https://github.com/dereneaton/ipyrad
Tip revision: a115f2aa11df4b3a35bd02545ca5cf33425402fc authored by eaton-lab on 27 June 2020, 02:13:23 UTC
"Updating ipyrad/__init__.py to version - 0.9.55
"Updating ipyrad/__init__.py to version - 0.9.55
Tip revision: a115f2a
tutorial_intro_cli.rst
.. include:: global.rst
.. _tutorial_intro_cli:
Introductory tutorial - CLI
============================
This is the full introductory tutorial for the command line interface (CLI)
to ipyrad. Here we will walk through an entire assembly process. The goal is
to become familiarized with the general workflow, terminology, data files, and
parameter settings in ipyrad. We will use a single-end RAD-seq data set
as an example, but the core concepts apply to other data types as well
(e.g., GBS and paired-end). Follow along by copy/pasting the
code-blocks into a command line terminal.
.. note::
If you haven't yet installed ipyrad go here first:
:ref:`Installation <installation>`
Getting the data
~~~~~~~~~~~~~~~~~
The example data set for this tutorial can be assembled in just a few minutes
on a typical laptop computer. Use the commands below to download and extract
the data. This will create a new directory called ``ipsimdata/`` located
in your current directory.
.. code-block:: bash
## The curl command needs a capital O, not a zero
>>> curl -LkO https://github.com/dereneaton/ipyrad/raw/master/tests/ipsimdata.tar.gz
>>> tar -xvzf ipsimdata.tar.gz
Use the command ``ls`` to look inside this directory. You'll see that
it contains many different files representing different test data sets.
.. code-block:: bash
## the command ls shows you the files inside a directory
>>> ls ipsimdata/
.. parsed-literal::
gbs_example_barcodes.txt pairgbs_example_barcodes.txt
gbs_example_genome.fa pairgbs_example_R1_.fastq.gz
gbs_example_R1_.fastq.gz pairgbs_example_R2_.fastq.gz
pairddrad_example_barcodes.txt pairgbs_wmerge_example_barcodes.txt
pairddrad_example_R1_.fastq.gz pairgbs_wmerge_example_genome.fa
pairddrad_example_R2_.fastq.gz pairgbs_wmerge_example_R1_.fastq.gz
pairddrad_wmerge_example_barcodes.txt pairgbs_wmerge_example_R2_.fastq.gz
pairddrad_wmerge_example_genome.fa rad_example_barcodes.txt
pairddrad_wmerge_example_R1_.fastq.gz rad_example_genome.fa
pairddrad_wmerge_example_R2_.fastq.gz rad_example_R1_.fastq.gz
For this introductory tutorial we will use just two files from
this directory. The file ``rad_example_R1_.fastq.gz`` contains Illumina
fastQ formatted reads and is gzip compressed. This is a typical format for raw
data. The other file, ``rad_example_barcodes.txt``, is a tab-separated table
matching barcodes to sample IDs.
Input files
~~~~~~~~~~~
.. note::
If you have **multiple plates** of data or if your data was already
demultiplexed when you received it, we still recommend you complete
the intro tutorial with the simulated data, but then see
(:ref:`tutorial combining data <tutorial_combining_data>`)
for specific instructions on how to read
in previously demultiplexed samples and how to merge multiple
plates of data.
Before we get started let's take a look at what the raw data looks like. Your
input data will be in fastQ format, usually ending in ``.fq``, ``.fastq``,
``.fq.gz``, or ``.fastq.gz``. It can be split among multiple files, or all
within a single file. In this tutorial the data are not yet demultiplexed
(sorted into separate files for each sample), and so we will start by demultiplexing
the data files. For this, we enter the location of our fastQ data files
on line 2 of the params file ('raw_fastq_path'). If the data were already
demultiplexed we would instead enter the location of the data files on line
4 of the params file ("sorted_fastq_path").
Below are the first three reads in the example file.
.. code-block:: bash
## For your personal edification here is what this is doing:
## gzip -c: Tells gzip to unzip the file and write the contents to the screen
## head -n 12: Grabs the first 12 lines of the fastq file.
>>> gunzip -c ./ipsimdata/rad_example_R1_.fastq.gz | head -n 12
And here's the output:
.. parsed-literal::
@lane1_locus0_2G_0_R1_0 1:N:0:
GAGGAGTGCAGCCCCTATGTGTCCGGCACCCCAACGCCTTGGAACTCAGTTAACTGTTCAAGTTGGGCAAGATCAAGTCGTCCCCTTAGCCCCCGCTCCG
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@lane1_locus0_2G_0_R1_1 1:N:0:
GAGGAGTGCAGCCCCTATGTGTCCGGCACCCCAACGCCTTGGAACTCAGTTAACTGTTCAAGTTGGGCAAGATCAAGTCGTCCCCTTAGCCCCCGCTCCG
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@lane1_locus0_2G_0_R1_2 1:N:0:
GAGGAGTGCAGCCCCTATGTGTCCGGCACCCCAACGCCTTGGAACTCAGTTAACTGTTCAAGTTGGGCAAGATCAAGTCGTCCCCTTAGCCCCCGCTCCG
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
Each read takes four lines. The first is the name of the read (its
location on the plate). The second line contains the sequence data.
The third line is a spacer. And the fourth line the quality scores
for the base calls. In this case arbitrarily high since the data
were simulated.
These are 100 bp single-end reads prepared as RAD-seq. The first
six bases form the barcode (TTTTAA) and the next five bases (TGCAG) the
restriction site overhang. All following bases make up the sequence
data.
Lets also take a look at the barcodes file for the simulated data. You'll
see sample names (left) and their barcodes (right) each on a
separate line with a tab between them.
.. code-block:: bash
>>> cat ./ipsimdata/rad_example_barcodes.txt
.. parsed-literal::
1A_0 CATCAT
1B_0 AGTGAT
1C_0 ATGGTA
1D_0 GTAGGA
2E_0 AAAGTG
2F_0 GATATA
2G_0 GAGGAG
2H_0 GGGATT
3I_0 TAATTA
3J_0 TGAGGG
3K_0 TGTAGT
3L_0 GTGTGT
Create an ipyrad params file
~~~~~~~~~~~~~~~~~~~~~~~~~~~~
ipyrad uses a simple text file to hold all the parameters for a given assembly.
Start by creating a new params file using the ``-n`` flag, followed
by a name for your assembly. In the example we use the name ``iptest``,
but the name can be anything at all. Once you start analysing your own data
you might call your params file something more informative, like the name
of your organism. We will refer to this as the "assembly_name".
.. code-block:: bash
>>> ipyrad -n iptest
.. parsed-literal::
New file params-iptest.txt created in /home/deren/Documents/ipyrad/tests
This will create a file in the current directory called ``params-iptest.txt``.
The params file lists on each line one parameter followed by a ## mark,
then the name of the parameter, and then a short description of its
purpose. Take a look at it by using the unix command 'cat' (or you can
use any text editor you like).
.. code-block:: bash
>>> cat params-iptest.txt
.. parsed-literal::
------- ipyrad params file (v.0.5.15)-------------------------------------------
iptest ## [0] [assembly_name]: Assembly name. Used to name output directories for assembly steps
./ ## [1] [project_dir]: Project dir (made in curdir if not present)
## [2] [raw_fastq_path]: Location of raw non-demultiplexed fastq files
## [3] [barcodes_path]: Location of barcodes file
## [4] [sorted_fastq_path]: Location of demultiplexed/sorted fastq files
denovo ## [5] [assembly_method]: Assembly method (denovo, reference, denovo+reference, denovo-reference)
## [6] [reference_sequence]: Location of reference sequence file
rad ## [7] [datatype]: Datatype (see docs): rad, gbs, ddrad, etc.
TGCAG, ## [8] [restriction_overhang]: Restriction overhang (cut1,) or (cut1, cut2)
5 ## [9] [max_low_qual_bases]: Max low quality base calls (Q<20) in a read
33 ## [10] [phred_Qscore_offset]: phred Q score offset (33 is default and very standard)
6 ## [11] [mindepth_statistical]: Min depth for statistical base calling
6 ## [12] [mindepth_majrule]: Min depth for majority-rule base calling
10000 ## [13] [maxdepth]: Max cluster depth within samples
0.85 ## [14] [clust_threshold]: Clustering threshold for de novo assembly
0 ## [15] [max_barcode_mismatch]: Max number of allowable mismatches in barcodes
0 ## [16] [filter_adapters]: Filter for adapters/primers (1 or 2=stricter)
35 ## [17] [filter_min_trim_len]: Min length of reads after adapter trim
2 ## [18] [max_alleles_consens]: Max alleles per site in consensus sequences
5, 5 ## [19] [max_Ns_consens]: Max N's (uncalled bases) in consensus (R1, R2)
8, 8 ## [20] [max_Hs_consens]: Max Hs (heterozygotes) in consensus (R1, R2)
4 ## [21] [min_samples_locus]: Min # samples per locus for output
20, 20 ## [22] [max_SNPs_locus]: Max # SNPs per locus (R1, R2)
8, 8 ## [23] [max_Indels_locus]: Max # of indels per locus (R1, R2)
0.5 ## [24] [max_shared_Hs_locus]: Max # heterozygous sites per locus (R1, R2)
0, 0 ## [25] [trim_reads]: Trim raw read edges (5'>, <3') applies same to pairs (see docs)
0, 0, 0, 0 ## [26] [trim_loci]: Trim locus edges (see docs) (R1>, <R1, R2>, <R2)
p, s, v ## [27] [output_formats]: Output formats (see docs)
## [28] [pop_assign_file]: Path to population assignment file
In general the default parameter values are sensible, and we won't
mess with them for now, but there are a few parameters we *must* change.
We need to set the path to the raw data we want to analyse, and we need
to set the path to the barcodes file.
In your favorite text editor (`nano` is a popular command line editor for linux,
for Mac you can use `TextEdit`) open ``params-iptest.txt`` and change these two
lines to look like this, and then save it. If you use a GUI editor be sure the file
saves as plain '.txt', no fancy business (e.g. .docx or .rtf). Also, be careful of
typos, if you enter the paths incorrectly ipyrad will raise an error and
tell you that it can't find your data files:
.. parsed-literal::
./ipsimdata/rad_example_R1_.fastq.gz ## [2] [raw_fastq_path]: Location of raw non-demultiplexed fastq files
./ipsimdata/rad_example_barcodes.txt ## [3] [barcodes_path]: Location of barcodes file
Step 1: Demultiplex the raw data files
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Now we will start assembling the data with ipyrad.
Step 1 reads in the barcodes file and the raw data. It scans through
the raw data and sorts each read based on the mapping of samples to
barcodes. At the end of this step we'll have a new directory in our project_dir
called ``iptest_fastqs/``. Inside this directory will be individual
fastq.gz files for each sample.
.. note::
**tldr; Please do not move or rename directories that ipyrad creates
or your assembly will break.**
You'll notice the name of this output directory bears a strong
resemblence to the name of the assembly we chose at the time
of the params file creation. Assembling rad-seq type sequence
data requires a lot of different steps, and these steps generate a
**lot** of intermediary files. ipyrad organizes these files into
directories, and it prepends the name of your assembly to each
directory with data that belongs to it. One result of this is that
you can have multiple assemblies of the same raw data with different
parameter settings and you don't have to manage all the files
yourself! (See :ref:`Branching assemblies <tutorial_advanced_CLI>` for more
info). Another result is that **you should not rename or move any
of the directories inside your project directory**, unless you know
what you're doing or you don't mind if your assembly breaks.
Now lets run step 1! For the simulated data this will take just a few seconds.
.. code-block:: bash
## -p indicates the params file we wish to use
## -s indicates the step to run (in this case 1)
>>> ipyrad -p params-iptest.txt -s 1
.. parsed-literal::
-------------------------------------------------------------
ipyrad [v.0.5.15]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
loading Assembly: iptest
from saved path: ~/Documents/ipyrad/tests/iptest.json
New Assembly: iptest
host compute node: [8 cores] on tinus
Step 1: Demultiplexing fastq data to Samples
[####################] 100% sorting reads | 0:00:04
[####################] 100% writing/compressing | 0:00:00
There are 4 main parts to this step: (1) It creates a new Assembly called iptest,
since this is our first time running any steps for the named assembly; (2) It
launches a number of parallel Engines, by default this is the number of available
CPUs on your machine; (3) It performs the step functions, in this case it sorts
the data and writes the outputs; and (4) It saves the Assembly.
Have a look at the results of this step in the ``iptest_fastqs/``
output directory:
.. code-block:: bash
>>> ls iptest_fastqs
.. parsed-literal::
1A_0_R1_.fastq.gz 1D_0_R1_.fastq.gz 2G_0_R1_.fastq.gz 3J_0_R1_.fastq.gz s1_demultiplex_stats.txt
1B_0_R1_.fastq.gz 2E_0_R1_.fastq.gz 2H_0_R1_.fastq.gz 3K_0_R1_.fastq.gz
1C_0_R1_.fastq.gz 2F_0_R1_.fastq.gz 3I_0_R1_.fastq.gz 3L_0_R1_.fastq.gz
A more informative metric of success might be the number of raw reads
demultiplexed for each sample. Fortunately ipyrad tracks the state of all your
steps in your current assembly, so at any time you can ask for results by
invoking the ``-r`` flag.
.. code-block:: bash
## -r fetches informative results from currently executed steps
>>> ipyrad -p params-iptest.txt -r
.. parsed-literal::
Summary stats of Assembly iptest
------------------------------------------------
state reads_raw
1A_0 1 19862
1B_0 1 20043
1C_0 1 20136
1D_0 1 19966
2E_0 1 20017
2F_0 1 19933
2G_0 1 20030
2H_0 1 20199
3I_0 1 19885
3J_0 1 19822
3K_0 1 19965
3L_0 1 20008
Full stats files
------------------------------------------------
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt
step 2: None
step 3: None
step 4: None
step 5: None
step 6: None
step 7: None
If you want to get even **more** info ipyrad tracks all kinds of
wacky stats and saves them to a file inside the directories it
creates for each step. For instance to see full stats for step 1:
.. code-block:: bash
>>> cat ./iptest_fastqs/s1_demultiplex_stats.txt
And you'll see a ton of fun stuff I won't copy here in the interest
of conserving space (you'll see more still on real empirical data versus
the simulated data here). Please go look for yourself if you're interested.
Step 2: Filter reads
~~~~~~~~~~~~~~~~~~~~
This step filters reads based on quality scores, and can be used to
detect Illumina adapters in your reads, which is a common concern with any
NGS data set, and especially so for homebrew type library preparations.
Here the filter is set to the default value of 0 (zero), meaning it filters
only based on quality scores of base calls, and does not search for adapters.
This is a good option if your data are already pre-filtered.
The resuling filtered files from step 2 are written to a new directory called
``iptest_edits/``.
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -s 2
.. parsed-literal::
-------------------------------------------------------------
ipyrad [v.0.5.15]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
loading Assembly: iptest
from saved path: ~/Documents/ipyrad/tests/iptest.json
host compute node: [8 cores] on tinus
Step 2: Filtering reads
[####################] 100% processing reads | 0:00:02
Again, you can look at the results output by this step and also some
handy stats tracked for this assembly.
.. code-block:: bash
## View the output of step 2
>>> ls iptest_edits/
.. parsed-literal::
1A_0_R1_.fastq 1C_0_R1_.fastq 2E_0_R1_.fastq 2G_0_R1_.fastq 3I_0_R1_.fastq 3K_0_R1_.fastq s2_rawedit_stats.txt
1B_0_R1_.fastq 1D_0_R1_.fastq 2F_0_R1_.fastq 2H_0_R1_.fastq 3J_0_R1_.fastq 3L_0_R1_.fastq
.. code-block:: bash
## Get current stats including # raw reads and # reads
## after filtering.
>>> ipyrad -p params-iptest.txt -r
.. parsed-literal::
Summary stats of Assembly iptest
------------------------------------------------
state reads_raw reads_passed_filter
1A_0 2 19862 19862
1B_0 2 20043 20043
1C_0 2 20136 20136
1D_0 2 19966 19966
2E_0 2 20017 20017
2F_0 2 19933 19933
2G_0 2 20030 20030
2H_0 2 20199 20199
3I_0 2 19885 19885
3J_0 2 19822 19822
3K_0 2 19965 19965
3L_0 2 20008 20008
Full stats files
------------------------------------------------
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt
step 2: ./iptest_edits/s2_rawedit_stats.txt
step 3: None
step 4: None
step 5: None
step 6: None
step 7: None
You might also take a gander at the filtered reads:
.. parsed-literal::
>>> head -n 12 ./iptest_edits/1A_0_R1_.fastq
Step 3: clustering within-samples
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
.. note::
A note on performance expectations. Steps 3 and 6 are the
"clustering" steps. These are by far the most intensive steps
and on real data you should expect them to take quite a bit
longer than the other steps. Here on the toy data it will take
a few minutes. See the :ref:`performance expectations <performance>`
docs for more specifics.
Step 3 de-replicates and then clusters reads within each sample
by the set clustering threshold and then writes the clusters to new
files in a directory called ``iptest_clust_0.85/``. Intuitively
we are trying to identify all the reads that map to the same locus
within each sample. The clustering threshold specifies the minimum
percentage of sequence similarity below which we will consider two
reads to have come from different loci.
The true name of this output directory will be dictated by the value
you set for the ``clust_threshold`` parameter in the params file.
.. parsed-literal::
0.85 ## [14] [clust_threshold]: proportion identical for clustering
You can see the default value is 0.85, so our default directory is
named accordingly. This value dictates the percentage of sequence
similarity that reads must have in order to be considered reads
at the same locus. You may want to experiment
with this value, but 0.85-0.90 is a fairly reliable range, balancing
over-splitting of loci vs over-lumping. Don't mess with this
until you feel comfortable with the overall workflow, and also
until you've learned about :ref:`Branching assemblies <branching_workflow>`.
Later you will learn how to incorporate information from a reference
genome (if you have one) to improve clustering at this step. For now, bide your
time (but see :ref:`Reference sequence mapping <tutorial_advanced_cli>` if
you're impatient).
Now lets run step 3:
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -s 3
.. parsed-literal::
-------------------------------------------------------------
ipyrad [v.0.5.15]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
loading Assembly: iptest
from saved path: ~/Documents/ipyrad/tests/iptest.json
host compute node: [8 cores] on tinus
Step 3: Clustering/Mapping reads
[####################] 100% dereplicating | 0:00:00
[####################] 100% clustering | 0:00:00
[####################] 100% building clusters | 0:00:00
[####################] 100% chunking | 0:00:00
[####################] 100% aligning | 0:00:03
[####################] 100% concatenating | 0:00:00
Again we can examine the results. The stats output tells you how many clusters
were found, and the number of clusters that pass the mindepth thresholds.
We'll go into more detail about mindepth settings in some of the advanced tutorials
but the important thing to know is that by default step 3 will filter out clusters
that only have a handful of reads since we have little power to make confident
base calls in low depth clusters.
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -r
.. parsed-literal::
Summary stats of Assembly iptest
------------------------------------------------
state reads_raw reads_passed_filter clusters_total clusters_hidepth
1A_0 3 19862 19862 1000 1000
1B_0 3 20043 20043 1000 1000
1C_0 3 20136 20136 1000 1000
1D_0 3 19966 19966 1000 1000
2E_0 3 20017 20017 1000 1000
2F_0 3 19933 19933 1000 1000
2G_0 3 20030 20030 1000 1000
2H_0 3 20199 20199 1000 1000
3I_0 3 19885 19885 1000 1000
3J_0 3 19822 19822 1000 1000
3K_0 3 19965 19965 1000 1000
3L_0 3 20008 20008 1000 1000
Full stats files
------------------------------------------------
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt
step 2: ./iptest_edits/s2_rawedit_stats.txt
step 3: ./iptest_clust_0.85/s3_cluster_stats.txt
step 4: None
step 5: None
step 6: None
step 7: None
The aligned clusters found during this step are now located in
``./iptest_clust_0.85/``. You can get a feel for what this looks like
by examining a portion of one of the files using the command below.
.. code-block:: bash
## Same as above, gunzip -c means print to the screen and
## `head -n 28` means just show me the first 28 lines. If
## you're interested in what more of the loci look like
## you can increase the number of lines you ask head for,
## e.g. ... | head -n 100
>>> gunzip -c iptest_clust_0.85/1A_0.clustS.gz | head -n 28
Reads that are sufficiently similar (based on the above sequence similarity
threshold) are grouped together in clusters separated by "//". For the first
cluster below there is clearly one allele (homozygote) and one read with a
(simulated) sequencing error. This is apparent in the 'size=' field of the two
reads for this cluster. For the second cluster it seems there are two alleles
(heterozygote), and a read with a sequencing error. For the third
cluster it's a bit harder to say. Is this a homozygote with lots of sequencing
errors, or a heterozygote with few reads for one of the alleles? Thankfully,
untangling this mess is what steps 4 and 5 are all about.
.. parsed-literal::
>1A_0_1164_r1;size=16;*0
TGCAGCTATTGCGACAAAAACACGACGGCTTCCGTGGGCACTAGCGTAATTCGCTGAGCCGGCGTAACAGAAGGAGTGCACTGCCACGTGCCCG
>1A_0_1174_r1;size=1;+1
TGCAGCTATTGCGACAAAAACACGACGGCTTCCGTGGGCACTAGCGTAATTCGCTGAGCCGGCGTAACAGAAGGAGTGCACTGCCACATGCCCG
//
//
>1A_0_4137_r1;size=10;*0
TGCAGGGTCGCCGGCAACTCAGCATTTTAACTCCGCGGGTTACACGTGCGGAGGCCTACTGGCTATCATTTTTAGGGTGCATTTGGTCGGCTGG
>1A_0_4130_r1;size=6;+1
TGCAGGGTCGCCGGCAACTCAGCATTTTAACTCCGCGGGTTACACGTGTGGAGGCCTACTGGCTATCATTTTTAGGGTGCATTTGGTCGGCTGG
>1A_0_4131_r1;size=1;+2
TGCAGGGTCGCCGGCAACTCAGCATTTTAACTCCGCGGGTTACACGTGTCGAGGCCTACTGGCTATCATTTTTAGGGTGCATTTGGTCGGCTGG
//
//
>1A_0_6246_r1;size=15;*0
TGCAGATACAAAAGCTTGCCCACTAAGTTGTGTGATCACTGTCTTATTACGGTGGCCTCCTTCAAGCTTCGAACGAGTTGTGGATCGGTAGGCT
>1A_0_6259_r1;size=1;+1
TGCAGATACAAAAGCTTGCCCACTAAGTTGTGTGATCACTGTCTTATTACGGTGGCCTCCTTCAAGCTTCGAACGAGTTGTGGATCGGGAGGCT
>1A_0_6264_r1;size=1;+2
TGCAGATACAAAAGCTTGCCCACTAAGTTGTGTGATCACTGTCTTATTACGGTGGCCTCCTACAAGCTTCGAACGAGTTGTGGATCGGTAGGCT
>1A_0_6268_r1;size=1;+3
TGCAGATTCAAAAGCTTGCCCACTAAGTTGTGTGATCACTGTCTTATTACGGTGGCCTCCTTCAAGCTTCGAACGAGTTGTGGATCGGTAGGCT
//
//
Step 4: Joint estimation of heterozygosity and error rate
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Step 4 jointly estimates sequencing error rate and heterozygosity to disentangle
which reads are "real" and which are sequencing error. We need to know
which reads are "real" because in diploid organisms there are a maximum of 2
alleles at any given locus. If we look at the raw data and there are 5 or
ten different "alleles", and 2 of them are very high frequency, and the rest
are singletons then this gives us evidence that the 2 high frequency alleles
are good reads and the rest are probably not. This step is pretty
straightforward, and pretty fast. Run it thusly:
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -s 4
.. parsed-literal::
-------------------------------------------------------------
ipyrad [v.0.5.15]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
loading Assembly: iptest
from saved path: ~/Documents/ipyrad/tests/iptest.json
host compute node: [8 cores] on tinus
Step 4: Joint estimation of error rate and heterozygosity
[####################] 100% inferring [H, E] | 0:00:02
This step does not produce new output files, only a stats file with the
estimated heterozygosity and error rate parameters.
You can also invoke the ``-r`` flag to see the estimated values.
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -r
.. parsed-literal::
Summary stats of Assembly iptest
------------------------------------------------
state reads_raw reads_passed_filter clusters_total clusters_hidepth
1A_0 4 19862 19862 1000 1000
1B_0 4 20043 20043 1000 1000
1C_0 4 20136 20136 1000 1000
1D_0 4 19966 19966 1000 1000
2E_0 4 20017 20017 1000 1000
2F_0 4 19933 19933 1000 1000
2G_0 4 20030 20030 1000 1000
2H_0 4 20199 20199 1000 1000
3I_0 4 19885 19885 1000 1000
3J_0 4 19822 19822 1000 1000
3K_0 4 19965 19965 1000 1000
3L_0 4 20008 20008 1000 1000
hetero_est error_est
1A_0 0.001824 0.000759
1B_0 0.001908 0.000752
1C_0 0.002084 0.000745
1D_0 0.001803 0.000761
2E_0 0.001830 0.000766
2F_0 0.001996 0.000755
2G_0 0.001940 0.000763
2H_0 0.001747 0.000756
3I_0 0.001807 0.000758
3J_0 0.001931 0.000776
3K_0 0.002092 0.000766
3L_0 0.002042 0.000748
Full stats files
------------------------------------------------
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt
step 2: ./iptest_edits/s2_rawedit_stats.txt
step 3: ./iptest_clust_0.85/s3_cluster_stats.txt
step 4: ./iptest_clust_0.85/s4_joint_estimate.txt
step 5: None
step 6: None
step 7: None
Step 5: Consensus base calls
~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Step 5 uses the inferred error rate and heterozygosity to call the consensus
of sequences within each cluster. Here we are identifying what we believe
to be the real haplotypes at each locus within each sample.
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -s 5
.. parsed-literal::
-------------------------------------------------------------
ipyrad [v.0.5.15]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
loading Assembly: iptest
from saved path: ~/Documents/ipyrad/tests/iptest.json
host compute node: [8 cores] on tinus
Step 5: Consensus base calling
Mean error [0.00076 sd=0.00001]
Mean hetero [0.00192 sd=0.00012]
[####################] 100% calculating depths | 0:00:01
[####################] 100% chunking clusters | 0:00:00
[####################] 100% consens calling | 0:00:10
Again we can ask for the results:
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -r
And here the important information is the number of ``reads_consens``. This is
the number of "good" reads within each sample that we'll send on to the next step.
As you'll see in examples with empirical data, this is often a step where many
reads are filtered out of the data set. If no reads were filtered, then the
number of reads_consens should be equal to the number of clusters_hidepth.
.. parsed-literal::
Summary stats of Assembly iptest
------------------------------------------------
state reads_raw reads_passed_filter clusters_total clusters_hidepth
1A_0 5 19862 19862 1000 1000
1B_0 5 20043 20043 1000 1000
1C_0 5 20136 20136 1000 1000
1D_0 5 19966 19966 1000 1000
2E_0 5 20017 20017 1000 1000
2F_0 5 19933 19933 1000 1000
2G_0 5 20030 20030 1000 1000
2H_0 5 20199 20199 1000 1000
3I_0 5 19885 19885 1000 1000
3J_0 5 19822 19822 1000 1000
3K_0 5 19965 19965 1000 1000
3L_0 5 20008 20008 1000 1000
hetero_est error_est reads_consens
1A_0 0.001824 0.000759 1000
1B_0 0.001908 0.000752 1000
1C_0 0.002084 0.000745 1000
1D_0 0.001803 0.000761 1000
2E_0 0.001830 0.000766 1000
2F_0 0.001996 0.000755 1000
2G_0 0.001940 0.000763 1000
2H_0 0.001747 0.000756 1000
3I_0 0.001807 0.000758 1000
3J_0 0.001931 0.000776 1000
3K_0 0.002092 0.000766 1000
3L_0 0.002042 0.000748 1000
Full stats files
------------------------------------------------
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt
step 2: ./iptest_edits/s2_rawedit_stats.txt
step 3: ./iptest_clust_0.85/s3_cluster_stats.txt
step 4: ./iptest_clust_0.85/s4_joint_estimate.txt
step 5: ./iptest_consens/s5_consens_stats.txt
step 6: None
step 7: None
This step creates a new directory called ``./iptest_consens`` to store
the consensus sequences for each sample. We can use our trusty ``head``
command to look at the output.
.. code-block:: bash
>>> gunzip -c iptest_consens/1A_0.consens.gz | head
You can see that all loci within each sample have been reduced to one
consensus sequence. Heterozygous sites are represented by IUPAC
ambiguity codes (find the **K** in sequence ``1A_0_1``), and all other
sites are homozygous.
.. parsed-literal::
>1A_0_0
TGCAGTATTGGCTGCCCCATCTTACGCTTGGTAATTTTCGCCTTTTCAACTGCATCCGCTAAATCTGCCATCTTTAAGCGTAGTCACTTCCACA
>1A_0_1
TGCAGCGKTACGCTCCTAGGGAACGTCCACGTCTCGGCAGTCGTCAGGTACTTTTAGCCTCTTGCCGCGCATCTCATGGGAGCAACGTGAGCCT
>1A_0_2
TGCAGACGGGAAACTTTAAAAAATAAAGCAATTGCTGCCATCTATGGGCGGTTTGAATGGGTTTTTTAGTGCCTCTACTATTAATTATGTGATC
>1A_0_3
TGCAGAGAGTGAACATCAGAAGACAGGTGGGTAGAAGACGCAACTTAGGACCTAAGGTTCTGGAGCTATTTTAAGTTCGACAGACAGGTCCAGC
>1A_0_4
TGCAGCGTGCTAAGGTTTGAGACATATAGCGAAGAACCTACGACGGTCGAATCTGACGGCGCTAAGCTGTGTGGACCTTAGTATTAGGCGGAAA
Step 6: Cluster across samples
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Step 6 clusters consensus sequences across samples. Now that we have good
estimates for haplotypes within samples we can try to identify similar sequences
at each locus between samples. We use the same clustering threshold as step 3
to identify sequences between samples that are probably sampled from the
same locus, based on sequence similarity.
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -s 6
.. parsed-literal::
-------------------------------------------------------------
ipyrad [v.0.5.15]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
loading Assembly: iptest
from saved path: ~/Documents/ipyrad/tests/iptest.json
host compute node: [8 cores] on tinus
Step 6: Clustering at 0.85 similarity across 12 samples
[####################] 100% concat/shuffle input | 0:00:00
[####################] 100% clustering across | 0:00:00
[####################] 100% building clusters | 0:00:01
[####################] 100% aligning clusters | 0:00:03
[####################] 100% database indels | 0:00:00
[####################] 100% indexing clusters | 0:00:01
[####################] 100% building database | 0:00:00
This step differs from previous steps in that we are no longer applying a
function to each Sample individually, but instead we apply it to all
Samples collectively. Our end result is a map telling us which loci cluster
together from which Samples. This output is stored as an HDF5 database
(``iptest_test.hdf5``), which is not easily human readable. It contains
the clustered sequence data, depth information, phased alleles, and
other metadata. If you really want to see the contents of the database
see the h5py_ cookbook recipe.
There is no simple way to summarize the outcome of step 6, so the output
of ``ipyrad -p params-iptest -r`` and the content of the
``./iptest_consens/s6_cluster_stats.txt`` stats file are uniquely uninteresting.
Step 7: Filter and write output files
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
The final step is to filter the data and write output files in many
convenient file formats. First we apply filters for maximum number of
indels per locus, max heterozygosity per locus, max number of snps
per locus, and minimum number of samples per locus. All these filters
are configurable in the params file and you are encouraged to explore
different settings, but the defaults are quite good and quite conservative.
After running step 7 like so:
.. code-block:: bash
>>> ipyrad -p params-iptest.txt -s 7
.. parsed-literal::
-------------------------------------------------------------
ipyrad [v.0.5.15]
Interactive assembly and analysis of RAD-seq data
-------------------------------------------------------------
loading Assembly: iptest
from saved path: ~/Documents/ipyrad/tests/iptest.json
host compute node: [8 cores] on tinus
Step 7: Filter and write output files for 12 Samples
[####################] 100% filtering loci | 0:00:05
[####################] 100% building loci/stats | 0:00:00
[####################] 100% building vcf file | 0:00:01
[####################] 100% writing vcf file | 0:00:00
[####################] 100% building arrays | 0:00:01
[####################] 100% writing outfiles | 0:00:02
Outfiles written to: ~/Documents/ipyrad/tests/iptest_outfiles
A new directory is created called ``iptest_outfiles``. This directory contains
all the output files specified in the params file. The default is to
create all supported output files which include PHYLIP(.phy), NEXUS(.nex),
EIGENSTRAT's genotype format(.geno), STRUCTURE(.str), as well
as many others. Explore some of these files below.
Final stats file
~~~~~~~~~~~~~~~~
The final stats output file contains a large number of statistics telling you
why some loci were filtered from the data set, how many loci were recovered
per sample, how many loci were shared among some number of samples, and how
much variation is present in the data. Check out the results file.
.. code-block:: bash
## The `less` command lets you easily view large files
## in the terminal. The stats output is quite long, so if
## you used `cat` here instead of less the results would
## fly off the page. Try it if you don't believe me!
##
## ProTip: To quit out of less push the `q` key.
>>> less iptest_outfiles/iptest_stats.txt
.. parsed-literal::
## The number of loci caught by each filter.
## ipyrad API location: [assembly].statsfiles.s7_filters
total_filters applied_order retained_loci
total_prefiltered_loci 1000 0 1000
filtered_by_rm_duplicates 0 0 1000
filtered_by_max_indels 0 0 1000
filtered_by_max_snps 0 0 1000
filtered_by_max_shared_het 0 0 1000
filtered_by_min_sample 0 0 1000
filtered_by_max_alleles 0 0 1000
total_filtered_loci 1000 0 1000
## The number of loci recovered for each Sample.
## ipyrad API location: [assembly].stats_dfs.s7_samples
sample_coverage
1A_0 1000
1B_0 1000
1C_0 1000
1D_0 1000
2E_0 1000
2F_0 1000
2G_0 1000
2H_0 1000
3I_0 1000
3J_0 1000
3K_0 1000
3L_0 1000
## The number of loci for which N taxa have data.
## ipyrad API location: [assembly].stats_dfs.s7_loci
locus_coverage sum_coverage
1 0 0
2 0 0
3 0 0
4 0 0
5 0 0
6 0 0
7 0 0
8 0 0
9 0 0
10 0 0
11 0 0
12 1000 1000
## The distribution of SNPs (var and pis) across loci.
## var = all variable sites (pis + autapomorphies)
## pis = parsimony informative site (minor allele in >1 sample)
## ipyrad API location: [assembly].stats_dfs.s7_snps
var sum_var pis sum_pis
0 16 0 331 0
1 55 55 376 376
2 106 267 208 792
3 208 891 52 948
4 198 1683 26 1052
5 145 2408 4 1072
6 124 3152 3 1090
7 69 3635 0 1090
8 50 4035 0 1090
9 12 4143 0 1090
10 10 4243 0 1090
11 3 4276 0 1090
12 3 4312 0 1090
13 1 4325 0 1090
Check out the ``.loci`` output (this is ipyrad native internal format).
Each locus is delineated by a pair of forward slashes ``//``. Within each
locus are all the reads from each sample that clustered together. The line
containing the ``//`` also indicates the positions of SNPs in the sequence.
See if you can spot the SNPs in the first locus. Many more output formats
are available. See the section on :ref:`output formats<full_output_formats>`
for more information.
.. code-block:: bash
>>> less iptest_outfiles/iptest.loci
.. parsed-literal::
1A_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
1B_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
1C_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATACCCGGTAGACATC
1D_0 GGTGGGCAGTAGTCTCKCGGATGATCTAGAAACTTCATACGTTGTATAAGTGKAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
2E_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
2F_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
2G_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
2H_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTCTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
3I_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGRGGATACCCTGGGCATCCCCGGTAGACATC
3J_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
3K_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGRATACCCTGGGCATCCCCGGTAGACATC
3L_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC
// - - - - - - |0|
1A_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA
1B_0 CAATTTAAACATGGCCTGTTTTGGGCC-CTTAAACAGCCATCA-TACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGT-GA
1C_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCAAAATAAGAGTCGA
1D_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAACCAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA
2E_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGGTGCGGAGCCACGGAGACTGCAAGTCACAATAAGACTCGA
2F_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGARCCACGGAGACTGCAAGTCACAATAAGACTCGA
2G_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA
2H_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA
3I_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA
3J_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA
3K_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA
3L_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA
// - - - - * |1|
Congratulations! You've completed your first toy assembly. Now you can try
applying what you've learned to assemble your own real data. Please consult
the docs for many of the more powerful features of ipyrad including reference
sequence mapping, assembly branching, and post-processing analysis.