| 9fdf25a | Ronny Lorenz | 14 July 2016, 16:43:38 UTC | Use only one API function to compute hairpin loop contributions for linear and circular cases | 14 July 2016, 16:43:38 UTC |
| bf4f384 | Ronny Lorenz | 14 July 2016, 15:35:27 UTC | Detach equilibrium probability computations from part_func.c - This creates a new source code file equilibrium_probs.c that implements base pair probability computations and alike | 14 July 2016, 16:31:46 UTC |
| b417d15 | Ronny Lorenz | 14 July 2016, 10:41:02 UTC | Fix free energy evaluation for circular RNAs in general and for RNAalifold | 14 July 2016, 15:02:18 UTC |
| 2f50403 | Ronny Lorenz | 11 July 2016, 15:02:21 UTC | Fix access to non-allocated memory in RNAalifold.c | 14 July 2016, 15:02:00 UTC |
| b0966d7 | Ronny Lorenz | 12 July 2016, 11:02:58 UTC | Add IUPAC sequence comparison in alphabet.c | 14 July 2016, 15:01:50 UTC |
| 8624083 | Ronny Lorenz | 12 July 2016, 11:40:26 UTC | Make pf_create_bppm() in part_func.c static as it was supposed to be | 14 July 2016, 15:01:34 UTC |
| ff1cdb1 | Ronny Lorenz | 13 July 2016, 20:49:46 UTC | Revert "Add documentation about post-condition of vrna_eval_move_pt()" This reverts commit b538c4df33cb78e597c5ef66726b83f05d84a5cd. | 13 July 2016, 20:49:46 UTC |
| 36eb209 | Ronny Lorenz | 13 July 2016, 20:48:38 UTC | Fix Makefiles for python bindings to be compatible with SWIG >= 3.0.9 | 13 July 2016, 20:48:38 UTC |
| b538c4d | Ronny Lorenz | 13 July 2016, 08:31:11 UTC | Add documentation about post-condition of vrna_eval_move_pt() | 13 July 2016, 08:31:11 UTC |
| 0050009 | Ronny Lorenz | 07 July 2016, 16:20:36 UTC | Fix potential syntax issues in the sources | 07 July 2016, 16:20:36 UTC |
| 12829a0 | Ronny Lorenz | 14 June 2016, 09:09:12 UTC | Removed unused variables in part_func.c | 07 July 2016, 16:20:06 UTC |
| ec525e7 | Ronny Lorenz | 04 July 2016, 11:39:31 UTC | Minimize doxygen warnings | 04 July 2016, 11:39:31 UTC |
| 7995c6a | Ronny Lorenz | 01 July 2016, 19:56:39 UTC | Add some documentation for scripting language interface wrappers | 01 July 2016, 19:56:39 UTC |
| 92b58ca | Ronny Lorenz | 01 July 2016, 11:54:30 UTC | Start adding notes on scripting interface wrappers in reference documentation | 01 July 2016, 19:32:27 UTC |
| ff19a01 | Ronny Lorenz | 01 July 2016, 18:35:40 UTC | Build Python3 interface by default | 01 July 2016, 18:38:12 UTC |
| fe7b78a | Ronny Lorenz | 01 July 2016, 18:37:25 UTC | Add more output to swig interface of vrna_pf_dimer() - Also add corresponding unit tests for scripting interfaces | 01 July 2016, 18:38:12 UTC |
| d4ca987 | Ronny Lorenz | 30 June 2016, 10:30:21 UTC | Minor changes in packaging files (PKGBUILD and .spec) | 30 June 2016, 10:30:21 UTC |
| 3625e03 | Ronny Lorenz | 30 June 2016, 10:30:02 UTC | Merge branch 'master' into development | 30 June 2016, 10:30:02 UTC |
| ad760db | Ronny Lorenz | 30 June 2016, 10:03:24 UTC | Fix some packaging issues | 30 June 2016, 10:03:24 UTC |
| ff71477 | Ronny Lorenz | 30 June 2016, 10:01:09 UTC | Fix dependency in debian packages for Ubuntu 16.04 | 30 June 2016, 10:01:09 UTC |
| b1e183b | Ronny Lorenz | 30 June 2016, 09:47:41 UTC | Do not redefine MIN2 and MAX2 in plex.c | 30 June 2016, 09:47:41 UTC |
| 962e995 | Ronny Lorenz | 30 June 2016, 09:46:52 UTC | Do not use variable in subopt.c before it has been initialized | 30 June 2016, 09:47:16 UTC |
| e044a8f | Ronny Lorenz | 30 June 2016, 09:45:47 UTC | Search for reference manual in both, builddir and srcdir on installation - This, again, makes distcheck happy | 30 June 2016, 09:45:47 UTC |
| 29e4a0b | Ronny Lorenz | 29 June 2016, 15:07:50 UTC | This is version 2.2.7 - Revert commit ba3ddbf3fa57a995759475560b3f1b3ada7609d3 that supposedly fixed an RNAup scaling bug but introduced general partition function scaling problems in other parts of the library. - Fix an RNAcofold --noLP bug - Include the file doc/dox in the distribution tarball - Include updated RNA::* perl modules | 29 June 2016, 15:09:01 UTC |
| f2b3c91 | Ronny Lorenz | 29 June 2016, 13:07:38 UTC | Include latest fixes in interfaces/Perl/RNA module | 29 June 2016, 13:07:38 UTC |
| 7e45cfc | Ronny Lorenz | 29 June 2016, 10:29:41 UTC | Merge branch 'dev_noLP_cofold' into 'development' Fix cofold --noLP issue when stack crosses cut point between strands This commit should fix the ambiguity for cases when a base pair stack contains the cutpoint, such as: CCAGUAUUAACUGUGCUGCUGA&GUCAUAAGGGUGUCUUAGUGUG .((((((.....))))))((((&(.(((....))).))))).... Such configurations are treated as lonely pairs from now on, since the pair that starts immediately after the nick in the backbone does not extend to a helix with size of at least 2. See merge request !54 | 29 June 2016, 10:29:41 UTC |
| 432f22f | Ronny Lorenz | 28 June 2016, 15:48:52 UTC | Fix cofold --noLP issue when stack crosses cut point between strands This commit should fix the ambiguity for cases when a base pair stack contains the cutpoint, such as: CCAGUAUUAACUGUGCUGCUGA&GUCAUAAGGGUGUCUUAGUGUG .((((((.....))))))((((&(.(((....))).))))).... Such configurations are treated as lonely pairs from now on, since the pair that starts immediately after the nick in the backbone does not extend to a helix with size of at least 2. | 28 June 2016, 15:48:52 UTC |
| 9e39946 | Ronny Lorenz | 26 June 2016, 13:13:25 UTC | Distribute doc/dox such that making the sources does not default to build the reference manual even when latex is available | 26 June 2016, 13:13:25 UTC |
| d1ccd24 | Ronny Lorenz | 25 June 2016, 15:09:46 UTC | Use VRNA_OPTION_DEFAULT in fold.c instead of just 0 | 25 June 2016, 15:09:46 UTC |
| 73f6a27 | Ronny Lorenz | 25 June 2016, 15:07:17 UTC | Repair Boltzmann factor scaling for RNAup (again) - In contrast to our previous fix, this solution should be robust since we set the scaling factor within the exp_params attribute of the backward compatibility fold compound just before the partition function recursions. | 25 June 2016, 15:07:17 UTC |
| fd5f3fe | Ronny Lorenz | 23 June 2016, 20:11:33 UTC | Revert "Fix RNAup bug" This reverts commit ba3ddbf3fa57a995759475560b3f1b3ada7609d3. This patch destroyed partition function scaling in vrna_pf() Signed-off-by: Ronny Lorenz <ronny@tbi.univie.ac.at> | 23 June 2016, 20:11:33 UTC |
| bf42930 | Ronny Lorenz | 21 June 2016, 12:12:34 UTC | Merge branch 'master' into development | 21 June 2016, 12:12:34 UTC |
| e176a66 | Ronny Lorenz | 09 April 2016, 16:09:24 UTC | Bump version to 2.2.6 - Add packaging/debian/python3-rna.install - Repaired make_windows_installer.sh - Plugged memory leak in RNAcofold - Fixed partition function rescaling bug in RNAup - Fixed bug in RNALfold with window sizes larger than sequence length - Re-added SCI parameter for RNAalifold - Fixed backtracking issue for large G-quadruplexes in RNAalifold - Fixed missing FASTA id in RNAeval output - Added option to RNAalifold that allows to specify prefix for output files - Several fixes and additional functions/methods in scripting language interface(s) - Added version information for scripting language interface(s) - Some changes to allow for compilation with newer compilers, such as gcc 6.1 | 21 June 2016, 11:49:15 UTC |
| 96d73bb | Ronny Lorenz | 19 June 2016, 10:12:36 UTC | Updated several .gitignore files | 19 June 2016, 10:12:36 UTC |
| ce81757 | Ronny Lorenz | 19 June 2016, 09:57:24 UTC | Bump version of src/Kinfold again to correctly link it against RNAlib | 19 June 2016, 09:57:24 UTC |
| 99edb45 | Ronny Lorenz | 18 June 2016, 13:34:46 UTC | Add latest HEAD of src/Kinfold again - See e1fe625e1ff61c197eea474589230446ed226fcd | 18 June 2016, 13:34:46 UTC |
| ebdeb0b | Ronny Lorenz | 18 June 2016, 12:48:42 UTC | Make 'make distcheck' happy | 18 June 2016, 13:27:33 UTC |
| c84e142 | Ronny Lorenz | 17 June 2016, 14:10:51 UTC | Minor changes for configure script - Kinwalker was deactivated by default but ./configure --help displayed it as default active - Do not show install paths for documentation when documentation is turned off | 17 June 2016, 14:10:51 UTC |
| 33166c0 | Ronny Lorenz | 17 June 2016, 13:51:39 UTC | Merge branch 'dev_unitTest' into 'development' Mario's swig interface enhancements and corresponding unit tests See merge request !53 | 17 June 2016, 13:51:39 UTC |
| 6c7de7b | Ronny Lorenz | 17 June 2016, 13:47:36 UTC | Minor cosmetic changes in unit tests for scripting language interfaces | 17 June 2016, 13:47:36 UTC |
| ab796ab | Ronny Lorenz | 16 June 2016, 16:54:02 UTC | First changes to make missing features working - Still two-dimensional array conversion from perl to vector<vector<T>> does not work at the moment. We need to think more deeply about this... | 16 June 2016, 16:54:02 UTC |
| aa0349d | Mario Koestl | 15 June 2016, 15:58:47 UTC | updated all eval.i functions to return the correct dataype | 16 June 2016, 11:59:33 UTC |
| 2746af8 | Mario Koestl | 17 May 2016, 13:05:03 UTC | python3 typemap changed to support strings, move_standard function utils.i fixed,started utility function in utils.i like pairtable functions, addBP in perl still not working and also the packing | 16 June 2016, 11:59:33 UTC |
| b217af5 | Mario Koestl | 12 May 2016, 07:40:30 UTC | changed utils.i to the correct one, commited wrong code yesterday, forget to name another error in test-RNA.py3, here we have a list of strings which is not recognised as strings, ?? | 16 June 2016, 11:59:32 UTC |
| d51df25 | Mario Koestl | 11 May 2016, 15:01:44 UTC | created new test for utils(till now only pairtable implemented), Following problems cannot be solved: 1. i canot find an equaivalent of unpack(f*) in python. 2: pack and unpack in python 3 is not working correct, string is represented different than in python 2. 3: addBP function in perl is not working, because 2 dimensional array is not recognized by SWIG, int python no problem. 4: new created interface for move_standard, in utils.i is returning with a core dumped in python, but in perl is working. | 16 June 2016, 11:59:31 UTC |
| bda3f58 | Mario Koestl | 28 April 2016, 14:07:43 UTC | created all python and python3 tests, now every unitTest is available in python, python3 and perl. Problem with test_moveSets and reference passingand test_check_access_C_array because RNA.cvar.iindx is None | 16 June 2016, 11:59:29 UTC |
| 484d4b7 | Mario Koestl | 28 April 2016, 14:02:47 UTC | added test-RNA-constraints.pl tests, updated all tests for test-RNA-mfe_eval.pl and test-RNA.pl created a simple getDirectory function in RNApath.pm and changed all tests to the test::More framework | 16 June 2016, 11:59:29 UTC |
| e1fe625 | Ronny Lorenz | 16 June 2016, 11:56:16 UTC | Pass VRNA_CFLAGS and VRNA_LIBS to Kinfold - From now on, we use a version of Kinfold that queries compiler and linker flags from pkg-config. This allows us to directly pass these flags to the subpackage as we do already for RNAforester and Kinwalker. | 16 June 2016, 11:56:16 UTC |
| 899a2f9 | Ronny Lorenz | 15 June 2016, 21:11:40 UTC | Merge branch 'dev_cleanup_autoconf' into 'development' Cleanup several things related to the autoconf/automake chain - We now use AX_OPENMP to detect OpenMP flags for different compilers - Restructured CFLAGS/CXXFLAGS/CPPFLAGS/LDFLAGS to properly propagate settings such as LTO. - Added new compiler/linker option -fno-strict-aliasing which prohibits the optimizers to accidentally misoptimize things See merge request !52 | 15 June 2016, 21:11:40 UTC |
| 13abf0f | Ronny Lorenz | 13 June 2016, 07:54:01 UTC | Cleanup several things related to the autoconf/automake chain - We now use AX_OPENMP to detect OpenMP flags for different compilers - Restructured CFLAGS/CXXFLAGS/CPPFLAGS/LDFLAGS to properly propagate settings such as LTO. - Added new compiler/linker option -fno-strict-aliasing which prohibits the optimizers to accidentally misoptimize things | 15 June 2016, 21:03:22 UTC |
| e5da644 | Ronny Lorenz | 15 June 2016, 20:03:26 UTC | Fix data structure type mismatch with LTO and -std >= C++11 | 15 June 2016, 20:09:34 UTC |
| da54cd3 | Ronny Lorenz | 15 June 2016, 13:51:18 UTC | Pass VRNA_CFLAGS and VRNA_LDFLAGS to RNAforester | 15 June 2016, 13:51:18 UTC |
| ecb2c1e | Ronny Lorenz | 15 June 2016, 11:04:33 UTC | Fix memory leak in RNAcofold | 15 June 2016, 11:04:33 UTC |
| 1a07a56 | Ronny Lorenz | 08 June 2016, 13:17:06 UTC | minor cofold speedup in energy_of_move See also commit 727c672ddc8c657679c3e08b1a905add39118c7a | 08 June 2016, 13:17:06 UTC |
| c7928a9 | Ronny Lorenz | 08 June 2016, 12:46:17 UTC | included cofold_penalty for energy_of_move See also 780eac036ba92c805277b4a2c988430f0c342d9e. This commit got lost when we transitioned from 2.1.9 to 2.2 | 08 June 2016, 12:46:17 UTC |
| 60f80fe | Ronny Lorenz | 08 June 2016, 12:32:33 UTC | Re-add latest switch.pl This got lost during the transition between v2.1.9 and v2.2 | 08 June 2016, 12:32:33 UTC |
| 44d8767 | Stefan Badelt | 07 July 2014, 11:26:05 UTC | check to make sure -bar and -circ is not called small changes in description. (cherry picked from commit 812c966363bfcd6cca93ac5fc2381a3ba63db477) Signed-off-by: Ronny Lorenz <ronny@tbi.univie.ac.at> | 08 June 2016, 12:26:25 UTC |
| e35167c | Ronny Lorenz | 08 June 2016, 12:19:19 UTC | fixed gquad bug in Lfold See also commit 99d276708958215a3b653a24c52aade6053ae1ff | 08 June 2016, 12:21:42 UTC |
| 7a168f2 | Ronny Lorenz | 08 August 2014, 15:14:43 UTC | Fix missing RNAeval fasta ID output (cherry picked from commit e3dd1150ff91f2be4b23181abdf7a3d4244186ed) Signed-off-by: Ronny Lorenz <ronny@tbi.univie.ac.at> | 08 June 2016, 12:21:38 UTC |
| 244ba9b | Ronny Lorenz | 23 February 2015, 13:51:12 UTC | Added proper interface to circfold and pf_circ_fold() into the SWIG interface (cherry picked from commit 07508d96fc5f7d1ad6ef1f14a822473bdfcec429) Signed-off-by: Ronny Lorenz <ronny@tbi.univie.ac.at> | 08 June 2016, 11:50:33 UTC |
| 908f9b7 | Ronny Lorenz | 07 June 2016, 15:08:43 UTC | Removed bug in mfe.c that scrambled backtracing with gquadruplex support for consensus structures See also c54fbaabf1b5050278b0c242afcdd8b9780fcdf5 | 07 June 2016, 15:08:43 UTC |
| 96ea21f | Ronny Lorenz | 18 September 2014, 16:58:02 UTC | Fixed backtracking issue in RNAalifold for larger gquadruplexes (cherry picked from commit f53caaaf397e79f1f2decb211fcbe2211759f17f) Signed-off-by: Ronny Lorenz <ronny@tbi.univie.ac.at> | 07 June 2016, 15:06:36 UTC |
| 403ccd2 | Ronny Lorenz | 07 June 2016, 15:03:22 UTC | Re-add SCI option for RNAalifold | 07 June 2016, 15:03:22 UTC |
| b7ca73d | Ronny Lorenz | 07 June 2016, 13:22:38 UTC | Add option to pass prefix string for filenames generated by RNAalifold | 07 June 2016, 13:22:38 UTC |
| 9b4c572 | Ronny Lorenz | 13 May 2016, 14:08:38 UTC | Fix building swig interfaces when swig executable is not present or of wrong version | 13 May 2016, 14:08:38 UTC |
| ba3ddbf | Ronny Lorenz | 09 May 2016, 15:55:37 UTC | Fix RNAup bug | 09 May 2016, 15:55:37 UTC |
| 04bda44 | Ronny Lorenz | 19 April 2016, 09:03:28 UTC | Include Python3 package in build instructions for CentOS | 19 April 2016, 09:03:28 UTC |
| bab803c | Ronny Lorenz | 19 April 2016, 09:02:04 UTC | Include Python3 package in build instructions for ArchLinux | 19 April 2016, 09:02:04 UTC |
| d6a070b | Ronny Lorenz | 19 April 2016, 08:58:28 UTC | Merge branch 'development' of krios.tbi.univie.ac.at:rna/viennarna into development | 19 April 2016, 08:58:28 UTC |
| 6d7077b | Ronny Lorenz | 19 April 2016, 08:57:52 UTC | Fix and update debian build instructions | 19 April 2016, 08:57:52 UTC |
| 3e7d652 | Ronny Lorenz | 19 April 2016, 08:56:45 UTC | Fix '__warn_memset_zero_len' compiler warning | 19 April 2016, 08:56:45 UTC |
| 60ac366 | Ronny Lorenz | 16 April 2016, 16:50:36 UTC | Fix version string for Perl interface and add fold_compound method to retrieve basepair probabilities | 16 April 2016, 16:50:36 UTC |
| 4660433 | Ronny Lorenz | 14 April 2016, 12:36:55 UTC | Add version number to SWIG generated interfaces | 14 April 2016, 12:36:55 UTC |
| cb27e4f | Ronny Lorenz | 11 April 2016, 21:59:24 UTC | Fix segfault in RNALfold when window size exceeds sequence length - 5 | 11 April 2016, 22:00:02 UTC |
| 3807c78 | Ronny Lorenz | 11 April 2016, 21:58:42 UTC | Allow build/install of Python3 interface for various python3 install types | 11 April 2016, 21:58:42 UTC |
| 32809c0 | Ronny Lorenz | 11 April 2016, 15:50:14 UTC | Install __pycache__ directory content in py3_sitearch/RNA/__pycache__/ | 11 April 2016, 15:50:14 UTC |
| 2156abf | Ronny Lorenz | 11 April 2016, 09:55:24 UTC | Remove compatibility package from packaging/viennarna.spec.in and add python3 package | 11 April 2016, 09:55:24 UTC |
| 7cf1885 | Ronny Lorenz | 09 April 2016, 16:42:05 UTC | Changed windows installer to allow for component selection - Also added Kinwalker to the list of installable programs | 09 April 2016, 18:39:16 UTC |
| 96ae047 | Ronny Lorenz | 09 April 2016, 16:09:24 UTC | Include latest kinwalker for being able to cross-compile for windows | 09 April 2016, 18:04:47 UTC |
| 64cfc12 | Ronny Lorenz | 08 April 2016, 18:21:46 UTC | Merge branch 'master' into development | 08 April 2016, 18:21:46 UTC |
| 6e23b18 | Ronny Lorenz | 08 April 2016, 18:20:26 UTC | Fix return values of some swig generated scripting language interface functions | 08 April 2016, 18:20:26 UTC |
| eca94e1 | Ronny Lorenz | 08 April 2016, 17:56:47 UTC | Merge branch 'master' into development | 08 April 2016, 17:56:47 UTC |
| bc29916 | Ronny Lorenz | 08 April 2016, 17:53:25 UTC | Fix build when swig is not available and re-enable python versions prior to 2.7 - This bugfix also fixes a syntax error in tests/eval_structure.ts and removes unnecessary include paths in packaging/viennarna.spec.in | 08 April 2016, 17:53:25 UTC |
| 14266ef | Ronny Lorenz | 08 April 2016, 15:40:54 UTC | Merge branch 'master' into development | 08 April 2016, 15:40:54 UTC |
| d29bb47 | Ronny Lorenz | 08 April 2016, 15:37:31 UTC | Merge branch 'release_v2.2.5' into 'master' Bump version to 2.2.5 - Added Kinwalker as optional subproject - Added Python3 interface - Fixed regression in RNAcofold that prohibited output of concentration computations - Fixed behavior of RNAfold and RNAcofold when hard constraints create empty solution set (programs now abort with error message) - Added RNA::Params Perl 5 sub-package - Update RNA::Design Perl 5 sub-package - Simplified usage of v3.0 API with default options - Wrap more functions of v3.0 API in SWIG generated scripting language interfaces - Plugged some memory leaks in SWIG generated scripting language interfaces - Changed parameters of recursion status callback in vrna_fold_compound_t - Enable definition and binding of callback functions from SWIG target language - Added several configure options to ease building and packaging under MacOS X - Added new utility script RNAdesign.pl See merge request !51 | 08 April 2016, 15:37:31 UTC |
| 4ded923 | Ronny Lorenz | 22 February 2016, 15:56:47 UTC | Bump version to 2.2.5 - Added Kinwalker as optional subproject - Added Python3 interface - Fixed regression in RNAcofold that prohibited output of concentration computations - Fixed behavior of RNAfold and RNAcofold when hard constraints create empty solution set (programs now abort with error message) - Added RNA::Params Perl 5 sub-package - Update RNA::Design Perl 5 sub-package - Simplified usage of v3.0 API with default options - Wrap more functions of v3.0 API in SWIG generated scripting language interfaces - Plugged some memory leaks in SWIG generated scripting language interfaces - Changed parameters of recursion status callback in vrna_fold_compound_t - Enable definition and binding of callback functions from SWIG target language - Added several configure options to ease building and packaging under MacOS X - Added new utility script RNAdesign.pl | 08 April 2016, 15:14:22 UTC |
| cb9b88f | Ronny Lorenz | 08 April 2016, 15:10:54 UTC | Restore compatibility for stdout/stderr redirect in doc/Makefile.am | 08 April 2016, 15:10:54 UTC |
| 1d8a1b0 | Ronny Lorenz | 08 April 2016, 14:24:40 UTC | Fix building of Python2 swig interface in MacOS X | 08 April 2016, 14:24:40 UTC |
| 3f6b1c0 | Ronny Lorenz | 08 April 2016, 12:15:31 UTC | Make 'make distcheck' happy again | 08 April 2016, 12:15:31 UTC |
| c86e83a | Ronny Lorenz | 08 April 2016, 10:10:40 UTC | Allow to pass 'None' as file handle in Python 3 interface | 08 April 2016, 10:10:40 UTC |
| dd16a91 | Ronny Lorenz | 07 April 2016, 17:01:35 UTC | Merge branch 'dev_merge_mario' into 'development' Merge latest changes from Mario See merge request !50 | 07 April 2016, 17:01:35 UTC |
| 0f129ba | Ronny Lorenz | 07 April 2016, 16:59:16 UTC | Started SWIG interface for file_formats.c | 07 April 2016, 16:59:16 UTC |
| 49b7541 | Ronny Lorenz | 07 April 2016, 16:57:53 UTC | Bugfix: Make RNAcofold printing computed concentrations again | 07 April 2016, 16:57:53 UTC |
| ee9a7f5 | Ronny Lorenz | 07 April 2016, 16:52:22 UTC | use proper namespace for 'string' datatype in interfaces/fold_compound.i | 07 April 2016, 16:52:22 UTC |
| ac9310e | Ronny Lorenz | 07 April 2016, 16:51:01 UTC | Fixed python and python3 interface unit tests | 07 April 2016, 16:51:01 UTC |
| 5d18d81 | Ronny Lorenz | 07 April 2016, 16:46:15 UTC | Fix casting of floating point kcal/mol to integer decakal/mol in constraints | 07 April 2016, 16:46:15 UTC |
| 1c5ed7a | Mario Koestl | 06 April 2016, 10:24:29 UTC | added all python test to python3 (Overloading with file handling functions is still not working), and SHAPE results have error variances. Added Perl test for the mfe_eval functions (cherry picked from commit c7b13e274f41929e5355840f5db728d30f7dbd20) Signed-off-by: Ronny Lorenz <ronny@tbi.univie.ac.at> | 07 April 2016, 10:01:25 UTC |
| 81cbdcb | Mario Koestl | 06 April 2016, 08:35:12 UTC | RNA interface is now able to accept Vector<vector<double>> for vrna_sc_add_bp() ,added new SHAPE test data (cherry picked from commit 69e6c11756b03943fe7407de0202ac54a5755c83) Signed-off-by: Ronny Lorenz <ronny@tbi.univie.ac.at> | 07 April 2016, 09:56:34 UTC |
| 86dde86 | Ronny Lorenz | 04 April 2016, 16:31:27 UTC | Merge branch 'dev_mario' into 'development' Include Mario's update on SWIG interface and Unittests See merge request !49 | 04 April 2016, 16:31:27 UTC |
| ea36d26 | Ronny Lorenz | 04 April 2016, 15:03:18 UTC | Activate soft constraints for base pairs in scripting language interface - Plus some code cleanup in interfaces/ and tests/ | 04 April 2016, 16:21:29 UTC |
