# path or URL to sample sheet (TSV format, columns: sample, condition, ...) samples: samples.tsv # path or URL to sequencing unit sheet (TSV format, columns: sample, unit, fq1, fq2, # strandedness). Units are technical replicates (e.g. lanes, or resequencing of the # same biological sample).If the column "strandedness" is present (which is optional), # can be empty or has one of these values: none, yes or reverse. none is for unstranded # protocols, yes an reverse follow the nomenclature used in `htseq-count --reverse` # which is referenced in STAR manual section 7, "Counting number of reads per gene". units: units.tsv trimming: # skip trimming: false or true skip: true # the sequencing adapter adapter: ACGGATCGATCGATCGATCGAT ref: # the STAR index index: "refs/hg38_STAR" # gtf file with transcripts annotation: "refs/hg38_STAR/hg38.gtf" pca: labels: # columns of sample sheet to use for PCA - condition diffexp: # contrasts for the deseq2 results method contrasts: infected-vs-mock: - infected - mock params: star: "" cutadapt-se: "" cutadapt-pe: "" diffgenes: "20" log-sig: "-30" log2-fold: "2"