| 3efc331 | Heng Li | 19 May 2014, 20:47:25 UTC | 0.7.9a-r786: fixed a segfault in a rare case More likely to happen given a circular genome | 19 May 2014, 20:47:25 UTC |
| 031d3d8 | Heng Li | 19 May 2014, 13:49:26 UTC | Wrong release number: 0.7.8 => 0.7.9 | 19 May 2014, 13:49:26 UTC |
| be74dbc | Heng Li | 19 May 2014, 13:09:11 UTC | Release bwa-0.7.9-r783 | 19 May 2014, 13:09:11 UTC |
| e4752b3 | Heng Li | 19 May 2014, 13:08:07 UTC | Release bwa-0.7.9-r782 | 19 May 2014, 13:08:07 UTC |
| f00cc94 | Heng Li | 16 May 2014, 04:06:34 UTC | r779: fixed a memory leak in SE | 16 May 2014, 04:06:34 UTC |
| a5ad0cf | Heng Li | 16 May 2014, 03:23:04 UTC | r778: reduced the number of alloc() calls a bit | 16 May 2014, 03:23:04 UTC |
| 012d54f | Heng Li | 15 May 2014, 15:48:28 UTC | Updated release notes | 15 May 2014, 15:48:28 UTC |
| 8d2986e | Heng Li | 14 May 2014, 18:44:03 UTC | r770: fixed a compiling warning | 14 May 2014, 18:44:03 UTC |
| 8f3e7d5 | Heng Li | 14 May 2014, 18:36:52 UTC | fixed wrong FAQ links | 14 May 2014, 18:36:52 UTC |
| d67e923 | Heng Li | 14 May 2014, 18:33:42 UTC | changed the heading format | 14 May 2014, 18:33:42 UTC |
| 1627f9d | Heng Li | 14 May 2014, 18:32:09 UTC | updated README | 14 May 2014, 18:32:09 UTC |
| 061c63f | Heng Li | 13 May 2014, 17:09:29 UTC | r766: removed useless code | 13 May 2014, 17:09:29 UTC |
| 0168f39 | Heng Li | 13 May 2014, 16:54:23 UTC | r765: fixed a declaration error Reported by Andreas Tile from Debian | 13 May 2014, 16:54:23 UTC |
| 08517ac | Heng Li | 13 May 2014, 16:53:24 UTC | r764: changed -c in "-x pacbio" to 500 | 13 May 2014, 16:53:24 UTC |
| a35a6c2 | Heng Li | 12 May 2014, 16:52:16 UTC | updated maual page | 12 May 2014, 16:52:16 UTC |
| 39a6cd5 | Heng Li | 11 May 2014, 19:15:44 UTC | r762: cleanup for the new release; unfinished It will take to make the documentation ready. | 11 May 2014, 19:15:44 UTC |
| cfe6996 | Heng Li | 09 May 2014, 18:59:07 UTC | r760: removed commented code It is slow and is not very effective. And I hate useless code. | 09 May 2014, 18:59:07 UTC |
| 43b498a | Heng Li | 09 May 2014, 18:56:59 UTC | r759: bugfix - frac_rep not working Also added commented code for a 3rd round seeding. Not used. | 09 May 2014, 18:56:59 UTC |
| c9b3350 | Heng Li | 07 May 2014, 19:07:29 UTC | r758: fixed a typo mostly negligible in practice | 07 May 2014, 19:07:29 UTC |
| e56572e | Heng Li | 06 May 2014, 21:11:17 UTC | help on how to use bwa-helper.js | 06 May 2014, 21:11:17 UTC |
| 1ced2f3 | Heng Li | 06 May 2014, 20:35:40 UTC | more debugging info at -v5 | 06 May 2014, 20:35:40 UTC |
| 4b95159 | Heng Li | 06 May 2014, 20:29:20 UTC | download link of data used by genalt | 06 May 2014, 20:29:20 UTC |
| 6ac8dd5 | Heng Li | 06 May 2014, 20:15:14 UTC | r754: added command msg for -h | 06 May 2014, 20:15:14 UTC |
| 81970e7 | Heng Li | 06 May 2014, 20:12:22 UTC | more comments | 06 May 2014, 20:12:22 UTC |
| c50ee8c | Heng Li | 06 May 2014, 20:02:40 UTC | genalt is working | 06 May 2014, 20:02:40 UTC |
| 8d37726 | Heng Li | 06 May 2014, 15:57:02 UTC | code backup | 06 May 2014, 15:57:02 UTC |
| 024195d | Heng Li | 05 May 2014, 20:51:14 UTC | code backup | 05 May 2014, 20:51:14 UTC |
| ce3c198 | Heng Li | 04 May 2014, 14:17:03 UTC | r749: max_hits tunable on CMD; default to 5 | 04 May 2014, 14:17:03 UTC |
| f21d649 | Heng Li | 02 May 2014, 20:49:19 UTC | r748: reduced the default -m to 50 | 02 May 2014, 20:49:19 UTC |
| e8f28cb | Heng Li | 02 May 2014, 20:17:50 UTC | r747: fixed a minor issue in the last (mis)commit | 02 May 2014, 20:17:50 UTC |
| 6db761e | Heng Li | 02 May 2014, 20:06:27 UTC | r746: tuned heuristic for GRCh38 Reduced -c to 500 by default. As a compensation, we choose up to 1000 positions if a seed has 500 or more occurrences. In addition, a read with big portion from such seeds will have lower mapping quality. | 02 May 2014, 20:06:27 UTC |
| 8763e0c | Heng Li | 02 May 2014, 14:43:49 UTC | Helpful scripts | 02 May 2014, 14:43:49 UTC |
| b707684 | Heng Li | 01 May 2014, 19:30:36 UTC | r744: int overflow given MB query | 01 May 2014, 19:30:36 UTC |
| fa20c71 | Heng Li | 01 May 2014, 18:27:38 UTC | r742: further control the max bandwidth I am looking at 6kb bandwidth... | 01 May 2014, 18:27:38 UTC |
| 7954e77 | Heng Li | 01 May 2014, 15:13:05 UTC | r741: fixed segfault in rare cases | 01 May 2014, 15:13:05 UTC |
| 4b24410 | Heng Li | 01 May 2014, 15:01:52 UTC | r740: don't attempt merge if bandwidth too large Sometimes the bandwidth can be >10k. | 01 May 2014, 15:01:52 UTC |
| 5aedc97 | Heng Li | 01 May 2014, 03:23:54 UTC | r739: output suboptimal hits in the PE mode However, PE information is not used for suboptimal hits | 01 May 2014, 03:23:54 UTC |
| c6c943f | Heng Li | 30 April 2014, 20:46:05 UTC | r738: output multi-map in the XA tag (SE only) ... PE support coming soon | 30 April 2014, 20:46:05 UTC |
| d59d788 | Heng Li | 30 April 2014, 18:55:44 UTC | r737: fixed an assertion when failed to convert sa A bug pointed out by Mikkle Schubert | 30 April 2014, 18:55:44 UTC |
| 88f89be | Heng Li | 30 April 2014, 18:14:20 UTC | r736: improved in low-complexity regions Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG This read has 5 chains, two of which are: weight=80 26;26;0,4591439948(10:-3095894) 23;23;27,4591439957(10:-3095888) 31;31;70,4591439964(10:-3095873) weight=50 45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801) 31;31;70,4591440090(10:-3095747) Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment [0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit adds a heuristic to fix this issue. | 30 April 2014, 18:14:20 UTC |
| 11698fc | Heng Li | 30 April 2014, 17:12:43 UTC | r735: fixed a bug caused by merge | 30 April 2014, 17:12:43 UTC |
| b603fed | Heng Li | 29 April 2014, 18:58:53 UTC | r733: bugfix - seed score unset when no -W | 29 April 2014, 18:58:53 UTC |
| 44754cd | Heng Li | 28 April 2014, 14:39:29 UTC | r731: separate layouter | 28 April 2014, 14:39:29 UTC |
| dadd5d6 | Heng Li | 28 April 2014, 14:01:54 UTC | r730: more permissive about merging overlapping | 28 April 2014, 14:01:54 UTC |
| 76bb49e | Heng Li | 24 April 2014, 20:06:01 UTC | r729: halved band width; doubled patch band width | 24 April 2014, 20:06:01 UTC |
| 6052d30 | Heng Li | 24 April 2014, 19:44:59 UTC | r728: sorting the end in mem_sort_dedup_patch() The older version does this, which is correct. | 24 April 2014, 19:44:59 UTC |
| df65893 | Heng Li | 24 April 2014, 18:28:40 UTC | r727: extend seeds with SW | 24 April 2014, 18:28:40 UTC |
| b92bbb4 | Heng Li | 24 April 2014, 16:24:49 UTC | Merge branch '0.7.7-softclip' into layout Conflicts: Makefile bwamem.h fastmap.c main.c | 24 April 2014, 16:24:49 UTC |
| 8c12ec4 | Heng Li | 24 April 2014, 15:56:43 UTC | r725: optionally disable hard clipping as is reqested by the cancer group | 24 April 2014, 15:56:43 UTC |
| 954cfd7 | Heng Li | 23 April 2014, 19:14:52 UTC | improved ksw_extend2() 1. the first cell in a row is not always right 2. prevent from H->H extension from H=0 cells 3. replaced the band narrowing heuristic with always correct one | 23 April 2014, 19:14:52 UTC |
| b93fca2 | Heng Li | 16 April 2014, 20:38:50 UTC | r723: merge adjacent hits | 16 April 2014, 20:38:50 UTC |
| 48847af | Heng Li | 16 April 2014, 16:00:13 UTC | code backup | 16 April 2014, 16:00:13 UTC |
| 00a07f6 | Heng Li | 15 April 2014, 20:16:04 UTC | r721: merge overlapping hits by default | 15 April 2014, 20:16:04 UTC |
| 45f24b4 | Heng Li | 15 April 2014, 20:09:42 UTC | r720: improved overlap hit merging | 15 April 2014, 20:09:42 UTC |
| bdb7b00 | Heng Li | 15 April 2014, 18:52:17 UTC | r719: more stringent overlap merge Will consider to make it the default | 15 April 2014, 18:52:17 UTC |
| 4e22270 | Heng Li | 14 April 2014, 21:01:17 UTC | r718: merge alnregs overlapping on both query/ref | 14 April 2014, 21:01:17 UTC |
| a38b065 | Heng Li | 14 April 2014, 20:05:08 UTC | Merge branch 'master' into layout Conflicts: main.c | 14 April 2014, 20:05:08 UTC |
| 6d4a6de | Heng Li | 14 April 2014, 20:04:29 UTC | r716: changed -x pbread | 14 April 2014, 20:04:29 UTC |
| 1209f16 | Heng Li | 14 April 2014, 16:24:45 UTC | code backup | 14 April 2014, 16:24:45 UTC |
| 836d464 | Heng Li | 14 April 2014, 13:55:55 UTC | r713: a bug in retrieving ref seq on rev | 14 April 2014, 13:55:55 UTC |
| d5877ad | Heng Li | 14 April 2014, 13:33:45 UTC | code backup | 14 April 2014, 13:33:45 UTC |
| f2b7d67 | Heng Li | 13 April 2014, 16:51:44 UTC | output extra debugging information | 13 April 2014, 16:51:44 UTC |
| c964557 | Heng Li | 13 April 2014, 16:49:10 UTC | code backup | 13 April 2014, 16:49:10 UTC |
| 685cd23 | Heng Li | 11 April 2014, 15:24:08 UTC | better readability for the neighbor struct | 11 April 2014, 15:24:08 UTC |
| 42e2a7a | Heng Li | 11 April 2014, 15:14:06 UTC | fixed a bug in overlap type inferrence | 11 April 2014, 15:14:06 UTC |
| bbcabfe | Heng Li | 11 April 2014, 01:53:52 UTC | r707: change params for pacbio-to-pacbio | 11 April 2014, 01:53:52 UTC |
| 658f27e | Heng Li | 11 April 2014, 01:48:47 UTC | Merge branch 'dev' into layout Conflicts: main.c | 11 April 2014, 01:48:47 UTC |
| 6fda935 | Heng Li | 11 April 2014, 01:38:14 UTC | r705: pairing performed on one chr only Change of versioning: the revision number is acquired with: git rev-list --all --count This counts the total number of commits across all branches. | 11 April 2014, 01:38:14 UTC |
| db4b171 | Heng Li | 11 April 2014, 01:09:47 UTC | Merge branch 'dev' into layout Conflicts: main.c | 11 April 2014, 01:09:47 UTC |
| 07182d9 | Heng Li | 11 April 2014, 01:09:06 UTC | dev-475: -F outputs unit score, not raw score | 11 April 2014, 01:09:06 UTC |
| 7d25fe2 | Heng Li | 11 April 2014, 01:07:16 UTC | Merge branch 'dev' into layout Conflicts: main.c | 11 April 2014, 01:07:16 UTC |
| e80bccc | Heng Li | 11 April 2014, 01:04:02 UTC | dev-474: fixed a typo | 11 April 2014, 01:04:02 UTC |
| f02cd42 | Heng Li | 11 April 2014, 01:03:13 UTC | dev-473: added a few assertions to make sure the new change works as is expected | 11 April 2014, 01:03:13 UTC |
| 8638cfa | Heng Li | 11 April 2014, 00:54:27 UTC | dev-472: get rid of bwa_fix_xref() This function causes all kinds of problems when the reference genome consists of many short reads/contigs/chromsomes. Some of the problems are nearly unfixable at the point where bwa_fix_xref() gets called. This commit attempts to fix the problem at the root. It disallows chains spanning multiple contigs and never retrieves sequences bridging two adjacent contigs. Thus all the chaining, extension, SW and global alignments are confined to on contig only. This commit brings many changes. I have tested it on a couple examples including Peter Field's PacBio example. It works well so far. | 11 April 2014, 00:54:27 UTC |
| e2d0c99 | Heng Li | 10 April 2014, 22:03:28 UTC | layout-477: output unit score, not the raw score | 10 April 2014, 22:03:28 UTC |
| 0eeacbb | Heng Li | 10 April 2014, 21:56:24 UTC | Merge branch 'dev' into layout | 10 April 2014, 21:56:24 UTC |
| 23e0e99 | Heng Li | 10 April 2014, 15:54:17 UTC | dev-471: fixed a compiling error from last commit | 10 April 2014, 15:54:17 UTC |
| ccbbe48 | Heng Li | 10 April 2014, 15:43:17 UTC | dev-470: don't stop on bwa_fix_xref2() failures Peter Field has sent me an example caused by an alignment bridging three adjacent chromosomes/contigs. Bwa-mem always aligns the query to the contig covering the middle point of the alignment. In this example, it chooses the middle contig, which should not be aligned. This leads to weird things failing bwa_fix_xref2(), which cannot be fixed unless we build the contig boundaries into the FM-index. In the old code, bwa-mem halts when bwa_fix_xref2() fails. With this commit, bwa-mem will give a warning instead of halting. | 10 April 2014, 15:43:17 UTC |
| 22c1d3c | Heng Li | 10 April 2014, 14:34:57 UTC | code backup | 10 April 2014, 14:34:57 UTC |
| cf6661a | Heng Li | 10 April 2014, 03:41:39 UTC | code backup | 10 April 2014, 03:41:39 UTC |
| bcf6d1b | Heng Li | 09 April 2014, 20:49:37 UTC | code backup | 09 April 2014, 20:49:37 UTC |
| 8220008 | Heng Li | 09 April 2014, 20:11:52 UTC | an attempt to layout tool | 09 April 2014, 20:11:52 UTC |
| db58392 | Heng Li | 09 April 2014, 17:20:04 UTC | dev-469: fixed wrong command line prompt | 09 April 2014, 17:20:04 UTC |
| d766591 | Heng Li | 09 April 2014, 02:11:36 UTC | dev-468: fixed a segfault caused by NULL | 09 April 2014, 02:11:36 UTC |
| 99f6f9a | Heng Li | 09 April 2014, 01:45:49 UTC | dev-467: limit the max #chains to extend | 09 April 2014, 01:45:49 UTC |
| c0a308a | Heng Li | 08 April 2014, 21:33:07 UTC | dev-466: simplified chain filtering | 08 April 2014, 21:33:07 UTC |
| f12dfae | Heng Li | 08 April 2014, 20:29:36 UTC | dev-465: a new output format for read overlap Also moved a few functions to bwamem_extra.c. File bwamem.c is becoming far too long. | 08 April 2014, 20:29:36 UTC |
| b45aeb8 | Heng Li | 08 April 2014, 15:40:54 UTC | dev-464: preset for pacbio read2read aln | 08 April 2014, 15:40:54 UTC |
| 172ba83 | Heng Li | 07 April 2014, 15:29:36 UTC | dev-463: added option -x to change multiple params I hate to copy-paste long command line options. | 07 April 2014, 15:29:36 UTC |
| 114901b | Heng Li | 04 April 2014, 21:01:04 UTC | dev-r462: refined setting for PacBio; weight flt The recommended setting in the last commit is wrong. If we can extend a random seed hit to the full length, we will force the read aligned through break points, which is wrong. The new setting is better but it may lead to a small fraction of fragmented alignments. In addition, I added a filter on the minimum chain weight and tied min_HSP_score to this filter. It doubles the mapping speed. | 04 April 2014, 21:01:04 UTC |
| 41f720d | Heng Li | 04 April 2014, 20:05:41 UTC | dev-461: added a heuristic for PacBio data See the comment above mem_test_chain_sw() for details. | 04 April 2014, 20:05:41 UTC |
| 066ec4a | Heng Li | 04 April 2014, 14:44:34 UTC | dev-460: disallow a cigar 20M2D2I30M in extension Global alignment does not allow contiguous insertions and deletions, but local alignment and extension allow such CIGARs. The optimal global alignment may have a lower score than extension, which actually happens often for PacBio data. This commit disallows a CIGAR like 20M2D2I30M to fix this inconsistency. Local alignment has not been changed. | 04 April 2014, 14:44:34 UTC |
| b6bd33b | Heng Li | 03 April 2014, 22:58:49 UTC | dev-459: don't hard code the drop ratio In the old code, if a secondary alignment is 50% worse, it won't be outputted. | 03 April 2014, 22:58:49 UTC |
| b322558 | Heng Li | 03 April 2014, 19:23:48 UTC | dev-458: simplified the smem iterator simpler but less powful. | 03 April 2014, 19:23:48 UTC |
| acfe761 | Heng Li | 03 April 2014, 19:10:50 UTC | dev-457: separated interval collection and seeding | 03 April 2014, 19:10:50 UTC |
| 9a57052 | Heng Li | 03 April 2014, 17:38:08 UTC | added more debugging infomation I can see a bug, but I do not know where it comes from. | 03 April 2014, 17:38:08 UTC |
| 3efb7c0 | Heng Li | 31 March 2014, 19:27:23 UTC | r455: release bwa-0.7.8 | 31 March 2014, 19:27:23 UTC |
| 127c00c | Heng Li | 31 March 2014, 16:03:27 UTC | dev-454: wording change in command line prompt | 31 March 2014, 16:03:27 UTC |
| b27bdf1 | Heng Li | 31 March 2014, 15:52:52 UTC | dev-453: change of -A scales -TdBOELU These paramemters are all proportional to -A. | 31 March 2014, 15:52:52 UTC |
| b7076d9 | Heng Li | 31 March 2014, 15:21:03 UTC | dev-r452: allow to specify insert size at cmd This is also very useful for debugging. | 31 March 2014, 15:21:03 UTC |
