CCGCGAAAATCGGCGGGCGTCATTCCGGTATAACCGCCGAACTGGTCTACCTGATTGGAG
GTTGCTTCAATCAGTAACGGCGTTTGGTTTGCACTGGCGTAGCGGATTGCAGCTTCCAGC
ACCAGCGGATGTGCGGAACAAACGGCATAAATTCCATTTGTTTTGCCCGCTTTGTGCTGT
CTCACCATTTCTGTCAGATGTTTCACTTTCCTCTCCAGTTCAGATTACTGCGATATTAAT
CTTTCGTTTTGTTTCAGTTGATACTGCGTCATGGTGAGATAAAAATAAAACGAAAGATAA
TGGTTTTCTGATCTGATTCACAAAAGAAACATAATGAAAGTCACTGAAACGAGAGTAGCT
TGCGTCAATGGGCAAGGTGGGCTTGCATTTGCTTAATAGAAAGGCGTTAATAGGCAAAAC
GAAATGAAACGAAAGTTTTACGAAAGGACTTACTATGAGTAATACCGACGCTTCAGGTGA
GAAGCGAGTGACTGGCACCAGCGAGCGACGAGAACAGATCATTCAGCGTCTGCGACAGCA
AGGGAGTGTGCAGGTTAACGATCTGTCGGCATTGTATGGCGTATCTACTGTGACGATCCG
CAACGATCTGGCGTTTCTGGAAAAGCAGGGGATCGCTGTGCGTGCCTATGGTGGCGCGTT
GATCTGCGATAGCACGACGCCGTCAGTCGAGCCATCAGTGGAAGATAAAAGCGCACTGAA
CACCGCGATGAAACGCAGCGTTGCGAAAGCTGCCGTTGAGTTGATTCAGCCAGGTCATCG
GGTTATCCTCGATTCCGGGACCACCACTTTTGAGATTGCTCGTCTGATGCGCAAGCACAC
TGACGTAATTGCGATGACCAACGGTATGAACGTGGCTAATGCGTTGCTGGAAGCGGAAGG
CGTTGAGCTGCTGATGACCGGCGGGCATTTGCGCCGTCAGTCGCAATCTTTTTACGGCGA
TCAGGCTGAGCAATCGCTGCAAAATTACCACTTCGATATGCTGTTTCTTGGTGTAGATGC
GATCGATCTGGAGCGCGGCGTCAGCACACATAATGAAGATGAAGCTCGTTTAAACCGTCG
GATGTGCGAAGTTGCGGAACGGATCATCGTGGTCACCGATTCCAGTAAGTTCAATCGTTC
CAGTTTACATAAGATCATTGATACTCAACGTATCGACATGATCATTGTTGATGAAGGCAT
TCCTGCGGATAGCCTGGAAGGACTGCGAAAGGCTGGGGTTGAAGTGATTCTGGTCGGGGA
GTGAGAAAGGATGCCCGCTGGTCAACACGAATGCGTTCGGCGGGCATTGTGAACACCATC
AATGGGTTTCTTCTGTTTCTCGGGTGAGGGTTTCCCAGTCGGCAGGAGGATGTCCTCTTT
TTAACATTTTGCTGAATACGGTATAGGCATCTGTTTTTTTACCGTAGGTGCGCAGAGTGT
TTTCATCGTTCATCCATCCCAGAATGATGACTTTCTCTTTTTCACTATAACGAAAGAAGA
GACGATAACGACCAGCACCAAATTTTACCCGTGACCAGTCTTTATTTTTCCCAGAGCCTA
ACGACTTGCCATGACGGAATGCCGGTGATGATGGATTGACCGTGATATGCTCCTCAATCA
CTTTATGGACTACCGCCAATAACTTTGTGGCGGCTTTTCTCTGATAATTTTCAGGATCTT
TTCCCTTTAATGTCTCGACTTCGGCAACTAAAGCGTCGTAGGTTTCCTGAAAACAGGGAT
GAGCATATAGCGCCCAACCATTAACCCTTTGTGGAAAATCCATTATTCGTCGTCGCCAAT
CTCATCATCAATGTTGACGTCCATGCCAGCGACAAGTTTCTTTCCTTGTTGAATGTTGAA
TGGACGAGTTTTTTGCGGGTTGTTCTGGATATCTGCATCCAGAAAACGCAAAAATGCATT
CATAGTATGATCCTCCTGTTCATCTCCCAGTCGGCACATAAATACTTGCCCACCAGGCAG
AATTTCGTAATGAATGCTGTCCTGGCCTGGCTTCAGTTTTAAGGCCTCACGCACTGGCGC
GGGGATAGTTGTTTGTCCGCGTATCGTGACCTTTGATTCAGTGGTCAGTACAGCGTGAGA
GCGAGCATTAGCGGGCATGATTCACTGTCCTTTTACAGCCTGTTTTCTGCTCAAATTATA
AGCTTGAACTAAGGTAATGCAAATGCATTATTAATGGACGTGGGGGCTTTAAACAATAAA
AACATGGCACTAAGGCCATGTTTTGCGAGGGACGTTCCAAAAGAAATCAGGTCACCGGTG
CCGGGTTAAACACCGCCAGCTGGTTATGCAGCCCCCATTGATCCGAGAAGGTTTTCTTCT
TCCCGCTGGCGACGTCGAGAATAAAGTGGAACAACTTCCAGCCCACCTCTTCAATAGTTT
CTTCGCCGGTAGCGATGGTGCCCGCATTAATATCCATTAAATCAAACCAGCGGTTCGCCA
GCTCGGTGCGGGTTGCCATTTTAATGACGGGTACCGCCATCAGGCCGTACGGCGTACCAC
GACCGGTCGTAAACACTTGCACTGTGATACCCGAAGCCACCTGTTGCGTGCCACAGACAA
AATCGCTGGCTGGCGTCGCGGCGTAAATTAATCCGCGTTTAGTCGGGCGTTGACCGGGCG
ACAGCACTTCAACAATTGCGCTTTTACCCGATTTAGCAATGGAGCCGAGTGCCTTCTCTA
CCACGTTTGCCAGACCGCCTTTCTTGTTGCCCGGCGAAGGGTTGGCGCTGCGGTCGGTTT
TTCCCATATTGAGATAGTTATCGTACCACTCCATCTCCTCCAGCAGCCGTTTGCCGACCT
CTTCGTTCACTGCGCGTGGTGTCAGCAGATGGATCGCGTCACGCACTTCCGTTACTTCTG
AAAACATCACCGTTGCGCCGCAGCGCACCAGTAGATCAGACGCATAGCCAACCGCCGGGT
TTGCCGTTACACCAGAAAACGCATCGCTGCCACCGCACTGCATACCAACGACCAGTTCTG
AAGCCGGGCAGGTTTCTCGCTGCCGTTGATTCAGTTTTTGTAGATGGCGTTCGGCGATCT
GCAAAATATCCTCGACCATGGACTGAAAACCGACATGCTTTTCATCCTGCAAACTGACAA
TGCTGGCGCTTTCTACTGGAATAGCTTGCACATCATCCGTTCCAGTCAGCAGGCGCTCAG
GCTGCAACTTTTCACAACCCAGGCCAATCACCATTACTTCGCCGCCAAAGTTAGGATTCA
GCGAAATATTGTGAATGGTACGGATAGGTACAACTGCCGCCGGTGCGTTAATCGCCACGC
CACAACCGTACAAATGATTCAGCCCCACCACGCCATCGACGTTCGGGTATTTCGGTAGCA
GATCGCGTTCAATGATTTTTACTACATAGTCCACCACGCCTGCCACACAGTGGACGCTGG
TGGTGATACCGAGCAGGTTTTTGGTGCCCACGCTGCCATCGGCATTGCGATAGCCCTCAA
AGGTGTATCCTTCCAGCGGCGGTAAGGGTTCCGGGACTTTGGTTGCCAGTGGCAGCGTGT
GTAACGGCGGCGCTTCCGGTAGTACAACCATTGATTCGTCGATCCAGCTTCCGCGTGGGA
TTGCACGCACGGCGTAACCAATCACTTCGCCATAACGAATAATTTCACCATTAGCCGGAA
TGTCCAGCAATGCGACTTTATGCCCCTGGGGAATATGTTCAATTAATTCCAGCCCATCCG
GAAAACGCGTTCCTGCTTTCAGGCCATTATCATTAACAATAATTGCCACATTATCTGTGT
CGTGAACTTTTATATAAAACGCAGTTGGCGTTTCTTGTCTGATTTCGATGTTGGCCATTG
TGCAATATTCTCCAGCCAGGGGTTATTAAAATGAGGACCTGGTCTCATTTAAAAATAAAT
GACTTCATTGGGTGAAATAAGAATGTCAGGAGTTTAAACGCAGAAATGTGATCAATGTCA
ATCATTTCAGGGATTGCAGTGCCGCCCGGTAAGGTAAAGCGCAAATCTGTGCTTTAGCGC
GCAACCTTATGTGCATATGCTCAAAATAATATTTAAATAGTATTAATTAAATTAGCATTT
GCACAATGATTATTATTCTCGCGCTGCTTATACTAATTCCCGAGTTCATTGTCGTTACGG
CATAAATGAAACTCATAAATAACACCTTCCCCATAATAATAAAAATCAGCATAAGTACCC
GAGGTAAATAAAATGATTCTGGACACCGTTGACGAAAAAAAGAAAGGCGTGCATACCCGC
TATTTAATATTACTGATTATTTTTATTGTTACCGCCGTTAACTACGCCGATCGTGCAACG
CTGTCTATTGCTGGTACCGAAGTGGCAAAAGAGTTGCAGTTAAGTGCGGTTTCGATGGGT
TACATCTTCTCCGCTTTTGGCTGGGCCTACTTGCTGATGCAAATCCCCGGCGGCTGGCTG
CTTGATAAGTTTGGCTCGAAAAAAGTTTACACCTACAGCCTCTTTTTCTGGTCGCTATTC
ACCTTCCTGCAAGGCTTTGTTGATATGTTCCCGCTGGCCTGGGCAGGGATCTCCATGTTC
TTTATGCGCTTTATGCTCGGCTTCTCGGAAGCGCCATCATTCCCGGCGAACGCCCGAATT
GTCGCCGCCTGGTTCCCGACGAAAGAACGTGGTACTGCCTCCGCCATCTTTAACTCGGCG
CAATATTTCTCGCTGGCGCTCTTTTCGCCGCTGCTTGGCTGGCTGACTTTCGCCTGGGGC
TGGGAGCACGTCTTTACCGTTATGGGGGTGATTGGTTTTGTGCTGACGGCGCTGTGGATC
AAGTTGATTCATAACCCGACAGATCACCCACGTATGTCTGCGGAAGAGCTGAAGTTTATC
TCTGAAAATGGCGCGGTGGTCGATATGGACCACAAAAAGCCGGGCAGTGCGGCAGCAAGC
GGACCCAAACTGCATTACATCAAGCAATTGCTCTCTAACCGCATGATGCTGGGCGTATTT
TTCGGACAATATTTTATCAACACCATCACCTGGTTCTTCCTCACCTGGTTCCCGATTTAT
CTGGTGCAGGAAAAAGGCATGTCGATTCTGAAAGTGGGTCTGGTCGCCTCGATTCCAGCA
CTGTGTGGTTTTGCGGGCGGCGTGCTGGGAGGTGTCTTCTCGGATTATCTGATCAAACGC
GGTTTATCCCTGACCCTGGCACGTAAGCTACCGATTGTGCTGGGAATGTTGCTGGCTTCC
ACCATCATCTTATGTAACTACACCAACAACACCACGCTGGTGGTCATGCTGATGGCGCTG
GCTTTCTTTGGCAAAGGATTTGGTGCGCTGGGCTGGCCGGTGATTTCTGACACCGCGCCG
AAAGAGATTGTTGGCCTCTGCGGCGGCGTCTTTAACGTCTTTGGCAATGTTGCCTCCATT
GTCACTCCACTGGTGATTGGCTACCTGGTAAGTGAACTGCACTCCTTCAATGCAGCACTG
GTTTTCGTGGGATGTTCAGCGCTGATGGCGATGGTCTGCTACCTCTTCGTAGTTGGCGAC
ATTAAACGTATGGAATTGCAGAAATAAGCAAAGGTATAAGCGATGAATAACGATGTTTTC
CCGAATAAATTCAAAGCCGCACTGGCTGCGAAACAGGTACAAATTGGTTGCTGGTCAGCA
CTCTCTAACCCGATTAGCACTGAAGTTCTTGGTTTGGCTGGGTTTGACTGGCTGGTGCTG
GATGGCGAACATGCGCCAAACGATATCTCCACGTTTATTCCGCAGTTAATGGCCTTGAAA
GGCAGCGCCAGCGCGCCAGTAGTGCGAGTGCCGACCAACGAGCCGGTAATTATTAAGCGT
CTTCTGGATATCGGTTTCTATAACTTCCTGATTCCTTTTGTAGAAACAAAAGAGGAAGCA
GAGCTGGCGGTGGCATCAACCCGTTACCCACCGGAAGGCATTCGCGGCGTCTCCGTTTCT
CACCGCGCCAATATGTTTGGCACCGTGGCGGATTATTTCGCTCAGTCGAACAAGAACATC
ACTATTCTGGTCCAGATAGAAAGTCAGCAGGGCGTAGATAACGTCGATGCCATTGCCGCT
ACCGAAGGCGTAGACGGCATCTTCGTCGGCCCCAGCGATCTGGCCGCGGCATTAGGCCAT
CTCGGCAATGCATCACACCCGGATGTACAAAAAGCAATTCAGCACATTTTTAACCGTGCC
AGCGCGCACGGCAAACCCAGCGGTATCCTCGCGCCGGTCGAAGCCGATGCGCGTCGTTAT
CTGGAATGGGGCGCGACGTTTGTGGCTGTCGGCAGCGATCTCGGCGTCTTCCGCTCTGCC
ACTCAGAAACTGGCTGATACCTTTAAAAAATAACCACCACCGCAACAAGAGAGATGATTG
ATATGACTATGAAAGTTGGTTTTATTGGCCTGGGGATTATGGGTAAACCAATGAGTAAAA
ACCTTCTGAAAGCAGGTTACTCGCTGGTGGTTGCTGACCGTAACCCAGAAGCTATTGCTG
ACGTGATTGCTGCAGGTGCAGAAACAGCGTCTACGGCTAAAGCGATCGCTGAACAGTGCG
ACGTCATCATAACCATGCTGCCAAACTCCCCTCATGTGAAAGAGGTGGCGCTGGGTGAGA
ATGGCATTATTGAAGGCGCGAAGCCAGGTACGGTATTGATCGATATGAGTTCTATCGCAC
CGCTGGCAAGCCGTGAAATCAGCGAAGCGCTGAAAGCGAAAGGCATTGATATGCTGGATG
CTCCGGTGAGCGGCGGTGAACCGAAAGCCATCGACGGTACGCTGTCAGTGATGGTGGGCG
GCGACAAGGCTATTTTCGACAAATACTATGATTTGATGAAAGCGATGGCGGGTTCCGTGG
TGCATACCGGGGAAATCGGTGCAGGTAACGTCACCAAACTGGCAAATCAGGTCATTGTGG
CGCTGAATATTGCCGCGATGTCAGAAGCGTTAACGCTGGCAACTAAAGCGGGCGTTAACC
CGGACCTGGTTTATCAGGCAATTCGCGGTGGACTGGCGGGCAGTACCGTGCTGGATGCCA
AAGCGCCGATGGTGATGGACCGCAACTTCAAGCCGGGCTTCCGTATTGATCTGCATATTA
AGGATCTGGCGAATGCGCTGGATACTTCTCACGGCGTCGGCGCACAACTGCCGCTCACAG
CTGCGGTTATGGAGATGATGCAGGCACTGCGAGCAGATGGTTTAGGAACGGCGGATCATA
GCGCCCTGGCGTGCTACTACGAAAAACTGGCGAAAGTCGAAGTTACTCGTTAATGACGTC
GTGCCCGGATGGCGTATTGCAATCCGGGCCTGGAATCCAGGCCGAATAAGAGAAACGCCC
TCCGGCGTCATGTGGTAACAGGCATAGGTATGAAAATCGTAATCGCCCCAGACTCTTATA
AAGAAAGTTTATCTGCCAGCGAGGTTGCGCAGGCGATAGAAAAAGGATTTCGGGAAATTT
TTCCTGATGCACAGTACGTTTCTGTTCCGGTTGCCGACGGTGGCGAAGGAACGGTGGAAG
CGATGATTGCAGCCACCCAGGGGGCTGAACGTCACGCCTGGGTTACAGGGCCGCTGGGCG
AGAAAGTGAATGCCAGTTGGGGGATCTCCGGCGATGGCAAAACCGCGTTTATTGAAATGG
CGGCGGCCAGTGGGCTGGAGCTGGTACCTGCGGAAAAACGCGATCCACTCGTGACCACTT
CACGCGGCACAGGCGAGTTAATCCTGCAGGCGCTGGAGAGCGGTGCGACAAACATTATTA
TCGGCATTGGCGGCAGCGCTACAAATGATGGCGGCGCAGGCATGGTACAGGCGCTGGGGG
CGAAATTATGCGACGCCAACGGCAATGAAATTGGTTTTGGCGGCGGTAGTCTTAATACTC
TGAATGATATTGATATTTCCGGCCTCGATCCGCGCTTAAAAGATTGCGTCATTCGCGTCG
CTTGTGATGTCACCAATCCGCTGGTGGGCGATAACGGCGCATCGCGCATCTTTGGCCCAC
AAAAGGGAGCCAGTGAAGCGATGATTGTTGAGCTGGACAATAACCTCTCTCACTATGCCG
AGGTCATTAAAAAAGCGCTGCATGTTGATGTGAAAGATGTCCCCGGTGCAGGAGCTGCGG
GTGGTATGGGCGCGGCGCTAATGGCGTTTCTTGGTGCGGAACTGAAAAGTGGTATTGAAA
TCGTCACTACGGCGCTGAATCTGGAGGAACATATTCACGATTGTACGCTGGTGATCACCG
GTGAAGGGCGTATTGACAGCCAGAGTATTCACGGGAAGGTACCGATTGGTGTCGCAAACG
TGGCGAAGAAGTACCATAAACCGGTGATTGGCATTGCGGGTAGCCTGACCGATGATGTTG
GCGTTGTACATCAGCATGGCATTGATGCGGTCTTCAGCGTATTGACCAGCATAGGTACGT
TGGACGAAGCATTCCGCGGGGCTTATGACAATATCTGCCGTGCTTCACGTAATATCGCCG
CGACACTGGCGATTGGAATGCGCAACGCGGGGTGACAAGGGCGCGCAAACCCTCTATACT
GCGCGCCGAAGCTGACCAGACAGTCGCCGCTTCGTCGTCGTCCTCTTCGGGGGAGACGGG
CGGAGGGGAGGAAAGTCCGGGCTCCATAGGGCAGGGTGCCAGGTAACGCCTGGGGGGGAA
ACCCACGACCAGTGCAACAGAGAGCAAACCGCCGATGGCCCGCGCAAGCGGGATCAGGTA
AGGGTGAAAGGGTGCGGTAAGAGCGCACCGCGCGGCTGGTAACAGTCCGTGGCACGGTAA
ACTCCACCCGGAGCAAGGCCAAATAGGGGTTCATAAGGTACGGCCCGTACTGAACCCGGG
TAGGCTGCTTGAGCCAGTGAGCGATTGCTGGCCTAGATGAATGACTGTCCACGACAGAAC
CCGGCTTATCGGTCAGTTTCACCTGATTTACGTAAAAACCCGCTTCGGCGGGTTTTTGCT
TTTGGAGGGGCAGAAAGATGAATGACTGTCCACGACACTATACCCAAAAGAAAGCGGCTT
ATCGGTCAGTTTCACCTGATTTACGTAAAAACCCGCTTCGGCGGGTTTTTGCTTTTGGAG
GGGCAGAAAGATGAATGACTGTCCACGACACTATACCCAAAAGAAAGCGGCTTATCGGTC
AGTTTTACCTGATGTACGTAATAAACCGTTCCGGCGGGTTTCAGATTGTTGAGTGCGCTT
TATTCATGCCGGATGCGGCGTGAACGCCTTATCCTGCCTACAAAAGCACGCAAATTCAAT
ATATTGCAGAGATGGCGTAGGCCTGATAAGCGTAGCGCATCAGGCATTTTTGCGGTTGCC
ATCAGTTTCAAACCCGCGTCAGTGAGTTTTTGCTTTTGGTGCACAGGGTAAGATGAATAA
ATATCTACGGTATTAATAATAGACTTTGTAAGAAGTTATTAAGTCTATATTGCATTTAAA
AGGTCGTAATCATACGTATAGTCCTCTCTGGTAAAATATTGCTTCTCTGAGTTATATGCT
TCATATGTGTTATATTCCCCGACCTCAAAGCCATTGTCCGGAGAATTTTCGTCTTTCTCG
AGGGTATTATCTGAAAGTAACTCTTCTGAGCTAGAGTCTTCTATGTTTAAATCCATAGTA
TAATTAATTTGGGGGACGACCAGATAAGCATTTTCTTTGGTATTTTCATAATCTTCAATG
ATTATATCGATGTAATCATATATTTTTTCTGATGAGAATTCTTTCATCTCTGTTAATTTA
ATTCTGTTCAAGCAATTGATGATTTTCGATGAGCTTTTATATATTTCTTTTGTTAATTCA
TTTTCTAATTTATCTGTAAGAGTTGCCCTTGGTATAGATTTTATAATTGCAAATCTCATA
ATTTTTAATTGTTCTTCGGTAATGTCTCCAGGCTCATTTAAACAACTTTCGACAAACTTG
ATTTTTTCTTCAGAATACATATCGCTAATGCTTATTAAAACAGGCGTTATTTTTAGTAAA
TAATCCCAGGAGATTGTGGCGTTTTGTGTTGAACTAACAAAATTAACCTGAAACATGTTG
GCATTAGTAAAATTTGTTGAATTCAATTTAAAAGGATTTAAAATAGTATTAGCCATATGT
TTATCTGTGAAATCATAATAATCTAAATCGACATTACGTAAGTCCAGAGAGGATAGATCA
ACGATATCTCCAGTCCCACAACTAAAAATTACGTTTAACCTCCTGATTTCATTGTAAATA
TCTTTTAATGGGCAATTAATATTGATATTACCTGTGGATATTTCCTGGTTTTTTAACGGT
TCATTAATGGTAAGTTCACAAGTATTGTCCGATCGTTGAATAATTTGGGCGTTATAACCT
AAAAAATCCAGACGAAGAGACGAGACATTATAAAGAATTACATTTTGTAAGTACGCTAAT
TCTTTTTGAAAATCACCAGTGATAATGCATTTTCCACCAGGTTGTAACGTGTTAAGTAAA
GTGACCATTTCAATAGAGGTCTGTTTTAGTTTTTCTATACCTGGTGCTAGTGCTTCGAGG
TTATTTCCTGTTGGGCTTTCAGGAAGGTCATTCATTTTTCGACGGACTAAATCACTACTA
ATATCATTACCAATTGATGAAACAGGGAACATTATTTTATCCTTTATAAATAATCAATAA
AAATCATTATTAAAATGATCGGGTGAAAAAAAGAGAATTTGCCAACAATCTGAAGTAATG
CTGGTTTTATTAAAGTGCACAAGGGGGGTTAAGATGGCTTCTTTTCGGGTGAATTTTGCA
CAATACTTAGAAATCGTCTCCTTAATACATTCCAGCTCTTTTTTATTGACGGCTGAGCAA
GTACATTGTTCACCAAAAGGTGCAAAAGTGCCTACATCTAATGTTTGTATGATATAATCA
TCATGTTCTCCTGTAGAAATATCTATAATGAATGGACTCATATTTTCCGGTTGGATTCGG
ATCATGACAGAAGGAACATCGCCATGATAGAAATTCAATGCAGTTATTGCAGATAATACT
CTCCGCAGTTCATTACTTATACTGTAAATTTTATTAACGTCATTGGTGGAGACAATTTCT
GCAAACTTTCTTTTTACCGTCCAATAATCAATATTTCTATTGTGATTGTTAACCACTGCG
TGCATTGGCGGGATTGAAGGGTGAAAAATATGCGCAATTGGGAAGCCTTTCATTGATGCC
TGCCTTGTCATCATGACAAACAATAATAGATGCTTATTTTCCTCGCAGGGTTCTTTCGCA
CTATCAAAAAACGCTCATTTACCCGGCGTTACAGTAAACGAAGCAACATTCTGTGGCCTA
CGCCGATCAAAAGCTCTGTGAAAATTTCCCTTGTTGTCTTTGTCTGACCTTATCGCGGCG
ATCAGCAATTATTCGTTTTGTGATCCTCAACACAAAATGCTATTCGTCGCCTATGAGGGG
AGAAGAATTTATGGAAAACGATTGCATTCACAAAATGACGTCCTGTCAGAAGAGAAAAAG
TTGACGTTAATCAATTGTTCGAGATGATCAATACATGTATTCGAAATTTTAAAATATTGA
TAAAATAAATGTTTGTTCTCCAACAAATAGCGTGAAAAAATGTGACATGCCGCATTATTT
ATCACTGAAAATGGTTTATTTATAATAAAATTTGAGAACTTGCTCATTAAATTTAACTCA
AATTTTGCCTGGTAATTATCCGGTAATTGCTTGAAATATGGTCTCAGCCCCTTTTTTGTA
TTAACCACATAACGAATGATGTTATCGCCATAAAATATGGTTATCCCCGTCATTTTTTTT
GACAAAAATCAGGGTTTATGCTGATTTTTATACTTTAACTTGTTGATATTTAAAGGTATT
TAATTGTAATAACGATACTCTGGAAAGTATTGAAAGTTAATTTGTGAGTGGTCGCACATA
TCCTGTTCATTTCATTTTGATACACTTCATGCCGTCAATGAGGTAATTAACGTAGGTCGT
TATGAGCACTATTCTTCTTCCGAAAACGCAGCACCTGGTAGTCTTTCAGGAAGTCATTAG
AAGTGGTTCTATCGGCTCGGCTGCAAAAGAATTAGGGTTAACTCAACCGGCCGTCAGTAA
AATCATTAACGATATTGAAGATTATTTTGGTGTGGAATTAGTGGTGCGGAAAAATACCGG
TGTAACATTAACACCTGCCGGTCAATTGTTACTCTCCCGTTCCGAATCCATTACCCGTGA
AATGAAAAATATGGTTAATGAGATAAGCGGTATGTCTTCTGAGGCGGTGGTGGAAGTCTC
ATTTGGTTTTCCTTCATTGATTGGTTTTACTTTTATGTCAGGGATGATCAACAAGTTCAA
AGAGGTGTTCCCGAAAGCGCAGGTTTCTATGTATGAAGCGCAACTGTCTTCGTTCTTACC
GGCAATCCGCGACGGTCGACTGGATTTTGCGATTGGTACGTTAAGTGCAGAAATGAAGCT
TCAGGATTTACATGTTGAGCCGCTGTTCGAGTCCGAGTTTGTGCTGGTAGCCAGTAAGTC
CCGAACATGCACCGGCACCACCACGCTGGAGTCGTTGAAGAACGAACAGTGGGTGTTGCC
ACAAACTAATATGGGGTACTACAGCGAACTGCTTACTACGTTACAAAGAAATGGCATCAG
TATTGAAAACATCGTTAAAACCGACTCAGTCGTGACAATTTATAATCTTGTTCTCAATGC
TGATTTCTTAACTGTAATTCCTTGTGATATGACGTCACCTTTTGGTTCTAATCAATTTAT
TACTATTCCGGTTGAAGAAACATTACCTGTGGCACAATATGCCGCGGTATGGTCGAAAAA
TTATCGTATTAAAAAAGCAGCATCGGTTTTGGTGGAATTAGCCAAAGAGTATTCATCTTA
TAATGGGTGTAGACGAAGGCAATTAATAGAAGTTGGTTAGTTATTTGTTTTTATTTAAAC
ATAAATAATCCACCTGTCTGTCTTGCAGGTGTCGGTTACGGTTACCTACATATTTAATTC
AGGCGAAGAGGTTTTATAATGCATATTACATACGATCTGCCGGTTGCTATTGATGACATT
ATTGAAGCGAAACAACGACTGGCTGGGCGAATTTATAAAACAGGCATGCCTCGCTCCAAC
TATTTTAGTGAACGTTGCAAAGGTGAAATATTCCTGAAGTTTGAAAATATGCAGCGTACG
GGTTCATTTAAAATTCGTGGCGCATTTAATAAATTAAGTTCACTGACCGATGCGGAAAAA
CGCAAAGGCGTGGTGGCCTGTTCTGCGGGCAACCATGCGCAAGGGGTTTCCCTCTCCTGC
GCGATGCTGGGTATCGACGGTAAAGTGGTGATGCCAAAAGGTGCGCCAAAATCCAAAGTA
GCGGCAACGTGCGACTACTCCGCAGAAGTCGTTCTGCATGGTGATAACTTCAACGACACT
ATCGCTAAAGTGAGCGAAATTGTCGAAATGGAAGGCCGTATTTTTATCCCACCTTACGAT
GATCCGAAAGTGATTGCTGGCCAGGGAACGATTGGTCTGGAAATTATGGAAGATCTCTAT
GATGTCGATAACGTGATTGTGCCAATTGGTGGTGGCGGTTTAATTGCTGGTATTGCGGTG
GCAATTAAATCTATTAACCCGACCATTCGTGTTATTGGCGTACAGTCTGAAAACGTTCAC
GGCATGGCGGCTTCTTTCCACTCCGGAGAAATAACCACGCACCGAACTACCGGCACCCTG
GCGGATGGTTGTGATGTCTCCCGCCCGGGTAATTTAACTTACGAAATCGTTCGTGAATTA
GTCGATGACATCGTGCTGGTCAGCGAAGACGAAATCAGAAACAGTATGATTGCCTTAATT
CAGCGCAATAAAGTCGTCACCGAAGGCGCAGGCGCTCTGGCATGTGCTGCATTATTAAGC
GGTAAATTAGACCAATATATTCAAAACAGAAAAACCGTCAGTATTATTTCCGGCGGCAAT
ATCGATCTTTCTCGCGTCTCTCAAATCACCGGTTTCGTTGACGCTTAATTAATTCGTTGA
GGATAGGATATGAGTACTTCAGATAGCATTGTATCCAGCCAGACAAAACAATCGTCCTGG
CGTAAATCAGATACCACATGGACGTTAGGCTTGTTTGGTACGGCAATCGGCGCCGGGGTG
CTGTTCTTCCCTATCCGCGCAGGTTTTGGCGGACTGATCCCGATTCTTCTGATGTTGGTA
TTGGCATACCCCATCGCGTTTTATTGCCACCGGGCGCTGGCGCGTCTGTGTCTTTCTGGC
TCTAACCCTTCCGGCAACATTACGGAAACGGTGGAAGAGCATTTTGGTAAAACTGGCGGC
GTGGTTATCACGTTCCTGTACTTCTTCGCGATTTGCCCACTGCTGTGGATTTATGGCGTT
ACTATTACCAATACCTTTATGACGTTCTGGGAAAACCAGCTCGGCTTTGCACCGCTGAAT
CGCGGCTTTGTGGCGCTGTTCCTGTTGCTGCTGATGGCTTTCGTCATCTGGTTTGGTAAG
GATCTGATGGTTAAAGTGATGAGCTACCTGGTATGGCCGTTTATCGCCAGCCTGGTGCTG
ATTTCTTTGTCGCTGATCCCTTACTGGAACTCTGCAGTTATCGACCAGGTTGACCTCGGT
TCGCTGTCGTTAACCGGTCATGACGGTATCCTGATCACTGTCTGGCTGGGGATTTCCATC
ATGGTTTTCTCCTTTAACTTCTCGCCAATCGTCTCTTCCTTCGTGGTTTCTAAGCGTGAA
GAGTATGAGAAAGACTTCGGTCGCGACTTCACCGAACGTAAATGTTCCCAAATCATTTCT
CGTGCCAGCATGCTGATGGTTGCAGTGGTGATGTTCTTTGCCTTTAGCTGCCTGTTTACT
CTGTCTCCGGCCAACATGGCGGAAGCCAAAGCGCAGAATATTCCAGTGCTTTCTTATCTG
GCTAACCACTTTGCGTCCATGACCGGTACCAAAACAACGTTCGCGATTACACTGGAATAT
GCGGCTTCCATCATCGCACTCGTGGCTATCTTCAAATCTTTCTTCGGTCACTATCTGGGA
ACGCTGGAAGGTCTGAATGGCCTGGTCCTGAAGTTTGGTTATAAAGGCGACAAAACTAAA
GTGTCGCTGGGTAAACTGAACACTATCAGCATGATCTTCATCATGGGCTCCACCTGGGTT
GTTGCCTACGCCAACCCGAACATCCTTGACCTGATTGAAGCCATGGGCGCACCGATTATC
GCATCCCTGCTGTGCCTGTTGCCGATGTATGCCATCCGTAAAGCGCCGTCTCTGGCGAAA
TACCGTGGTCGTCTGGATAACGTGTTTGTTACCGTGATTGGTCTGCTGACCATCCTGAAC
ATCGTATACAAACTGTTTTAATCCGTAACTCAGGATGAGAAAAGAGATGAATGAATTTCC
GGTTGTTTTGGTTATTAACTGTGGTTCGTCTTCGATTAAGTTTTCCGTGCTCGATGCCAG
CGACTGTGAAGTATTAATGTCAGGTATTGCCGACGGTATTAACTCGGAAAATGCATTCTT
ATCCGTAAATGGGGGAGAGCCAGCACCGCTGGCTCACCACAGCTACGAAGGTGCATTGAA
GGCAATTGCATTTGAACTGGAAAAACGGAATTTAAATGACAGTGTGGCCTTAATTGGCCA
CCGCATCGCTCACGGCGGCAGTATTTTTACCGAGTCCGCCATTATTACCGATGAAGTCAT
TGATAATATCCGTCGCGTTTCTCCACTGGCACCCCTGCATAATTACGCCAATTTAAGTGG
TATTGAATCGGCGCAGCAATTATTTCCGGGCGTAACTCAGGTGGCGGTATTTGATACCAG
TTTCCACCAGACGATGGCTCCGGAAGCTTATTTATACGGCCTGCCGTGGAAATATTATGA
AGAGTTAGGTGTACGCCGTTATGGTTTCCACGGCACGTCGCACCGCTATGTTTCCCAGCG
CGCACATTCGCTGCTGAATCTGGCGGAAGATGACTCCGGCCTGGTTGTGGCGCATCTTGG
CAATGGCGCGTCAATCTGCGCGGTTCGCAACGGTCAGAGTGTTGATACCTCAATGGGAAT
GACGCCGCTGGAAGGCTTGATGATGGGTACCCGCAGTGGCGATGTCGACTTTGGTGCGAT
GTCCTGGGTCGCCAGCCAAACCAACCAGAGCCTGGGTGACCTGGAACGCGTAGTGAATAA
AGAGTCGGGATTATTAGGTATTTCCGGTCTTTCTTCGGATTTACGTGTTCTGGAAAAAGC
CTGGCATGAAGGTCACGAACGCGCGCAACTGGCAATTAAAACCTTTGTTCACCGAATTGC
CCGTCATATTGCCGGACACGCAGCTTCATTACGTCGCCTGGATGGAATTATATTCACCGG
CGGAATAGGAGAGAATTCAAGCTTAATTCGTCGTCTGGTCATGGAACATTTGGCTGTATT
AGGCTTAGAGATTGATACAGAAATGAATAATCGCTCTAACTCCTGTGGTGAGCGAATTGT
TTCCAGTGAAAATGCGCGTGTCATTTGTGCCGTTATTCCGACTAACGAAGAAAAAATGAT
TGCTTTGGATGCCATTCATTTAGGCAAAGTTAACGCGCCCGCAGAATTTGCATAATTTAG
TTGAAGTATTGTAGAGAGATTATTTTTCATGAAGGTAGATATTGATACCAGCGATAAGCT
GTACGCCGACGCATGGCTTGGCTTTAAAGGTACGGACTGGAAAAACGAAATTAATGTCCG
CGATTTTATTCAACATAACTATACACCGTATGAAGGCGATGAATCTTTCCTCGCCGAAGC
GACGCCTGCCACCACGGAATTGTGGGAAAAAGTAATGGAAGGCATCCGTATCGAAAATGC
AACCCACGCGCCGGTTGATTTCGATACCAATATTGCCACCACAATTACCGCTCATGATGC
GGGATATATTAACCAGCCGCTGGAAAAAATTGTTGGCCTGCAAACGGATGCGCCGTTGAA
ACGTGCGCTACACCCGTTCGGTGGCATTAATATGATTAAAAGTTCATTCCACGCCTATGG
CCGAGAAATGGACAGTGAATTTGAATATCTGTTTACCGATCTGCGTAAAACCCATAACCA
GGGCGTATTTGATGTTTACTCACCGGATATGCTGCGCTGCCGTAAATCTGGCGTGCTGAC
CGGTTTACCAGATGGCTATGGCCGTGGGCGCATTATCGGTGACTATCGCCGCGTAGCGCT
GTATGGCATCAGTTATCTGGTACGTGAACGCGAACTGCAATTTGCCGATCTCCAGTCTCG
TCTGGAAAAAGGCGAGGATCTGGAAGCCACCATCCGTCTGCGTGAGGAGCTGGCAGAGCA
TCGTCATGCGCTGTTGCAGATTCAGGAAATGGCGGCGAAATATGGCTTTGATATCTCTCG
CCCGGCGCAGAATGCGCAGGAAGCGGTGCAGTGGCTCTACTTCGCTTATCTGGCGGCAGT
GAAATCGCAAAATGGCGGCGCGATGTCGCTGGGCCGCACGGCATCGTTCCTCGATATCTA
CATTGAGCGCGACTTTAAAGCTGGCGTACTCAATGAGCAGCAGGCACAGGAACTGATCGA
TCACTTCATCATGAAGATCCGTATGGTACGCTTCCTGCGTACACCGGAATTTGATTCGCT
GTTCTCCGGCGACCCAATCTGGGCGACGGAAGTGATCGGCGGGATGGGGCTGGACGGTCG
TACGCTGGTGACCAAAAACTCCTTCCGCTATTTGCACACCCTGCACACTATGGGGCCGGC
ACCGGAACCTAACCTGACCATTCTTTGGTCGGAAGAATTACCGATTGCCTTCAAAAAATA
TGCCGCGCAGGTGTCGATCGTCACCTCTTCCTTGCAGTATGAAAATGACGATCTGATGCG
TACTGACTTCAACAGCGACGATTACGCGATTGCCTGCTGCGTCAGCCCAATGGTGATTGG
TAAGCAAATGCAGTTCTTTGGTGCACGCGCTAACCTGGCGAAAACGCTGCTCTACGCAAT
TAACGGCGGGGTGGACGAGAAGCTGAAGATTCAGGTCGGGCCGAAAACAGCACCGCTGAT
GGACGACGTGCTGGATTACGACAAAGTGATGGACAGCCTCGATCACTTCATGGACTGGCT
GGCGGTGCAGTACATCAGCGCGCTGAATATCATTCACTACATGCACGACAAGTACAGCTA
CGAAGCTTCGCTGATGGCGCTGCACGATCGTGATGTCTATCGCACTATGGCATGCGGCAT
CGCGGGCCTGTCGGTGGCGACGGACTCCCTGTCTGCCATCAAATATGCCCGCGTGAAACC
AATCCGTGACGAAAACGGCCTGGCGGTGGACTTTGAAATCGACGGTGAATATCCGCAGTA
CGGCAACAACGACGAGCGCGTAGACAGCATTGCCTGCGACCTGGTTGAACGCTTTATGAA
GAAAATTAAAGCGCTGCCAACCTATCGCAACGCCGTCCCTACCCAGTCGATTCTGACTAT
CACTTCTAACGTGGTGTACGGCCAGAAAACCGGTAATACGCCGGACGGTCGTCGCGCCGG
AACACCGTTCGCGCCGGGCGCTAACCCGATGCATGGTCGTGACCGCAAAGGTGCCGTGGC
CTCATTGACGTCGGTGGCGAAACTGCCGTTCACCTACGCCAAAGATGGGATCTCGTACAC
CTTCTCAATCGTTCCTGCGGCGCTGGGCAAAGAAGATCCAGTACGTAAAACCAACCTTGT
CGGCCTGCTGGATGGGTATTTCCACCACGAAGCGGATGTCGAAGGCGGTCAACACCTCAA
CGTCAACGTAATGAATCGGGAAATGCTGCTGGATGCCATCGAGCACCCGGAAAAATATCC
TAACCTGACAATCCGTGTCTCTGGCTACGCCGTGCGCTTCAACGCACTGACCCGTGAACA
GCAACAGGATGTTATTTCACGTACCTTTACCCAGGCGCTCTGACGCCGGAGGATGTATGA
AAAAGATTATCGAAACGCAACGTGCCCCAGGCGCAATCGGCCCTTATGTTCAGGGCGTTG
ATTTAGGCAGCATGGTCTTCACCTCCGGGCAAATACCGGTTTGCCCACAGACCGGTGAGA
TCCCGGCTGATGTGCAAGATCAGGCGCGTTTAAGCCTCGAAAACGTCAAAGCGATCGTGG
TTGCTGCCGGGCTGAGCGTGGGCGATATCATCAAGATGACCGTGTTTATCACCGATCTGA
ATGATTTTGCCACCATCAACGAAGTCTATAAGCAGTTCTTCGATGAGCATCAGGCGACCT
ATCCGACCCGGAGCTGTGTGCAGGTCGCGCGTTTGCCGAAAGATGTGAAGCTGGAAATTG
AAGCCATCGCAGTACGTAGTGCGTAAAGCCTCGTGAGCGGGACGGTCGTAAGGTCGTTCC
GCTCCACTTCACTGAACGGCAATCCGAGGGTGTGGATATGATTAGTGCATTCGATATTTT
CAAAATTGGGATTGGTCCCTCCAGTTCGCATACCGTGGGGCCAATGAATGCCGGAAAAAG
TTTTATTGATCGGCTGGAAAGTAGCGGCTTATTAACCGCGACGAGCCATATTGTGGTCGA
TCTGTACGGGTCGTTGTCACTGACGGGCAAAGGCCATGCCACGGATGTCGCCATCATCAT
GGGACTGGCAGGAAACAGTCCGCAGGATGTTGTCATTGATGAGATCCCTGCATTTATAGA
GTTAGTAACGCGCAGCGGGCGGCTGCCAGTGGCATCTGGTGCGCATATTGTTGATTTTCC
TGTAGCAAAGAACATTATCTTCCATCCCGAAATGTTGCCTCGCCATGAGAACGGAATGCG
GATCACTGCCTGGAAGGGACAGGAAGAGCTATTAAGTAAAACCTATTACTCTGTCGGCGG
CGGGTTTATTGTCGAAGAAGAACACTTCGGCCTGTCGCACGATGTCGAAACGTCCGTACC
TTACGATTTCCACTCAGCAGGTGAACTGCTGAAAATGTGTGATTACAACGGCCTGTCTAT
ATCTGGTCTGATGATGCACAACGAGCTAGCGCTGCGCAGCAAAGCGGAAATTGACGCCGG
TTTTGCCCGTATCTGGCAAGTGATGCATGACGGTATTGAACGTGGGATGAACACTGAAGG
CGTGCTGCCTGGTCCGCTCAATGTGCCGCGCCGTGCCGTAGCGCTGCGTCGTCAGCTGGT
TTCCAGCGATAACATCTCTAACGATCCGATGAATGTCATCGACTGGATCAACATGTACGC
GCTGGCGGTTAGTGAAGAAAACGCAGCTGGCGGGCGCGTGGTAACGGCACCGACTAACGG
TGCGTGCGGCATTATTCCGGCAGTACTGGCTTATTACGATAAGTTCCGTCGTCCGGTAAA
CGAGCGGTCAATTGCCCGCTATTTTCTGGCCGCGGGGGCTATTGGCGCGCTGTATAAAAT
GAACGCCTCCATCTCTGGCGCGGAAGTCGGCTGTCAGGGGGAGATTGGCGTGGCCTGTTC
AATGGCGGCGGCAGGGTTAACTGAACTACTGGGCGGCAGTCCGGCGCAGGTATGCAATGC
GGCGGAAATCGCGATGGAGCATAACCTTGGGCTGACCTGCGATCCGGTTGCCGGACAGGT
ACAAATCCCGTGCATTGAACGTAATGCCATTAATGCCGTGAAAGCAGTAAACGCCGCGCG
GATGGCGATGCGCCGCACCTCGGCACCGCGTGTTTCACTCGATAAAGTGATCGAGACGAT
GTATGAAACCGGCAAAGATATGAACGATAAATACCGCGAAACATCACGCGGAGGACTGGC
CATTAAAGTGGTCTGCGGCTGACATTGCTGTCAGCTTTCATCCTTGGGTGCACAAATGTG
CACCTTTTTTTTGTGATCTGCCGCAAATAGAGAATGAATATTCTCCTGCGATTAATTTAG
TAGAAAATTCTTATCCATCTCCGTTATTTCAAAGTCTTGATTGTGAAGATTTTCTCTGAC
CTCGCGCGTATCATTTCTTTATTCTAATAACTCGCCTGCAAAAACGTAGACCGCATATCG
CCTTGATGCGGCTCGGAAAAAAATAATAAGCCCTACAAAATATTGAGCGAGAAATTATGG
AAATTGCATCGAATAAAGGCGTCATTGCAGACGCTTCGACCCCGGCGGGTCGTGCTGGAA
TGAGTGAGAGCGAGTGGCGAGAAGCGATCAAATTCGACAGTACTGACACCGGCTGGGTGA
TTATGAGTATCGGGATGGCGATTGGCGCGGGGATTGTTTTTCTCCCGGTGCAGGTCGGTT
TGATGGGATTGTGGGTATTTTTGCTCTCATCGGTGATTGGTTACCCGGCAATGTATCTGT
TTCAGCGATTGTTTATTAATACGCTGGCAGAATCACCAGAATGTAAAGATTACCCGAGCG
TCATTAGCGGTTATTTAGGTAAAAACTGGGGCATCCTGTTAGGTGCGCTCTATTTCGTAA
TGCTGGTGATTTGGATGTTCGTCTATTCCACCGCCATCACCAACGATAGTGCTTCCTACC
TGCATACCTTCGGCGTGACGGAAGGGTTGCTGTCAGACAGTCCCTTTTATGGTCTGGTAC
TGATTTGCATTCTGGTGGCGATCTCCTCACGCGGCGAGAAATTGTTATTCAAAATTTCGA
CCGGCATGGTGCTGACCAAGCTGCTGGTGGTCGCGGCGCTGGGCGTGTCGATGGTGGGAA
TGTGGCATCTGTATAACGTCGGTTCGCTACCGCCGCTGGGGCTGCTGGTGAAAAACGCCA
TTATTACGCTGCCGTTTACCCTGACGTCGATTCTGTTTATCCAGACGTTAAGTCCGATGG
TGATCTCTTATCGCTCGCGGGAAAAATCAATTGAAGTGGCGCGGCATAAAGCATTGCGGG
CAATGAATATCGCGTTTGGCATTTTGTTTGTCACCGTCTTTTTCTACGCCGTGTCGTTCA
CGCTGGCGATGGGACATGACGAAGCGGTAAAAGCCTATGAGCAGAATATTTCCGCGCTGG
CGATTGCCGCACAGTTTATTAGCGGTGACGGCGCAGCGTGGGTGAAAGTGGTCAGCGTCA
TTCTCAATATCTTTGCTGTCATGACTGCATTCTTTGGCGTCTATTTAGGCTTTCGCGAAG
CAACGCAAGGGATCGTAATGAACATCCTGCGTCGCAAGATGCCTGCCGAGAAGATTAACG
AAAATCTCGTTCAGCGCGGCATCATGATTTTCGCCATTTTGCTGGCCTGGAGCGCCATCG
TACTGAACGCACCGGTGTTGAGCTTCACCTCTATCTGTAGCCCGATTTTCGGCATGGTAG
GGTGCCTGATCCCGGCGTGGCTGGTTTACAAAGTACCAGCATTGCACAAATACAAAGGGA
TGTCTCTGTACCTGATTATCGTCACTGGTTTGTTGCTGTGTGTTTCTCCGTTCCTGGCAT
TTTCTTGATTTACCTGAAATTTTAAGGTTTTTAATATGTTTGATTCGACTTTAAATCCGT
TATGGCAGCGTTACATCCTCGCCGTTCAGGAGGAAGTAAAACCGGCGCTGGGATGTACTG
AACCGATTTCACTGGCGCTGGCGGCGGCGGTTGCTGCGGCAGAACTGGAAGGTCCGGTTG
AACGTGTAGAAGCCTGGGTTTCGCCAAATCTGATGAAGAACGGTCTGGGCGTCACCGTTC
CCGGCACGGGAATGGTGGGGCTGCCGATTGCGGCGGCGCTGGGGGCGTTAGGTGGAAATG
CCAACGCCGGGCTGGAAGTGCTGAAAGACGCAACAGCGCAGGCAATTGCCGATGCCAAAG
CACTGCTGGCGGCGGGGAAAGTCTCCGTTAAGATCCAGGAACCTTGCGATGAAATCCTCT
TCTCACGCGCCAAAGTCTGGAACGGTGAGAAGTGGGCGTGTGTCACCATCGTCGGCGGGC
ATACCAACATTGTGCATATCGAGACGCACGATGGTGTGGTGTTTACCCAGCAGGCGTGTG
TGGCAGAGGGCGAGCAAGAGTCTCCGCTGACGGTGCTTTCCAGAACGACGCTGGCTGAGA
TCCTGAAGTTCGTCAATGAAGTCCCGTTTGCGGCGATCCGCTTTATTCTCGATTCCGCGA
AGCTAAATTGTGCGTTATCGCAGGAAGGTTTGAGCGGTAAGTGGGGGCTGCATATTGGCG
CGACGCTGGAAAAACAGTGCGAGCGCGGTTTGCTGGCGAAAGATCTCTCTTCATCCATTG
TGATTCGTACCAGCGCGGCATCCGATGCGCGTATGGGCGGCGCTACGCTTCCGGCTATGA
GTAACTCCGGCTCGGGTAACCAGGGGATTACCGCAACAATGCCTGTGGTGGTGGTAGCAG
AACACTTCGGAGCGGATGATGAACGGCTGGCGCGTGCGCTGATGCTTTCGCATTTGAGCG
CAATTTACATCCATAACCAGTTACCGCGTTTGTCTGCGCTGTGTGCCGCAACGACCGCAG
CAATGGGGGCCGCCGCCGGGATGGCATGGCTGGTGGATGGGCGTTATGAAACCATCTCGA
TGGCGATCAGCAGTATGATCGGCGATGTCAGCGGCATGATTTGCGATGGTGCGTCGAACA
GCTGCGCGATGAAGGTTTCGACCAGTGCTTCGGCTGCGTGGAAAGCGGTGTTAATGGCGC
TGGATGATACCGCCGTGACCGGCAATGAAGGGATTGTGGCGCATGATGTTGAGCAGTCGA
TTGCCAACCTGTGTGCGTTAGCAAGCCATTCGATGCAGCAAACGGATCGGCAGATTATCG
AGATTATGGCGAGCAAGGCCAGATAAACGCCAGGTTTTGGGGATCGTGCCGGATGCGATG
CTGGCGCATCTTGTCCGGCCTACGGGTTGTTTAATTCGTTAATGTTGTTGGATTTTGTAG
GCCGGATAAGGCGTTTTCGCCGCATCCGGCAACCTGTCTTTACGCGGTAGCTTCATCCTC
GGCTAAACGCGTTTCAGCATCCGCGACGATAGCTTCCAGCTCGCTCAACATCTCTTCATA
GCCAAAATTTTTGGCGGTGCGAGCAGGTTCTTTCGCCACCACGGGCTTCACCGGCTGGCG
CTTTTTGGCCAATTTTTTACTCATCATCATCTCCCTGTAAAAACAACTAGACAGGCAAAT
CTATCAGCAAAGCGCGCAGTGGGGAATCGGCAACCAGCGTAATGTTAGCCTCGTCACGAA
TAAACGCCCCATCACCGCAGGTCAGCGCCGCTTTCTCTTCATGATGCGTAAGCGCATGAA
ATTTCCCGTGAATCGATTGCAAATACGCGCGTGGCCCATGCAACTGGAAATTCGCACTTT
CGCCTTTGTCGAGCACGATATGGTGCAGCCACACTTGCTGGCGTAATTGCAGGCTTCCCA
TCGCACCCTCTGGCGAGGCGATTAATTGCTGCTTGCCCATATTAAGCGCCAGCTTTTGAA
TCAGCGGATTCTCTCGCTGCGGGCAGGCGTCCAGCCAAAGCTGCATTCGCGTTAACGGTT
TGTCTTTGCTGAGATTGTGTTCGCTATAGCTGACACCCGGCTGGGTAGAGAGCAGCAACG
CCTCTCCGGCGCTGGCCTGAACATGATTGCCTTCGCTATCGCGATACTCTGCTTCTCCAT
CCAGAATCACATTTAAAATATCGACTTTGGGATAGGTTCGCGGCTGAAAGGCGGCACCTG
GGGCCAGCACTTCCTGGTTAAGCACACGCAGGGAGGCATAGCCTAACAATTTCGGGTCGA
AGTAGTGTCCAAAGGAAAAAGTATACCGGGCCTGCAACCATCCGTAGTCTGCTTGTCCAC
ACTGCCTGGCAGTTCGGGTAGTAATCATAATTCTTGACCTCTCTTTACTTCCTTTTATGG
TAAGGGGCTGGACGCTACATTGTTAGCCAGATATTCTGCCCGGTATGTTCAAATTTCCTG
AATGAGAACGAAATGGCCAAAGAAAGGGCATTAACGCTGGAAGCACTACGGGTTATGGAT
GCGATCGATCGCCGGGGCAGTTTTGCGGCGGCGGCGGATGAGCTGGGACGCGTGCCTTCC
GCACTTAGCTACACCATGCAAAAACTGGAAGAAGAGCTGGATGTGGTGCTGTTTGACCGC
TCGGGCCATCGTACCAAATTCACCAATGTCGGGAGGATGTTGTTGGAGCGAGGGCGCGTT
TTGCTGGAAGCCGCAGATAAACTGACTACTGATGCGGAAGCTCTCGCGCGCGGTTGGGAA
ACGCATCTCACCATTGTGACCGAAGCGCTGGTACCGACACCTGCCTTTTTCCCGTTAATC
GACAAACTGGCGGCAAAAGCCAATACCCAACTGGCAATCATCACAGAAGTGCTGGCGGGG
GCGTGGGAACGGCTGGAGCAGGGGCGGGCGGATATTGTTATCGCGCCGGATATGCATTTT
CGTTCCTCGTCGGAGATCAACTCGCGCAAGCTCTATACGTTAATGAACGTCTACGTTGCC
GCGCCTGATCACCCGATTCATCAGGAGCCGGAACCGTTATCTGAAGTGACGCGTGTGAAA
TATCGTGGAATTGCGGTGGCGGATACCGCTCGTGAGCGCCCGGTGTTGACCGTACAGCTG
CTGGACAAACAGCCGCGCTTAACGGTGAGCACGATTGAAGATAAACGTCAGGCATTACTG
GCGGGGCTTGGCGTGGCGACGATGCCGTATCCTATGGTCGAAAAAGATATTGCGGAAGGG
CGGTTGCGTGTCGTCAGCCCGGAATCGACCAGCGAGATCGATATTATTATGGCCTGGCGT
CGTGACAGTATGGGGGAAGCGAAATCCTGGTGTCTGCGGGAAATTCCCAAACTTTTTAAC
GGAAAATAATATTTATTATTGTTAATAAAAAGGGGCGAAATATCGCCCCAATTCTAAGAT
TAATTTGAACCAAACTTCGGATCGTTTCCGTAACGATTGCTGCCAGAAGTACCTTCTGTG
CAGAAAAAAACCAGAAGCACGAGCCAGCCAATAAACGGAACAAAAAAGAGCAAGGCCCAG
GCACCTGAACGGTCGGTATCGTGTAAGCGACGGATAGCAAGCGCAAGGACGGGAAGGAAG
GTTGCCAGCAAATAAAGCATAGACAGATATGGAAGCTCCAGACCTAAAATCAATTGAATG
ACATTGATAATAGCGCCGACGATGGCGTTAATCAGAGTAAACATCCAGTACTCTTTACGA
CGTGCGCGACCAGAGAAACCAACATAATTTTTTAATACGGACAAATACCACTGCATAAAA
ACATCCCTTTAATTAAAAGTGACGAAAGTCTATTCCGGGTATTGTGTAAATGCTATTCGT
ATCTTTCTTTTTCGGATGTTATAAAGGTTTTGATATTTAAGATAAATACATGGTTATTTT
TTATAGGTAATTTATATAACGACATTGAAATATTTTAAATAAACATTAGTAAATTATTCA
TTCATCAACATAATGATAAAAGCCGGATGAGTCAGACATCCGGCGAGCAGATTTGTTTTA
AGGTTCCAGTTTTGGATCTGGTCCAAAGCGGTTTTCGCCTGGCGTACCCGCCTGGCAGTT
AAAGACGATGATAATAAGCCAGCCGATAAACGGGATTAAGAATAGCAGTGCCCACCACGC
CGAGCGGTCGGTGTCGTGCAGGCGGCGGAACTGAACCGCCCACCACGGTAAAAACACCAG
AATACCGTAGATTGTCGTCAGGATGCCTTCGCCACCAGCGCGTTGCCAGCCTAACATTTT
ATCCAGCAGCCCCAGCACGAACGTAAAGATGATGTTGACCAGAATAAACATCCAGTACTC
TTTGCGCCGCGCACGACCCCGGAAACCGACATAATTTTTTAGTACTTTCAGATACCAGTC
CATTTTTGCCTCAATTTTGCTCAATCACTTGTTTTTAAAGCAGCAAATTAAGAATAGACG
TGAATGAAATGGCAGTAAATATTCGTTCAAGGAATTAATAAAGTGCCGTGAAGGCGCGCT
AAGACTGATGACAAGCGCAAAATCGCCAGATGCGCTACGCTTATCTGGTCTGCGCGGGTT
ATGCAATCTATTGAATGTACAATGTTTTGTATGTCAGATAAGGCGTTCATGCCACATCCG
ACATGAACAACATGCACTTAGCTAATTATCAGAGGCACCTCGTAAGGTGCCTTTTTTTAA
CCGAAGCGAACATCTCGTCCATGCGGTTCATCGAGATCCTGCCACGGACCAATTGAAATA
ATCCCCGTAGGGTTGATGGTCTTATGGCTGCGGAAGTAATGATTACGGATATGATCGAAA
TTGACTGTTTCGGCGATCCCCGGCATCTGGTAGATATCGCGCAGAAAACCGTACAGATTC
AGGTAATCGCTGATGCGGTGCTTATCACACTTGAAGTGGGTCACATACACCGGATCAAAA
CGCACCAGCGTAGTCCACAGGCGAATATCGGCTTCGGTTAGCTGGTTGCCGGTCAGGTAA
CGATGCTGGCCTAAAATCTGCTCCAGTCGTGCCAGCGATTCAAACACTTTCGCCACCGCC
TCGTCGTAAGCTTCCTGGCTGGTGGCAAAACCAGCTTTATACACGCCGTTGTTAACGGTG
TCATAAATCCAGCCGTTAAGTTCGTCAATTTTTGTTTGCAGGGCTGGAGGGTAGTAATCA
CCCGCTTTCGCGCCCAGCGCATCAAACGCGGTATTGAACATGCGGATGATTTCTGCTGAT
TCGTTGCTGACGATGGTGTGGTTCTTTTTGTCCCACAGCACGGGAACAGTAACTCGTCCG
CTGTAGTGTGGATCGGCGTGGAGATAAAGCTGATACAGAAATTCATTTTGATAGAGCGTG
TCTCCGGTTGCTCCCGGAAAACTGTCATCAAAGGTCCAACCGTTTTCCAGCATCAGCGGG
TTCACTACGGAAACGGAAATAAACGGTTCCAGTCCTTTGAGTTTGCGCATGATCAGCGTG
CGGTGCGCCCACGGGCAGGCGAGTGAAACATAGAGATGATAACGATCTTTCTCTGCGATA
AAACCGCCTGTGCCAGTGGGGCCAGGAGCGCCATCGGCAGTGAGCCAGTTACGAAATGCG
GAAGCTGAACGTTGAAATTTACCGCCGGTAGATTTGGTATCGTACCAGGTGTCATGCCAG
ACGCCGTCAATCAGTTGACCCATTTTTCTCTCCTCCAATAGCAAAAACGAGGAGCTTCCT
CCTCGTTTTTTATCGTTAAGTATAGCGCGTGCTTACCACTTTTTATTCAGCAGGCGGTCG
ATGCTATACGCGCCCGGACCGGTAATTGCCAGCAGCAGGAATCCGCCAGAAATTGTCAGG
TTTTTCATGAACATCAGCGAGTTGACGCCTTCAGCAAAGTTGCTGTGAAATAAAAATGCC
GTCAGCAGCGTAAAGCCCGCAGTAAACAGGGCTGTGGTGCGAGTCAGGAAACCGAACAGG
ATTGCCAGACCACCACCAAACTCAAGCAGAATCACCAGTGGCAGCATAAAACCCGGGACG
CCCATTGCTTCCATATATTGTTGGGTACCCGCGTAGCCAGTAATTTTTCCCCAGCCAGCG
GTAATAAACAGAATCGGCATTAAAATGCGCGCTACCAGTACACCAACATCTTCTAATTTT
TTCATCATACTCTCCACTGCGCCACTCAGGCTGCTGATTGTTTTTTTGTGCAATGGCGCG
GTATTAGCGTCGTTGCTGTCGATGGAGAGAATCATAAACGTGGTGAATGATGATTGTTAG
CAAGGAAAACTGTCAAAAATCTTCAAAAAATTTGAGGGATAAGGCCGGAATGGCTCCGGC
CAGAGGGAAGTTAACCGCGAAGCTGTTGCTGCTTGAGGGTCGTTTTAACCAGACGCCAGG
CGCTCCATACGCCAAAACCGCGTCTGGCCCAGCGGACCAGCATATTAGGATGGCGAATCG
TCCAGATCGCCATCACGCTACTGCCAACCAGCGCCCAGGAGCGCAGACTTAGCAGCATAT
TCCAGCGACGATCGTAAGCGCCTGTTGTCTCCAGCCATTCACGACGACTGGCGGAAAGAT
CCAGCCGTTGTTGCTGGATCTGGCTAAGCAGTTGCGCCTTACGTCGTTCACGTTCGACTT
TACTGCTCACGGGACTCCTCCTCGAGCAGCTGCCGATCGTTTGCTAACTCATGGCGTGTA
TGGCGCAGCAACGTAGACTTACGCGATTTACGTAGCGTCCAGATACCGCCAATCAGTGCC
AGTAGCAGCAACACCACGGTGGTGGCAATCATCGCATTCAGGCGATATTGCGGGTCAACC
GCCCAAATAATTAGCACCATCAGGCTCATAAGACCAAATGCAGCGAAAAGCATCGTCAGG
CCCAGCATCAGTAAAAGTTGAAAGAGATTCGCTTTTTCCTCTTCCAGCTCCACCACCGCC
AGCCGCAGACGTGTCTCTACCATTTCAACCATGATAGAAACAATTCGCTGCCCGATGCCC
AGAACGCTTTTACCGGGCCCTTGTGCGTGATGAGTGTCCGCCATAATTAACGACGCGACA
GCAGAACGCCGAGCACTACACCGATTGCAGCGCCAATGCCCACGCCCGTCCACGGATTTT
CGCGCACATACTCATCGGCACGCGCCGCCGCGACACGGGTTTGTTTGGCAATGGCATCAC
CGGTTTCACCCAGGCGATAACGGCTCTGTTTCAGTGCCTGCTCCGCTTTGCTACGAATCT
TACTCAACTCTTCTTTCGACTTCTCGCCAGATGAGCTAAGCACCTCTTCCAGCGTATCGG
AAAGGGATTTCAACTCAGCACGCAGATGTTCCGTAGTGTGTTCTTTCGACATAGTTTTCT
CCAGGTGAGTAAGTAGTGACTATTGTGAGTTAGTAGTCGCGCGCTTCCAGCTTTTTCAGC
TCTTCCTGCGCTTCTGCCAGTTTCCGTTCGCGTTTGGCAATCTTATCGGCATCGCCTTTT
TGCTTCGCCTCGGCTAAATCTTGCTGGCGTTCCGCCACCTCATCTTTCTGCTTTGCGATT
TTCTTCTGATGATCGGCACGCAGCTGGCTATCTGAACAGTTGGCCCGGACTTCACTCAGG
GCTTTATTCAGACCGTCAATACGATTCTGGTTTTGGTGTTTTTCGGCATAGCTGATCTCC
TTAAGGATATTTTGCTCCTTTTCCTGACACAGGGTAGTGGCATAACTACCGGCACTAAGA
GCAAAGAGAGAAACAGCTAAAGCGATGCGGTATTTCATTCTTGAACCTTCCATTGTGATT
CGGACCTATTACAAAGGAACGATTGTCCAGACAACGAAGCGGTAGTGTTAACCACCGCCT
CATTAATCATAGACAGTTACGGTGAAATCACCAAAGTGAGTGATATGTTTCGGATAACAG
GAAGTTATCCGAAGCGATGAGAGTTATCCCGTAACCGGGTCAGCCACTGCATAGCCTGAC
TGTTATTGTCCTGCTGCGCAATGATGTAGCCATGGGGCAATGTTCTGTCGAGGACCGCTT
TTGCGGCGGCGCTCTGGTCGCTGGAGTCAAATGTAATTAACAGAGTGTCGTTTTTGGGGG
TGATACTTTTGAAAGGAATGCCATGAGCGTCAAGGTGATGCCAGATTGAAAAACCGTCTG
GCATCGTTGTGCCTTGATGAACGGCACGAATCGCCAGCGTAGACTCTTGCTGGCGAACCG
CGGACCAGGCCAGCAACAGCGTGCCGACCAGAAGTAAAACAGCGCCGGACCAGGCTAGCT
GGCGAAGCGACATGCGAGGTATTTGCATCCCTTACCCCCGATTTCCATATTTCTTTTTCC
ATAACACGACCAGAGAACCTGCCAGGCCAAACACCAGCAGCACCACCGGGAGCAGCATCA
GGCATGACATCAGCTGGTCCTCGTACTTTAAAAATACCGGCGTTTTGCCGAGCATGTAAC
CCAGAGTTGTCAGGATCAATACCCACAGCAGACCGCTCATCCAGTTGAAAAACTGAAAGC
GCGCGTTATTCAGCCCTGATAACCCGGCAATCGTCGGCAGCAGTGTTCTGACAAACGCAA
TAAAGCGACCAATTAACAGCGCCGATAAACCGTGTTTATGAAAAAGATGGTGTGCGCGTT
GATGATAATGCGCGGGTAAATGAGATAGCCAGTTTTGTACGGTGCGGGTATTGCCCAGCC
ATCGCCCCTGAATATAGCTGACCCAGCAGCCGAGGCTGGCGGCAACGGTCAGCAGCAGAA
TCGTTTGCGGATAGCCCATCGCGCCTTTCGCAATCAACACGCCGACCAATACCAGTAAAC
TGTCGCCCGGTAAAAAGGCCGCCGGAAGCAAGCCGTTTTCAAGGAACAAAATTACAAACA
AGACAAAATACAACATGCCAATCATCGATGGATTGGCCAGGGTTTCAAAATCCTGCGCCC
ACAGGGCTTGCAGCAATTGGGTCAAAAGTTCCATTCATTATTCCTGGTGAATCGGTTAAC
GCCACGCTGGTTTTAAAAGATGCACTACCGCAATGTTATTGCTGTTTTGGTATGTTCTGC
GGGTTTGATACATCAACACAGCCTGAACTATTCCCTGTTAAATCGTGAGATAAGAAAGCA
TTCAAAAACATAAATTCAAATTGAATCTAATTGTAACAAAGGTCAACGTTGTTCGTTATC
AAAATTACATGTCCGTGGAGTCTGATTTTGCTGAATGCAGGGGAGGGTGGCGAGAGGATT
TACACAGGCTGACACTTTATACTTTTCGCTTACCGACGAGACAAACAGGCGCATTGCAGC
GCCTGTCGGACAGGAATTTCATTTACTGCCGCTGGTGGCTGTATCGAGATGCACCACCGG
GTTTTCGGCGAATAGATAGCGGTCGGCATTGAACTCGAAGTCGTCGCTGGTTTCGTTAAA
TAACATGATCTTGGTGTTTTCCAGATGCTGCCACATTGCCAGCTTAGCAGCATGAGGATC
TTTGCGAATCAGCGCCTTGAGGATTTGATCGTGGTCATCACACCAGTTATCGACGGTACG
GGAATCAATGTGTTCGTGCAGTTTTTTCCAGTACGGGTTATGACTACGCTGGGTCCACAT
TTTTTCCACGATAGCCGCCAGGGCGGAGTTCTGCGTCGCCAGAGCGACCTGAATGTGGAA
CTGCAAATCCCACTCGGAATCACGGAAGCATTGTTCGCCGCGCGCCTGTTCCTGAATGGC
CATCAGTTTCATGATGTCCTGTTTCGTTACCTGAGTTGCCGCGAATTCGGCAATATTACT
TTCGATGAGCTGGCGAGCCTGAAGCAACTCAAACGGACCGTAATTGGCGAATTCCATATT
ATTGTCAGCCGCCTGCTGATGGCGCGGCTGGTTGGAAACCACATGAATACCTGAACCTTT
ACGCACTTCGACATAGCCTTCAACTTCCAGCATGATGATGGCTTCACGAACTACCGTACG
GCTGACGTTCTTTTCATCGGCAATAAAGCGTTCTGCAGGCAGTTTATCACCCACCAGATA
GACGCCCTGTTCGATGCGCTCTTTCAGGTCAGCGGCAAGTTGTTGATACAAACGGCGTGG
TTCAGTGATTTCCATATGCGCTCCAGGCATGATACGGCAGACTATATTTGTTATACCACT
TTTGCGAGTTTAGCTCTACTCGCAGTGATGAAAAAGCCGCCTGAGAAGGCGGCTTTGAAG
GGAAACTAAAACTTACACGAAACGTTAATGTTGCGGTGCGGGATCGTTATGTGTTTCCTG
CGCCACCTCAATCGCCGGTTTGTTCTGCAACACGGTCCAGATAACCAGCGCACCTAACAG
GTCGAACACTGCCAGAACTGCGAACAGCGGGCTGAAGCCGATGGTGTCAGCCAGTGCACC
GACAACCAGCGCAAACAGCGTACTTGCCAGCCATGCGGACATCCCGGTTAAACCGTTTGC
CGTTGCCACTTCGTTACGACCAAACACATCGGAAGAGAGCGTAATCAGCGCGCCAGACAG
TGCCTGGTGGGCAAAACCACCGATACACAGCAGCATAATTGCGACATACGGGTTGGTGAA
CAGGCCGATCATACCCGGGCCAATCATCAGCACTGCACCCAGCGTTACGACCATCTTACG
GGAAACGATCAGGTTCACACCAAACCAACGCTGGAACAGCGGCGGCAGGTAACCACCGAG
GATACAACCGAGGTCAGCAAACAGCATCGGCATCCAGGCGAACATCGCGATCTCTTTCAG
GTTAAAGCCGTAAACTTTAAACATGAACAGCGGGATCCACGCGTTAAAAGTACCCCAGGC
CGGTTCTGCCAGGAAACGCGGCAGCGCGATACCCCAGAACTGACGGTTACGCAGGATCTG
ACCAACGGACATTTTCTTCGCCGTGCTCACCTGGTGCTGGGCTTCCTGACCATTAATAAT
ATAGTCGCGTTCTTCATCGGTCAGATGCTTCTGGTCGCGCGGATGTTTATAGAAAATCAG
CCATGCCATCGCCCAGATAAAGCTCAATGCACCGGAGATGATAAATGCCATCTGCCAGCT
GTGCATTACGATTGCCCATACCACCAGCGGCGGCGCAATCATCGCACCAATCGAAGAACC
TACGTTAAAGTAGCCTACTGCGATGGAACGCTCTTTCGCCGGGAACCATTCGGAGCTGGC
TTTCAGACCCGCCGGGATCATCGCTGCTTCCGCGGCACCGACCGCACCACGAGCAACAGC
CAGGCCACCCCAGCTACCTGCCAGCGCGGTTGCACCACAGAACACGGCCCACAGCACAGC
AAACATTGCATAACCGATTTTCGTACCCAGCACATCCAGTACATAACCTGCTACCGGTTG
CATGACCGTATAAGCAGCAGAATAGGCTGCGATGATATAGGAATACTGTTGGGTGGAGAT
GTTTAACTCTTCCATCAGAGTTGGCGCAGCTGCCGCCACAGTGTTACGCGTCAGGTAACC
AAGCACGGTGCCGAGCGTCACCAGTGCGATCATATACCAACGTAACCCTTTAATTTTACG
CATGTAAAACCTCATCGTTTTGTTATATCCGCAGGAAGCGCGGCCATCATCCCGCCAGAG
GCTGAAGATGTTAGTTACGACCGGGTAACCGAAAAAAAACCGGCACGCCCCGAACGTTGC
CATGAAAGTTTCGTGCTAATTCGGCTTCCGTACCGGTTAACCCGATTCATCTAACAAATG
AATGAATCGGCAATTTGCATTCCGTCGACTTATGATTTGCGACGGCAGAAAGATAACTTG
TCATACAACTTTAAAAGGTGAGAGCCATCACAAATGTGGGAATATTTGTAGGGACATTAC
CTGACGACAGCAAGGCCAGTACTGGCGCGGCCTGCAGCGAGATTTACCACTTTGAGAGTA
ATTTTTTTAACTACGTTTATTGATCTAACTCACGAAAATATCTTCGGACTCTGGAAATTG
GTGTGATAACTTTGTCAGCATCGCACCATAAGCAAGCTAGCTCACTCGTTGAGAGGAAGA
CGAAAATGACTCCGTTTATGACTGAAGATTTCCTGTTAGATACCGAATTTGCCCGCCGTC
TGTATCACGACTACGCAAAAGACCAGCCGATTTTCGATTACCATTGCCATTTGCCGCCGC
AGCAGATTGCGGAAGACTATCGTTTTAAAAACCTGTATGACATCTGGCTGAAAGGCGATC
ACTACAAATGGCGCGCTATGCGTACCAACGGTGTGGCCGAGCGTCTGTGTACCGGTGATG
CGTCTGACCGTGAAAAATTTGACGCCTGGGCGGCGACTGTTCCGCACACTATCGGCAACC
CGTTATACCACTGGACGCACCTCGAACTGCGCCGTCCGTTTGGTATCACTGGCAAATTGC
TTTCTCCGTCAACTGCCGATGAAATCTGGAACGAATGTAACGAACTGCTGGCGCAGGATA
ACTTCTCCGCGCGCGGCATCATGCAGCAGATGAACGTGAAAATGGTCGGCACCACCGATG
ACCCGATCGATTCTCTGGAGCATCACGCAGAGATCGCCAAAGACGGCTCTTTCACCATCA
AAGTGCTGCCGAGCTGGCGTCCGGACAAAGCCTTCAACATCGAACAGGCGACCTTTAACG
ACTACATGGCGAAGCTGGGCGAAGTTTCCGATACCGACATTCGCCGCTTTGCTGACCTGC
AAACTGCCCTGACCAAACGTCTGGATCACTTCGCCGCTCACGGCTGTAAAGTGTCTGACC
ACGCGCTGGATGTGGTGATGTTTGCTGAAGCGAACGAAGCGGAACTGGACAGCATTCTGG
CGCGCCGTCTGGCTGGCGAAACCCTGAGCGAGCACGAAGTGGCGCAGTTCAAAACTGCGG
TACTGGTGTTCCTTGGTGCCGAATATGCACGTCGCGGCTGGGTACAGCAGTACCACATTG
GCGCGCTGCGTAATAACAACCTGCGTCAGTTCAAACTGCTGGGGCCGGATGTAGGCTTTG
ACTCCATCAACGACCGTCCGATGGCGGAAGAGCTGTCTAAGTTGCTGAGCAAGCAGAATG
AAGAAAACCTGCTGCCGAAAACCATTCTGTACTGCCTGAACCCGCGCGATAACGAAGTGC
TGGGCACCATGATCGGTAACTTCCAGGGCGAAGGTATGCCGGGCAAAATGCAGTTCGGTT
CCGGCTGGTGGTTTAACGATCAGAAAGACGGTATGGAACGTCAGATGACCCAACTGGCGC
AGCTCGGTCTGCTGAGCCGCTTTGTCGGTATGCTGACTGACAGCCGTAGCTTCCTGTCAT
ACACCCGTCACGAATACTTCCGCCGCATTCTGTGCCAGATGATCGGTCGCTGGGTGGAAG
CGGGCGAAGCACCGGCGGACATCAACCTGCTGGGCGAGATGGTGAAAAATATTTGCTTTA
ACAATGCGCGTGACTACTTCGCCATTGAACTGAACTAAGGTCTGGGGTTGATATGCAATA
CATCAAGATCCATGCGCTGGATAACGTCGCGGTCGCTTTAGCAGATTTGGCTGAAGGCAC
AGAAGTCAGTGTCGATAACCAGACTGTTACGCTGCGCCAGGATGTTGCTCGTGGACATAA
ATTTGCGTTAACGGATATCGCAAAAGGGGCCAATGTCATCAAATATGGCCTGCCGATTGG
TTATGCATTGGCGGATATTGCGGCAGGTGTTCACGTTCACGCCCACAATACGCGCACGAA
TCTGAGCGATCTGGATCAGTATCGCTATCAACCTGATTTTCAGGATCTGCCTGCGCAAGC
GGCAGATCGTGAAGTGCAGATCTATCGTCGCGCTAACGGCGATGTCGGGGTGCGTAATGA
GCTGTGGATCCTGCCAACCGTGGGCTGTGTCAACGGCATCGCGCGGCAGATCCAGAACCG
TTTTCTGAAAGAGACCAACAACGCCGAAGGTACTGACGGCGTGTTCCTCTTCAGCCACAC
CTACGGCTGCTCACAGCTGGGCGACGATCACATTAATACCCGCACCATGCTGCAAAACAT
GGTGCGCCACCCGAACGCAGGCGCAGTGCTGGTGATTGGTCTGGGCTGTGAAAACAACCA
GGTTGCCGCATTCCGTGAAACGCTGGGCGATATCGATCCTGAACGCGTTCATTTCATGAT
CTGCCAACAGCAGGATGATGAGATCGAAGCCGGAATCGAGCATTTGCATCAGCTGTATAA
CGTGATGCGCAACGATAAACGCGAGCCAGGCAAACTCAGCGAACTGAAGTTTGGTCTGGA
GTGCGGTGGTTCTGACGGTCTTTCTGGTATTACTGCTAACCCGATGCTGGGGCGTTTCTC
TGACTACGTGATTGCTAACGGCGGTACTACCGTACTGACCGAAGTGCCGGAGATGTTTGG
CGCAGAGCAGTTGCTGATGGACCATTGCCGCGACGAAGCAACGTTTGAAAAACTGGTCAC
CATGGTCAACGACTTCAAACAGTACTTTATTGCCCATGATCAGCCGATCTATGAAAACCC
ATCGCCGGGGAACAAAGCGGGCGGTATCACCACGCTGGAAGACAAATCACTTGGCTGTAC
CCAGAAAGCGGGTTCCAGCGTCGTGGTTGACGTGCTGCGTTACGGCGAGCGTCTGAAAAC
GCCAGGGCTGAACTTGTTAAGTGCGCCGGGTAACGATGCCGTAGCGACCAGCGCCCTGGC
GGGTGCGGGCTGCCATATGGTGCTGTTCAGTACTGGTCGTGGCACGCCGTATGGTGGATT
TGTGCCGACGGTGAAAATCGCCACCAACAGTGAACTGGCGGCGAAGAAAAAACACTGGAT
CGACTTTGACGCGGGTCAGTTGATCCACGGTAAAGCGATGCCGCAGTTGCTGGAAGAATT
TATCGACACCATCGTTGAGTTTGCCAACGGTAAGCAAACCTGTAACGAGCGTAACGACTT
CCGCGAACTGGCGATCTTCAAAAGCGGCGTAACGCTATAAAGTCGAAATGAGTTGTTAAT
AAAAAACGGCGTTTCATAATGTGAAGCGCCGTTTGCTTTTCCATACCTGCTAAGGATTTA
TCATGACCGCGTATTGGCTGGCCCAGGGCGTGGGTGTCATCGCCTTTCTGATTGGTATCA
CAACATTTTTCAATCGTGACGAACGTCGCTTCAAAAAGCAGCTTTCGGTCTATAGCGCCG
TTATTGGCGTACATTTTTTTCTTCTGGGCACCTATCCCGCTGGTGCCAGTGCCATCCTTA
ATGCCATTCGTACATTGATTACCTTACGCACGCGCAGCTTATGGGTAATGGCGATTTTTA
TTGTGCTGACTGGCGGAATTGGCCTCGCGAAGTTCCATCATCCTGTCGAACTATTGCCGG
TTATCGGCACGATTGTCAGTACCTGGGCGCTATTCTGCTGTAAAGGGCTGACCATGCGCT
GCGTAATGTGGTTTTCAACGTGTTGCTGGGTGATTCACAACTTCTGGGCGGGGTCGATAG
GCGGCACGATGATTGAGGGTAGTTTTCTGCTTATGAATGGCCTGAATATCATTCGTTTCT
GGCGGATGCAGAAAAGGGGAATTGATCCGTTTAAAGTTGAGAAAACCCCTTCCGCCGTAG
ACGAAAGGGGTTAAACAATTAATTACGCAGGGCGCTATTTGCCAGACGATCGTCTTCTGC
CTGGCAAGCTGCCGCAGTGAACAGCACGTCAGTTGAAGAGTTCAGCGCGGTTTCGCAAGA
GTCCTGCAATACGCCGATGATAAAGCCGACGGCAACCACCTGCATGGCGATATCGTTCGA
AATACCGAACATATTACAGGCCAGTGGGATCAGCAGCAGAGACCCCCCCGCCACGCCGGA
TGCGCCACAGGCACACAGAGAAGCCACCACGCTCAACAGCAGCGCCGTGGGCAGATCGAC
CGGAATACCCAGCGTATTAACCGCAGCCAGCGTCAACACGGTAATAGTGATTGCTGCGCC
CGCCATATTGATGGTGGCTCCCAGCGGAATAGAAACGGAATAGGTATCGCGATCCAGATT
CAGCTTTTCACACAGCGCCATATTCACCGGAATGTTCGCTGCAGAGCTGCGGGTGAAGAA
GGCATACACACCGCTTTCGCGCAGGCACAGCAGCACCAGCGGGAACGGGTTACGACGAAT
TTTCCACCACACCAGCAATGGGTTAACCACCAGCGCCACCAGTAACATACAGCCAACCAG
CACGACCAGCAGTTGCGCGTAGCCCCACAGTGTGGAGAAACCGGTGGTTGCCAGGGTAGA
AGAAACCAGCCCAAAAATACCAATCGGTGCGAAGCGAATGACCAGTTTCACCATAAAGGT
AACGGCATTCGACATATCGTTAACCAGGTTTTTGGTGGTCTCGTTACCGTGACGCAGTGC
GAAGCCGAGGCCGATCGCCCACACCAGAATCCCGATGTAGTTACCTTTCAGCAGCGCGTC
GATGGGGTTGGAAACCATGCTCATTACCAGCCCGCGCATCACTTCGACAATGCCTGACGG
CGGCGAAATATCACCCGCGCTACTGGATAAATGCAGGGTAGAAGGGAAGGCAAAGCTGAA
GACTACTGCGGCCAGAGCAGCAGAGAAGGTGCCCAGTAGATAGAGGAACAAAATAGGGCG
GATATTGGTTTTCTGCCCGTGCTGGTGGTTAGCAATAGATGCCATCACCAGCATCAACAC
CAGGATGGGGGCAACGGCTTTCAGTGCGCCGACGAACAAAGTACCTAACAGACCAACAGC
TTCCGCCGCGGGTTTTGAGATCCATGCCAGAAGAATCCCCAGAACAAGGCCGACCAGGAT
TTGTTTTACCAGGCTGCCATGAGCCAGACGCCGGAATAGCCCCGGTGAACGTTGCGTAGT
CATTTTTCGATCCTTTCATTGTGTTGTCGCACATCCCTGGTGCGTTCTGTCGACGCATCT
TTCAGGATGTAACAAAGTGTTTGCAAGGTCGAGTATAAGGAAAGTTACAGCTTCGGGAAG
CGAAAAATGCTGGATTTTAAAGAGAGGTCATATTTTGAAACTTAATGGTTACATTTCTTT
GACATAAAAATAAAGCCAACGTGCGGCTTCCAGACTGATGACAACATCAAAAAAGGACTC
GGTCAGTCCCCTCGCCCCGTTTGGGGAGAGGGTTAGGGTGAGGGGAACAGGCCAGCATCG
GTGCGAAAAATTACCCTCACCCCGACCCTCTCCCTGGAAGGGAGAGGGAGAAAACGGTGC
TCATGTTAATGACAGGGTACACGGCTTAGGCAGATTAAAAATTATCCACCCCGCTGCTTA
TCATGCCGATAATTCACCCAGGCGTTGATAATAAACGTCATCACCAGAATGCCAAACACC
ACGCCCAGCGAGACGGCGATTGGAATATGGTAGAAGTCGACAATCAGCATCTTGATACCG
ATAAACACCAGAATCACCGCCAGGCCATATTTGAGCATCGAGAAACGCTCTGCTACGCCC
GCCAGCAGGAAATACATCGCACGCAGGCCGAGGATCGCAAACAGGTTTGAGGTCAGCACA
ATGAACGGGTCAGTGGTCACGGCGAAGATAGCCGGAATGCTATCCACGGCGAAAATCACG
TCGCTCAATTCCACCAGAATCAGTACCAGCATCAGCGGTGTGGCGTACAGCAATCCATTC
TTACGCACAAAGAAATGCTCGTTGTCGATGGTGTCGGTCATGCGCAAATGACCGCGTAGC
CAGCGCACCAGCGGCTTGTCGCCAATGCCTGATTCATCTTCATGGGCGAGCGCCATCTTC
ACGCCGGTAAACAGCAGGAAGGCACCGAAGATATACAGGATCCAGTCGAACTGCGAAATT
AGCCAGCTGCCAGTGAAGATCATGATGGTACGCAGAACAATCGCCCCGAGCACGCCATAC
ACCAGCACGCGGCGTTGTAATGCCGCCGGAACAGAGAAATAGCTGAACAACATCAGCCAG
ACAAAGACGTTATCGACCGCCAGCGATTTCTCAATCAGATAACCTGTGAGAAAGGCCAGT
GCCTGTGGATCGGCAACGGCGCGACCTTCGGTTTGCACCAGATACCACCAGAAAGCGGCG
TTAAACAGTAACGACAGCGTCACCCAGACCAGCGACCAGGCCGCAGCCTGTTTCATGGTC
ATGGCATGTGCCCCACGACGCCCCTGCAACAACAGGTCGATAGCCAGCATAATGGCGACA
ACAACAGCGAATCCGCCCCATAGCAACGGCGTGCCGACAGTATTCATAGAAGTTCCTTAC
ACATAAAAAAACGGCCAACGTCGGAAGACGTCAGCCGCTGCTTTTTATGCATAGACCTCG
CCTTCCGGCAAGGTCTCACTTACAACAAAAAAGGAATACGTCTGCGTATTCCTTTCGGGT
TGCCCGGTGACCGGATGTGTTTTTTCACACATCGTAATGACGATCGACCGGCAATGAAGT
TACTCCCCTTTGCAGGTAACAAAGTATGACAGACCATTCAGCCAGTCAATGGTCTGTTAC
ATACCTTTTACACTGTTTTACTTTGGCAATTATAGTTTTACGCTATCTGCCGGAAAAATC
ACCCCAGTCTGGCGGCGGATCTCGGTCAGCAGTTTGGCGGTGATGCGACTGACCGCCAGC
CCTGGATGATCCACCAGATGCTCATCCACCAGGGTAGCGAACAGCTCTGCTTCGTAGAGC
ATGGTATTAATATGCTGCGGCTGGGTGAGATCCTGCATTTGGCTGCCACGCGGCACGAAG
CACACTTTCTGGCATTCAGACAGTTTTTCAATCACCAGCGATCCTGCTTCGCCCTGAATC
TCGCTCGCCAGGACAGAATCACTGACTTTTGAGTGCTGCAAGGTGACGCTGAAATCACCG
TAATCCATCACCACCACGCCCTGGGCGTCAACGCCGCTTGCCAGCAAACTGGCGGTTGCC
TGCACGCTTTTCGGCTCACCAAATAACGCCACCGCCGACGCCAGACAGTAAAAACCGATA
TCCATAATTGAACCGTTAGAGAATGCCGGATTAAAGGTGTTGGGATTCTCACCATCCAGG
TAACGTTGATACCGCGAGGAATACTGGCAATAGTTGAAAAAGACTTTCCGCAGTTTGCCG
ACTTTCGGCAGCGCCTGGCGCAACAAATGAAAGTTCGGCAGGCAGGCGGTTTTAAATGCC
TCAAACAGCACCACCTGATTTTCCCGCGCACAGGCAATGGCGGCATCCACTTCCGCCAGA
TTCGACGCCAGCGGTTTCTCGCAAATCACATTAATTTTATGGCTAAGGAAAAGTTGTGTC
TGGGAAAAATGCAGGGAATTCGGGCTGGCAATATACACCGCGTCAATGGCATCGCTTTCC
GCCATCGCTTCCAGCGAGGTAAACAGATGCTCGACAGAAAAATCATTGGCGAAGTGCTGG
GCCTGTTCAAGGCTGCGGGAATATACGGCGGTTAACTTGTATTTACCGCTCTCATGGGCG
GCCTCGACGAACTGGCGAGTGATCCAGTTCGTACCAATCACAGCGAAACGTATCATAACG
CGTGGATACTCCATAAAGGGATTCTGTCGTCAATGTAGCACGCCTTTTTCATCTTCGACG
TGCGCAGATACGCATTATTTCTGCGCCGGACAGCCATGCTCACTAAACGGCCCAATCATG
ACCGAAGGCCCGAGATATTTCGGCTGGCGATGGAGGATTTTGGCGTCAATCACGGCGCTG
ACACGAGCGAGTTTCTCCCGCAGTTGAGTATAAAAACCGTGCTTCATATTGAGGTCTGGC
GCGTTAAAACCGATAGCGTCGATGCCGTACTGTTTTGCCAGCCAGATGGCGCGTTGATTA
TGAAATTCTTGCGAGATAATGGTGATATGGTTTTCACCAAAAACCTTTTTGGCACGCACT
ACCGAATCCAGCGTTGAGAATCCGGCATAGTCGCAGAAGATCACTTTTGCTGGTACGCCT
TTAGCGATCAAAGCCTGCTGCATACCTGATGCTTCATCGTAATTTTTACGTCCGTTATCG
CCACTTACCAGCAGCCATTTCACTTTTCCGGCGTGGTACAACGCTGCTGCGGTATCAATA
CGTCGGGTAAAGTAGCGATTACCCGGCCTCGCCCCCAGCAATAAACCCACGTTACGCGCC
GGAACGGCGTTGACATCGCTCCAGGTCAGCTGTTTGCTGGCGTTGACCATTACGCGATCG
GCGATAAGGATGGTCGCTCCTGCCACAAGTAACAGTAAGCAGGCAATCTTTAGAGTCCGG
CGAGAAAAACAAATACGGAGAAGAAGGCGGGCAAATGCGCGCAGCATGGTCGTTATCCTT
AACGAAAGGGGGGAGGTCGATTTTAGGCGCTAAAGAAAGAAAAGATAACGCCTGACATCA
TTTTCAGATTTTGTTCTGCCCAAGCGACAACTGCGTTAGCCACAGTCGGGTGTCGAACTC
AAGCTGGTGGTACTGGGGTTCCATATGACAACACAACTGGTAAAACGCTTTGTTATGCTC
TTTCTCCTTCAGGTGCGCCAGCTCGTGCACCACGATCATGCGCAAAAACGGTTCCGGCGC
GTTGCGAAACACGGTAGCGACGCGGATCTCCACCTTTGCTTTCAGCTTGCCGCCCTGCAC
ACGAGAAACAGCGGTATGTAACCCGAGCGCGTTTTTTAGCACATGGATCTTATTGTCATA
CATCACTTTATTGATCGGCGGGGCATTACGCAGAAACTGATTTTTCAGATCCTGAGTATA
TTGCCAGAGGGCTTTATCGGTGGCGTAGTCGTGTGTTCCCGGATAGCGTTTTGCCAGCAC
ATCGCCCAGACGCTGTTCGTTAATCAGTGTTCGCACCTGGGAAAGTAGCTGCTCGGGATA
ACCCTGAAGATAAGTAAGATTGCTCATAACCGCCCACGAAAAAGAGAAAAAGGGTATACT
CACGCACCCTTTTCAGGGGCAATGTCGAAATTTTATCATTCAGGAGGGCCGATGAGCCAC
TTAGACAACGGTTTCCGTTCACTGACACTACAACGTTTTCCGGCGACGGATGACGTTAAC
CCGCTACAGGCGTGGGAAGCGGCGGATGAATATTTGCTGCAACAGTTGGACGACACAGAA
ATCCGCGGCCCGGTGTTGATCCTGAATGATGCCTTTGGTGCGTTAAGCTGCGCACTGGCG
GAACATAAGCCGTACAGCATTGGCGACTCATACATCAGTGAACTGGCGACGCGCGAGAAT
TTACGCCTCAACGGGATTGATGAGTCGAGCGTGAAGTTTCTCGACAGCACCGCCGACTAC
CCGCAACAGCCGGGTGTGGTGCTGATCAAAGTGCCGAAAACACTGGCATTGCTGGAACAG
CAACTGCGTGCGCTGCGCAAAGTGGTCACGTCGGATACACGTATTATTGCCGGTGCCAAG
GCCCGTGACATTCACACTTCCACGCTGGAACTGTTCGAAAAAGTGCTCGGCCCAACCACC
ACCACGCTGGCATGGAAAAAAGCGCGCCTGATTAATTGCACTTTCAATGAACCGCAGCTG
GCCGATGCGCCGCAGACCGTTAGCTGGAAGCTGGAAGGTACTGACTGGACTATCCACAAC
CATGCGAATGTCTTCTCCCGCACCGGGCTTGATATCGGCGCGCGCTTCTTTATGCAACAT
CTGCCAGAGAATCTCGAAGGGGAGATTGTCGATCTCGGTTGCGGTAATGGCGTTATTGGT
CTGACGCTGCTTGATAAAAACCCGCAGGCGAAAGTGGTGTTTGTCGATGAATCGCCGATG
GCGGTTGCTTCCAGCCGTTTGAACGTTGAAACCAACATGCCAGAGGCGTTGGATCGCTGC
GAGTTTATGATCAACAACGCGCTCTCCGGCGTGGAGCCTTTCCGCTTTAATGCTGTGCTC
TGCAACCCGCCGTTTCACCAACAACATGCGCTGACCGATAACGTCGCCTGGGAGATGTTC
CACCACGCCCGCCGCTGCCTGAAAATCAACGGCGAGCTGTATATCGTTGCCAACCGTCAC
CTGGATTACTTCCATAAACTGAAGAAGATTTTCGGCAACTGCACCACTATTGCGACGAAT
AATAAATTTGTGGTACTGAAAGCGGTGAAGCTGGGACGTCGTCGGTAAGATTGGGAGTTA
CCTGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACGTTCAGCACGTTACTCCAGGCCG
GATAAGACGCGGCAAGCGTCGCATCCGGCAATGTCTGCCCAGTTCTGGAATCGCGCTTCC
ATAAAACAAAAAATCCCTGTCACCATCGTCTACATTCTCTTGTTTAGCGTTTTTCTACGT
TTATTCTTCCGTCACACAGATAAATTCATCCGTTGCCAATCTGGCAACGGATGTTATCAT
ATTGCCAATTTGTCAACGGACGTGATGAAGAATGCACCTGATAACTCAAAAAGCATTGAA
AGATGCTGCGGAAAAATACCCGCAACATAAAACGGAGTTGGTGGCTCTGGGGAACACGAT
TGCTAAGGGATATTTCAAAAAACCTGAGTCATTAAAAGCAGTATTCCCATCTCTGGATAA
CTTCAAATATCTGGATAAGCATTATGTTTTCAATGTTGGGGGCAATGAATTACGTGTTGT
AGCAATGGTCTTTTTTGAATCGCAAAAGTGCTACATACGTGAAGTTATGACGCATAAAGA
ATACGATTTCTTTACCGCTGTTCATCGTACTAAGGGGAAAAAATGATTGCGATTGCCGAC
ATCTTGCAAGCAGGAGAAAAGCTAACTGCTGTGGCACCTTTTCTGGCGGGTATTCAGAAC
GAGGAACAATACACCCAGGCGCTGGAACTGGTAGATCATCTGCTGCTCAACGATCCTGAA
AACCCCTTGCTGGATCTGGTGTGTGCCAAAATAACCGCGTGGGAAGAATCAGCGCCCGAA
TTTGCGGAATTTAATGCCATGGCTCAAGCCATGCCTGGCGGTATAGCCGTGATTCGTACC
CTTATGGATCAATATGGTTTAACCCTTTCCGATCTGCCGGAAATTGGCAGTAAATCTATG
GTGTCACGCGTTTTGAGCGGGAAGAGGAAATTAACGCTGGAACACGCTAAAAAATTGGCA
ACGCGATTCGGCATTTCTCCCGCCTTGTTTATTGATTAACGCGACGTGCCGGATGCGTTG
CATCCGGCGCTTCAAATAACGATTTAAATCTCCAGCGCCAGCCGTGTTCCCTGGGCAATT
GCCCGTCGTGCGTCCAGCTCCATAGCCACATCGCAGCCGCCAATTAAATGCACCGTTTTC
CCGCTATCAATCAGCGGTTGCGCCAGCGCGCGGTTTGGCTCTTGCCCTGCGCAGATCACC
ACATTGTCCACTGCTAATACCTGCGTTTCGCCGTTGATCACCACATGCAGCCCGTCATCG
TCAATCTTCTGATAACTTACGCCTGGGATCATTTTCACACCCCGCGAGAGCAGGGTGGTG
CGATGGATCCAGCCGGTGGTTTTGCCTAACCCCTGTCCTGGTTTGCTGGCTTTGCGCTGG
AGCATCACAATCTGCCGTGGGCTACGGGGGATCTGCATTCCCTGCGGGCTTAAGCCACCA
GCCTGTTGTAGGCTACTGTCGATCCCCCATTCATTACAGAACCCGGCGATATTCTGGCTG
GTGGATTCGCCCGGCTGACTTAAATACATCGCCGTATCAAAACCAATCCCGCCACAACCG
ATGATGGCAACTTTGTTGCCAACCGGCGCTTTGTCGCGCAGTACATCGAGATAACTCAAT
ACCTTCGGATGATCGATCCCGTCGATGGGCGGAGTGCGCGGCACGATCCCACTGGCGAGG
ATCGTTTCATCGAAAGCCTGTAACTGATCCGCCGTCACGGTGTGATTGAGTTTTAGCGTC
ACGCCCGTCACTTCGATCATCCGGCGGTAATAGCGCAGCGTTTCGTAAAACTCCTCTTTG
CCGGGGATCTGTTTGGCGATATTAAACTGCCCGCCAATCTCGCTATGAGCGTCAAACAAT
GTTACCTGATGCCCACGCGCCGCCGCGTTAATGGCAAACGCCAGCCCAGCAGGTCCCGCA
CCGACCACCGCCAGATTTTTTTTCTGCACGGCGGGAAGGATTGGCATTTTGGTTTCGTGG
CAGGCGCGAGGATTCACCAGGCACGAGGTGACTTTGCCAACGAAGATTTGATCGAGACAG
GCCTGATTGCAGCCAATACAAGTGTTGATCTCATCGGCTCGTCCCGATTGCGCTTTTGAC
AGCAGCTCCGCATCAGCAAGAAACGGTCGCGCCATCGATACCATATCGGCATCGCCGCGC
GAGAGAATATCGTCGGCAACCTGCGGATCGTTAATCCGGTTGGTGGTTACCAGCGGCAGC
GAGACGTGGCCTTTCAGTTTGCGCGTGACCCAGCTAAATGCGCCGCGCGGCACGGGCGTG
GCAATGGTCGGAATACGTGCTTCATGCCAGCCAATGCCGGTGTTGATAATGGTCGCGCCC
GCCGCTTCAATGGCCTGCGCCAGCTCTACCGTTTCGGCAAAAGTCCCGCCGTCTTCGACC
AGGTCGAGCATCGACAGTCGGTAGATAATAATGAAGTCGTTGCCGACGCGTTCGCGCACC
GCACGCACTACTTCTACGGCAAATCGCATCCGGTTGCGGTAATCGCCGCCCCACTGGTCA
CTACGCTGATTGGTGCGCAGCGTCAGAAATTCGTTGATCAAATACCCTTCGGAACCCATC
ACCTCTACACCGTCGTATCCTGCCTCCCGCGCCAGTTGCGCGCAGCGGGCGAAATTGTCG
ATCAGTTGCAGGATCTCTTCATGGCTTAACTCATGGGGCACGAAACGGTTGATGGGGGCC
TGCAATGCGGACGGGGCGACCAGATGCGGTTGGTAGCTGTAGCGCCCGGTATGCAAAATT
TGCAGGGCTATTTTGCCGCCTTCCTGATGTACCGCTTCGGTAATGGTGCGATGGTGTGGG
ATCTGGCTGGCGTCGTTGAGCATTGCGCCACCTTCCATGCCAACGCCTGTTAAATCTGGT
GCAATGCCGCCGCTGACAATCAGCGCCACGCCGTGACGGGCGCGTTCGGCATAAAACGCT
GCCAGCCGCTCGGCACCGTCCGGGTATTCCTCCAGCCCGGTGTGCATTGAGCCCATCAAC
ACGCGGTTTTTTAACGTGGTAAAACCTAAATCCAGCGGGGCGAACAGCGACGGGTAGCTC
ATAAAATTGTCCAGTATGTAAAATAATTGTTATGTGGTCGGATGAGTTCTAATTTAGCCG
TCGCCGGAGAAAAGGGAAAAGGGGAGTGCGGGGTTTGTGATGGGATTCAAAAAGAATACG
CCCGGTGATAACGCCGGATGCGACGCTTGTCGCGTTTTATCCAGGTTACGGAATTGCACA
TGTAGGGCGGATAAGGCGTCCACGCCGCATCCGCCAGTGGCGCGGTGCAGATGCCGGATG
CGACGCTTGTCGCGTCTTATCCGACCTACGGGAACACACATGTAGGGCGGATAAGGCGTT
CACGCCGCATCCGCCAGTGGCGCGGTGCAGTTGCCGGATGCAACGCTTGCCGCGTTTTAT
CCGGCCAGGAGGATTGCACATGTAGGGCGGATAAGGCGTTTACGCCGCATCCGCCAGCAG
TTGCAAATTATTGCTTACGGAAAAAATCGTTATACAACATATACAAATGCGCGGCACTCC
AGGAGAAATTTGGTGCGCCTTGCTGTGCGCCTGTCAGCGGGTTGTAATTTTCCTGAATTG
GTCCATCGGCGGTTAACCCTTTGGCGTGCCGGAAGAACGTATCCGCCAGCTTCAGGGCAT
CATCACGATAACCGTAACGCTCCATCCCTTTCAGACCAAACCAGAACTGATCCACCCATA
CGCGCCCACGCCAGTAGATATCAGCGCCAAAAGCCGGATTGGTTAACGCCGCCGTTCCCA
GCGGGACAAAGGTGTTGAACTCTTTAGGATCGAGCATCACCTTCACCACCGCGTCGGCAT
TGGCCTGCGTTGCCGCACCGTTAAACAGCGGCGACCAGCCTTCCGGCCCTTTACCGCGCT
CAACAATCGGTTTGCCCGCGCAGCCGTTCGCCAGTGGTTTATCTTCAATACGTACGTCAT
AGTAGAACTGGGTAGTCGGGTCGAACATACAGGTGTTGATGTAGTCCGCGAGCTGCTGTG
CCAACTGGCGATAGCGTTTGGCCTCTTCTGGCTTACCGAGGATGGTTGCCATCTCCGCCA
GATAATGGTTATCGCTGTACATATAGCTGGCCTGATCCACCGACTCCTGCAATAGCGAGT
AGCCCAGCAACGTTCCGTCCTGACTGCGGTTTTCGGCGAATTTCACCGTCCAGTCGCTAC
GTTTGCCGCCATTAGCGACATATTTATCCAACTGTTCTTTGTCGATAAACCCAAAGACGG
CGGCATCATCACGCCCCGATTCCCACGATGCAGCAACCTGTGCCGGAATTTCCAGACTGT
CGTACTGGCCTTTCTCCACCACGCGGGCGTAGTTGTTCAGCCCAGACTGCGTCTCTTCTT
TATCGCCTTTTTTCACCGTAAACAGCATCTCGCCGCTCTCAGTGTTGTGGGCTTTGTCGC
GGGTCGCGCCATATTCCGGCACGCCGTTGCCGTTGTGATCGCGGTTACGTAACCACCAGT
CGTGATAGGCCACCAGTTTCGGGTACATCTCTGCCACCCAGGTTTTATCTTGGGTGACGT
TATACACTTCCATCACCGACCAGGCGGCAAGGCTGGGTTTGGTATTACGTTCGTTCCAGT
TGCCGCCATCGCCACCACGCTCGGGGCTAAGGTTCCACGCTATCAGGTCGGGGACAAAGC
CCACATCCTGCGGACGCACGCTATCGCCAGGCTGGATCTGCCAGGAGAAGACCGCGCGGA
TATTCTCTTTGGCGATGTCCGGATTGAAATGCGCCATCGCAAACGCCTGCTTCCAGGTAT
CCCACGGCCAGGTCTGATTGCCGGAGAACCAGCGCCCGGTCACCGACGGTGTAACGGTGT
TAAATTTCACCGCACCGCCCGGTGAGCGCCAGTTACCGTTGAGCGTTTCGATCGCTTTCA
CCGCGACGCGCGTCTGTTCCGGCGTCGCATCCGGATTGGTTAACCCTTTCTTCAGGTATT
CTTCCCAGCGTTGCTGCGAGGCGGTGAGATAAAACGCCGGACGCGCCAGAATATCGCGGA
TCTGCATTTGCTCTTTGCTAACTTCCTGAGCGGTCAGCAGATGGGAATAGGTGGTGTAGA
GCGTGGTCGAACCGTTGATATGCGCCTTACTGGTAAAGCGATTACCGTTGATTTCAGTCT
GCACCGGCAGGGATTTATGCACCTGATATTCCGATTCGCCGGAGGTCAGCAGATCCCAGG
TGGCGCGCACTTTGCCAAAGGTGACTTTCAGGCCATCACGGGTGGCGCTGATTTTGCGCT
GATAGTCAGGGTATTCGCCAGCAATGGTTTTATCGGAAAGCGGTTTCCCTTCTTTCGCTT
CCAGTTTTTCCAGCAGTTCGCCGTCCCACACCAGATCCAGCGGTTTATTGCTGGTGATTT
TGGTTTCCAGTAGTGACGTGCGCGGCGTGGCGAAGCGCAGAGTCATTTCGACTTGCACAT
CTTTTGCTGTCAGTTTTTGCACCAGCGCACCGGGAATACTGTATGCCTCCAGCGTAAAGT
CGACTTTCTTGCCGTCCTGCCAGACGGTCAGGCGGTCGAAATTGCTGGCCATAAAGTTGA
TGTACTCTTCCGTCAGCAGCGCAACGCCCGGAAAGCCGCCCATGGTGTTAGGGCCGTCTG
GCAACAGATGACCATGCCAGGCTCCGAGATCGAAAAACGGATTAAAACGCTGGTGATCGT
CGTAATCGTAATCCTTCATGTACTGCGGCGCGCCAGTACGGTTAATCACGTTTTTATAAT
TGTCGGCGTTAGCGGCATGGGCGGAAAAACTTATCAGCAGAGCGCAGGTTACTGGCGTTA
AAATAGTTTTTATTTTCATGAAATTACAGTCCTTATTACCAGTAGAAATATTGCATCAGG
AAGATTTGGTCGCTGGGATCGTGAGAGGCATTTTTCATGTAGAAGCGGCTATCAAAAGCC
GTGGCGAAACGTCCGCCGCCGTATTCGTACCAGATACCAAACTGCATGAAAGAGGTGGTT
TCATCGTCAGCGTGGTCAGGGCGATGTTTGGCGTAGGTGTAAGCGGTGGAGAGATAAACG
CCCTTTAACGCTTCATACATGGCGCTCACCATCATCCCACTTTCACTTCCCGGTACGTCC
AGCCCGTCGGCGCGTCCGGTATGGTGCCAGGCGCGAGCGGCAAAGTTAGGAGTTAGCAGG
CCCGTGAGATAGAGCTGTCCTGTGCCGTCGGTGATTTCCAGACCGTTCATCCAGGTGATG
CCTTCGGCAAGGTCATACTGGATGTAACCGTTCATCATTGCCGGATAGGTGTATTTGTCG
TCATAGCGATCGTATTTGCCAAAATGTAGCCAGGCTTTGCTTTCATCATGATGTCCGGCA
GGAGTCGCGGTGACGCTATAACGAAAGTTGCCGCTTAAGTTCTGTACCTTCAGCGCAGTC
ATAATGTCGCGGGTATTGGGAATGACGTAGCCCAGATCGGGGGTGAAATCGCCCCACCAT
TGCAGGTCATCCAGCGAGGAATCCTGACGCAGACTGAGCATGATTTCGGTGCCATCATTG
GTACGATAACCGCCATAGAAACGGTTAATTCCGCCCTCGAAACCACCCCAGCTATGGTCT
GGCACCCAGGCATTGCCGTCGTGGTCGGCCTGCACGGTCCAGCCTTCGCCGTAAATCAGG
CCGAACCAGGAGCCGTACTTCATCTCCAGGCCACCTTCAATATAGGTACCGTCGCTGTAT
TTATGTTTATTCTCACCCTCTAAATCCATATATCCACCAACCCCTAATTCGCCGTAAAAA
CGAAATGAAGGAGAAGATGTCGAGGTAATTGCGGGTGTTTTTGTGTCGTCATGTTCTGCC
GGACGTGCTTCTTCTCCTGCCGCAGAAAAGGCGTAGCAAAACGGCAGAGCAAGTAATGCT
CTGCATGGTGCAGTGATTAATTTCATTGTGTTAATCCATGAGCTAAAGAAAAAGTACAGC
CTTTTATCGTTGTAATTATAAAAATATAAAGGCAGAAACTATTTTCCCTCTCCTCATCCA
GGAAGAGGGAAAATGCCTGCTCATTTTTTATTATTCTGCTTAATCAACATTGCTGGCTGG
CGTCGCTTCAATATGGCGCTCTTCAGCCGTTAATCCCTTTATATATTTACTGTATTTCCA
CCACGCAAAGCCAAGGAAGATAACAATACCGCCGACGTTATAAAAAATGATGGTCAGAAT
ATTCGCGCCAGTCGGGAATGTCGAAGCGACAAACCCTACGGCAAATATCGCAATCAGCAT
TGAAACAACGATAATACCGGTGCGGCGGGAGCCCATACGGAAATCGCGTGGCAGGTGATC
TAATTTGGCGCGTAAATTCAGGTAAGCCAGCATGATGAATAACGGCGGAAGCATGGACGC
TGCGGCGGTCATATTAATAATAGTATTCATCAGATCCTGCACGGTATTGGAACCGAGCAT
CGGGATAATCATCAGCGGGATGACGATCAGGAACTGGATCCACGCTGCGCGCGCCGGAAC
GCCGTTTTCGTTCAGTTCGACGGTTTTCTTACCAAAGATGCCTTCCGGGATTTCGGAGAA
GAAAATTTTCACCGGCGTTGCGGTCCACATCAGCAGGGAACCGAACATCGCGGTAAAGGA
CACCAGACCGACAAAGCGATTCATCAACGCTTCCGGTAGACCAAAATACGCCGCCATGCC
GTGGAATACCTGCACCGATCCGCCGGTAAATTTCAACTCTTTGCTGCTGACGAAGACGTT
AATCAGCACCGAGGAGACGGAATACAGTACGCCGATAAAAATCCCGGCGAGGATGATCAC
TTTAACGAACGATTTCGAACCGCCTTTGACGTCGTTAACGTACACAGCGACGGACTCCGC
GCCACCTGCGGCCATAAAGATCCAGGTGGTAACGCCGAGGAACGCCCAGTTGAAGTTCGG
GATCATCGCGTCAACGGTGATGGCGTCAGCAGGCTGTACGCCGCCAACCAGCGCCGTACC
TGCCAGTAAAATGTAGGAGAGCGTTAACAGCAGCATCAGCGTTGAAGTGACGGAGGTAAT
TGGCCCCAACATTTTCGCCCCGTTGGTGGAAACCCAGGTGGAGAAGGCGAACAGCACCAT
ACTGATAATGGTGGTGGCAACCGGCGTCATAATATATTCGTATCCGAGGAAGGCATACGA
AGCATAAGCAATAACGCGCGGCAACAGTGAGGTGAAAAAGAACAGGTTTACGAACCAGTA
GGTATAGGCAGTAATAAATGCCCAACGTCCGCCCAGCGAACTTTTTACCCACGCGTAGAC
ACCGGCTTCTGAGTTTTTATTTAACGAAACAAATTCTGCGATGATCAGACAGAAGGGAAT
AAAATAAAAAATCGTCGCGAGGAAAAACATCGGTGCCGAGGCCAGTCCAAGCTCAATATT
ATTATTGATAACGTTGTTAAAGCTGTAAACGGCGGCAAAAGTCAGCGAGAGCAAGCCGAA
TTTGCCGATTGTATTACGTTTGGTATCAGACATAACACATCTCCGAAAATGAGTAGGGTA
GCGGTGGCGGCAAACTCCTTTTGCCGCCGTAGTTGTTATTTGTTATGGAAATAACCATCT
TCGATGGTGACTTTGAGAACCACTTTTTTGACCGCGTTATTGCAGATAAACCGATACGCT
TCATGGATATCGCAAATAACGATTTGCCCTTCGTGGACCTCAACGGTTTCTCCGCAGCCT
TTTAAATATTCACGGTCAGTTTCATCACGATAATATTCCACTACCTGTAATGTCTCTTTC
GGCGCATATTCAATTTTTTGCTGCCCTTGCAGGTAGTAATGCACTTCAAAATAGCGTCGA
TGCCCGGTAAATAGCGCATCGGTCGCGGAGTCTGTCTCCACGCGGTAAGTCAATGAGTCA
CCGATGGAGTGGGCGACGCCAGGCTGAATGTTGTCGATATTTTCAATCGCTTCAACGCAG
CGTTGCCACTTCTTGCCAGAGGCGTAAATCTGGCGGAACTGTTCTAAGTTATCGATGATC
CTCATTGCTTATTCTCGCTGTGCAAATTCGTGGAAAAGAACCCTGCGCCGAACTCATACG
ACGCCAGGCTTTGCGCGGTAGCTTCTCCGCCAGAAACCGGCAGCAACGTAAAGCCGTAGC
TGAAGTCACGGAACCAGACGCGCCAGGAGTCCAGCACCTCGCTGCCCCAGGAGTTGGAGC
CGAGGCCAAGCAGCTGGTGATCGAGGTTCAGGGTGATGTCATCACTGCGCTGCAGCTCGT
TACAGTGCTGGGCAGCGTGGATGTTTTCCTGGGTATAGTGCCAGGCGCTGAAGTTAATTG
GGCGCTGCGGAACCACCAGCAGACCGTTACCGTGGCGGTTAGTCAGTGCCGTCCAGCGGA
CATGCTGACGGTTACCGTTGTTCTGCGGGAAGGGATAGTTCTCGAACATGGCATCGACGG
TGCTGCGCCAGATATCGATGATGTTAGCCTGCTGGCTGTCGGCGTAGTTTTCGCCCGGTC
CACGACCGTAATACGCCACCTGATCGTATTCGCCGTTAATTCCCATGGTGAAACCGATGC
ACGGAATGATGTGCGGATAGTCGCCGTAACGCTCGCCGGAAAGCGCCACGTTAACCTGGC
CATCGGCAGCGATGCGCCAGATGTAGGTGCAGCGCATCCCGAAGTCAAACACCGGCGGGG
CAATAACTGTGCGGCTGATGATCAGCACTTCACCATCGCTCTGTTCTACGGCAAAGTCGC
GCAGATGTTCCTGCATGATCTGCAAATGATTCGGTTGCCACAGCCCTTCGTACTCCTGCT
TGTGGTTGTCGATCATCGGCTTGAAGAAGTTGATCTTTGGCTCGCGAGTCAGCAGCGATT
CGCCATTCACCTGCCAGGATGTCGGTTTGCCACTCATTTTTGAGAAGGTGATCGCGAAGT
TGTAGCCGCGAACGGTGCAGCTCAAACGATCGTCTTCCAGCGTCAGCGGACGCGCATTAT
TTGGTGCGAAAGGCACTGGCTGCGCGGTGTTTTCCTTCAGCGGGAACTGATAAGTGGCGA
TAGGGTGTCCGGCTTCGCTGTAGCGGGTGCGGGAATCTTTGGTCACCGTAATGTTGAGGA
ACGCTTCGCGGGCGTCCAGCTGCGGCAGCGTGATCTGCAAGGGGGCTTCGCTGTTCGGCG
CAACGTCGCGCAGTTTAATCTGCTGCGTCGCGAGCGTTTCACCTTCGGCGCGCACCTCTG
CGTGCAGGGTGTAGTCATCAAGCGTGGTAAACCACAGTTTATTTTCGACTTTCAACTCGC
CGCGAGTCAGATCCCGCGCGTGGATTTTTACCGGCGCGATAACCTGTTTGTACTCTTTCA
GGCCCGGTCCCGGCGTCTGATCGGAATAGATCAAACCATCAAGACAGAAGTTATAGTTGT
TGGGATAGTCGCCGTAGTCGCCGCCGAATTTATACCAGACATTGCCGTGGTCGTCCTGTG
CCTGGATCCCGTGGTCGCACCACTCCCAGACATAATGACCCTGAATGCAATCGTGCTTAT
AGAAGACGTTCTGGTACTCCGTCAGCCCGCCCGGTCCGTTCCCCATCGCATGAGCATATT
CACAGATGATGCGCGGCTTCGGATGCGGGTATTCACCAAACTCATTCATCAGCGGCACGC
GGGTGTACATGGTGGAAATAATATCGACCACTTCAGCATCGCGATCTTCTTCGTAATGCA
CCAGTCGCGTGTCATCCAGCGCTTTCGCCGCATGGTACATCGCGCGGATGTTACAGCCAT
AGCCGGATTCATTGCCCAGCGACCAGATGATGATCGACGGATGGTTTTTCTGCGCGTGGA
TATGGCGAACAATGCGCTCGACGTAGACTTTTTCCCACTGCGGATCGTCGGTAATACGGC
TAATATCGCCGACATTAGCAAAGCCGTGCGATTCGACGTCGGTTTCCGCCATCACAAACA
GGCCGTAGATATCACACAGTTCGTAAAAACGCGGATCGTTCGGGTAGTGAGCGGTACGCA
CGGAGTTGATATTGTGCTGCTTCATCAACTGGAGATCTTTCTCGACGCGATCCATTCCAA
CGGCGCGGCCTTTGCGATGATCGTTGTCGTGACGGTTGACGCCGTGCAGCATCACATAAC
GGTTATTGATCCAGAACAGACCGTCGCGCACTTTGATATCACGGAAGCCAACGCGTTGTG
GCACCACTTCCAGAACGTTGCCGTTGGCGTCTTTCAGCGTCATGACCAGATGGTAAAGAT
AAGGGGATTCTGCTGACCATTGCTGCGGCTGTTCGACAGTAAAAGCAAAGCTGGCGCTGG
TCAGTTTTTCAATTGCCAAATGATCAATGGCGCTGCTGTGCACCACGCGTTCGCCATCAA
ACAGGGTATATTCCAGCGTCGTGACGACAGGGGAGGCGGCGAGATTTTCCAGCACCACTT
CGCAGGAAAGCGTGGCATCGCAATAGGCTTCGTCAAAGTCGGTACGCACAGTGAAATCGT
TAATATGCGTTAGGTGTTTTCCGACCAGATAAACATCGCGGAAGATCCCCGCTGACCACC
ACATATCCTGGTCTTCCACGTAGGTAGAGTCCGCCCACTGCATCACGCGCACACACAACA
GGTTGTCGCCGGTTTTAACCATCGCGCTGATGTCAAACTCTGCGGTCAGGCGACTGCCCT
TGCTGAAACCCACATACTGACCGTTAACATAGACTTCAAAATAGGTTTCGACGCCGTCAA
ATTTAATCAGCGTCTGTTTACCCTGCCAGCCGTCGCTGAGGGTGAAAATACGTTGATAGG
CACCGGTTGGGTTATCGCTGGGGACAAACGGCACATCGATGGGGAACGGAAAACCTTCGT
CGGTATATTGCAGTTTGCCGTGACCTTCCATTTGCCACATGGCGGGGACGGTAATATGCC
CCCAGTCAGCCATTAACTCAGAGGTGAAGGCTTCTGGTACTTGCAGCGGATGGTCAAAAA
AGTGGAAATTCCACTGACCGCTTAAGGGCAGAAACAGGCTGCTGGTTTCGCGGGCAAAGG
TACGCGCTTGCGCAACAGAATCATATGAAAAAAAGTACGCACGCGGCGCAAGTCGGTTTT
CGTGGGTGAGCTGAATGTTTTCCCAGCGATTCATAGGGCCTCCCGGTAGAGAGAAATCGG
AACCATTCATGGTGATGGTAGTTTGTGTAATTGCTGGGGAGTTTAGTAAAATTTTTACTA
AAAAGTAGCAGGTAAATGCATTTACTTTAACTGGATCACGAAAATAAACGGCAGCACTGT
CCGGCAAAAACGATTGCCGGACAGTGTGTAAGGGGATTTAACGGGTCGTGCCGCGCAGTT
TTAATTTGCTGGGAACGAAGACTAACAGCGGCAGCGCGCGACCATCGCGGGCTTTTTCAT
ACACCAGGTTAACGCCCTGACTTCCCATCATCTCGGAATGGATGCGCACGGTGGAGAGCG
GCGGAAAGGTAAATCGCGCGGTGGGGATATCGTTAACGCTGATAAGCGAAATATCCTGTG
GGATGTTCAGGCCTCGTTCATGAATTGCCCGCAGTACGCCGATAGCAATGGAATCGGAAG
CAACAAACAGTGCCTTCGGATAGTCTTCCCGCGCCAGCATTTGTTTTGCCAGTTCATAAC
CCGACGAACTGGAAAAACCGCCGCGCCAGATATCCTCTTCGCGTACCACTTGTTTCAGTC
GGCCATATTCCGCAAAGGCGACCTCACGAATATCCGCCTTGCCAGGCTCATCTTCACCGC
CAATAAAACCAATACGATTAACGCCCTGGTTGATATAGAAGTCGATGATTTCTTTACTGA
TGCGTGCCAGATCGATATCCACCGCATCGTAACCGCTGCCGGGTTCGTGAAAGTCGATAA
AACAGATATTGTCGGTCAACGCGCTGGCAGCGGCGCGCAGGGCGGGCGTGGGTTTGCCGA
CAATTAAAATACCGGTGACGTTTTTAATGTCTGGTAAGCCGCTGTGTTCATAACAGTTGG
TGAGCTCGATGCCCAGCTTTTCGCACTGGGTTTCAATGCCGTGGCGGATCGCCAGATAGT
AAGGATCGTTGATCTCCAGCTCCTGCTGGTAGCTGTAGATAGCCAGAATATGGTGTTGGT
TGACTGCACCTGTCTGGAGTTTACGGGCACTACTGGTCTTGTACTCCAGCTTTTCGGCGA
TCTCGAGAATGCGATGTTTCGTCTCTTCTTTCACATTCAATGTCGGATCGTCATTTAAGA
CCCTGGATACTGTCGCCAGGGATACGCCAGCTTCGATTGCGATGTCTTTTAGTGTTGCCA
TGTTTACCTTTTTTACTTTCCCTGATGTGCGCCCCCATTGTAGAGGAAGTGCTTATCGGG
TCACCTGTTTTCAGTAAATAAAGCGCGTTTCTTTGACGCTGTAACGGTAACACAGCGGCT
CACGAATGTGATCACGCCTGCATTCTCCATTTTTAGCCTACAGGATTGAGAAAAACTTTT
GCTATAGTTTAGTAAAATTTTACCCTAAGGGAGGAAGCAATGGAAACCGTGGCTTACGCT
GATTTTGCACGTCTGGAAATGCGCGTCGGAAAGATTGTGGAAGTGAAACGCCATGAAAAC
GCCGACAAGCTGTACATCGTACAGGTTGATGTGGGGCAAAAAACGCTGCAAACCGTGACC
AGCCTGGTGCCGTACTACAGCGAAGAAGAGCTGATGGGGAAAACGGTGGTGGTCTTATGC
AATCTGCAAAAAGCGAAAATGCGTGGTGAAACGTCGGAATGCATGCTGTTGTGTGCGGAA
ACCGATGACGGCAGTGAAAGCGTGCTGTTAACGCCGGAGCGGATGATGCCTGCGGGCGTA
CGCGTCGTATAAAAAGATCGGATGGCGACGTCGTATCGCCATCCGATTTGATATTACGCT
TCTTCGACACTTACTCGCATGGCCGCCAGCGCCTTACGCGCCGCTTTGATCACCAGTTCA
CACTGTTCAATGGTCAGTGTCAGTGGCGGTTCAATGCGGATCGTTTTGGCGTTATTGAGC
GTTCCGGCCACCAGTACGCGCTGGCGGAACATCTCGCTGGCAAAGTTATAGCCGATTTCG
TTATCAACAAACTCAATCGCCATCAACATCCCTTTACCACGCGCTTCCTGTACCAGATCG
GGATATTCCCGCGCCAGTTGACGGAAACCGTCCAGCAACATATCGCCTTTTTGCTCAGCC
TGAGCCGGTAAGTTCTGCTCCAGCAACACATTGATGGTCGCCAGCGCCGCCGCACAGGCC
AGCGGGTTGCCGCCAAAGGTGGTGGTATGCAGGAATGGGTTGTCGAACAGAACTGAAAAC
ACCTCTTCAGTGGCGATGGTCGCGCCAATCGGCATCACGCCGCCGCCGAGCGCTTTGGCA
AGGCAGAGGATATCCGGCTGTACGTTCTCATGCTCGCAGGCGAACATCTTGCCCGTGCGC
CCCATGCCCGTTTGTACTTCATCGAGGATCATCAGTGCGCCGAACTCATCGCATAGCTTA
CGTACGGCGGTGAGATAGCCCGGCGGCGGCAGAATTACGCCACCTTCACCCTGAATCGGT
TCGAGGATCACCGCAGCCACATCATCACCGGTTTTTTTGCACTCGTTAAGAGCCGTGCGC
ATGGCTTCGATATTGCCAAACGGCACATGACGGAAGCCCGGCAGTAACGGCATAAACGGT
TTGCGGAAGGTCGATTTCGCCGTGGCCGACAGCGCGCCAAGTGATTTACCGTGGAACGCG
CCGCTGGTGGCAATAAAAGTAAACTTGCCGCGCGGTGACTGGTAAGCTTTCGCCAGCTTC
AGCGCTGCTTCAACGGACTCGGTGCCGCTATTACAGAAGAAGCTGTATTTCAGTTTACCG
GGCGTTAGCGCAGCAAGGGTTTTCGCCAACATCGCCCGTAACGGATCGAGCAGCTCCTGG
CTGTGCAGCGGTTGTTTCGCAAGTTGATTCTGTACGGCGGAAACCACAACTGGATTACGG
TGCCCCACGTTGAAAATTCCAAAACCTCCCAGGCAGTCGATAAACTCCTGGCCCTGGGTG
TCGACAAGCGTATTTAAACTTCCCGCTTGCCACTCTACGGCTCCGTAATCCCCGCCGGCG
GTAACAGATTTGCGATACTCTAAAAACCCCGGATTGACATGCTCTTTGAAGTATTCAATC
ACCTCTCGGTTAAGTGCTTTCATCTCCTCATGATCCAGCGTTCGCTTCTCAATGAGATTC
AGGGCGTGGGCGCTGCACGCTAAAGCCGATGCGCTCGAAGGTAACCTGTTCAAAATATGC
TCCGGAGGCTCGCGTATCACATGATACCGATTTAAGTATTGCAGGGATTGCGCCACTCCG
GCTGCGATCGCGAAAATCGGGATAAACACAAATTCGGTTATCATTTGTGCAATATTTAAT
GCTATCTGTTAACATTTGTTGTTATTTTGCACGGTTTTTGTCGGGTATGGATTTGATGAT
TGCTGCGCAAATGCACGTTTTCAGGGCAATAATTGCCTGATTTTTGGGCAAGATAATTAA
CGTTTTCGTATAGTAACAGAGTGAAAGTATTTTAAATCAAGGAATTAGATTTGTGTTTAA
ATCGCAAATTGCGATCTAAATCAAATTAATCGGTTAAAGATAACCGCAGCGGGGCCGACA
TAAACTCTGACAAGAAGTTAACAACCATATAACCTGCACAGGACGCGAACATGTCTTCTC
ATCCGTATGTCACCCAGCAAAATACCCCGCTGGCGGACGATACCACTCTG