Revision 42b3c6ebb50ecaabf92e3d168da1be05a640f9f2 authored by davelopez on 11 May 2022, 14:31:46 UTC, committed by davelopez on 11 May 2022, 14:31:46 UTC
1 parent 06d37d9
shrimp_wrapper.xml
<tool id="shrimp_wrapper" name="SHRiMP for Letter-space" version="1.0.0">
<description>reads mapping against reference sequence </description>
<requirements>
<requirement type="binary">rmapper-ls</requirement>
</requirements>
<command>
python '$__tool_directory__/shrimp_wrapper.py' '$input_target' '$output1' '$output2'
#if $type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip"
'$type_of_reads.input_query'
#elif $type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip")
'$type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size'
#elif $type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full"
'$type_of_reads.input_query' '$param.spaced_seed' $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold
#elif $type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full"
'$type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size' '$param.spaced_seed' $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold
#end if
</command>
<inputs>
<conditional name="type_of_reads">
<param name="single_or_paired" type="select" label="Single- or Paired-ends">
<option value="single">Single-end</option>
<option value="paired">Paired-end</option>
</param>
<when value="single">
<param name="input_query" type="data" format="fastqsolexa" label="Align sequencing reads" help="No dataset? Read tip below"/>
</when>
<when value="paired">
<param name="insertion_size" type="integer" value="600" label="Insertion length between two ends" help="bp" />
<param name="input1" type="data" format="fastqsolexa" label="Align sequencing reads, one end" />
<param name="input2" type="data" format="fastqsolexa" label="and the other end" />
</when>
</conditional>
<param name="input_target" type="data" format="fasta" label="against reference" />
<conditional name="param">
<param name="skip_or_full" type="select" label="SHRiMP settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full List">
<option value="skip">Commonly used</option>
<option value="full">Full Parameter List</option>
</param>
<when value="skip" />
<when value="full">
<param name="spaced_seed" type="text" value="111111011111" label="Spaced Seed" />
<param name="seed_matches_per_window" type="integer" value="2" label="Seed Matches per Window" />
<param name="seed_hit_taboo_length" type="integer" value="4" label="Seed Hit Taboo Length" />
<param name="seed_generation_taboo_length" type="integer" value="0" label="Seed Generation Taboo Length" />
<param name="seed_window_length" type="float" value="115.0" label="Seed Window Length" help="in percentage" />
<param name="max_hits_per_read" type="integer" value="100" label="Maximum Hits per Read" />
<param name="max_read_length" type="integer" value="1000" label="Maximum Read Length" />
<param name="kmer" type="integer" value="-1" label="Kmer Std. Deviation Limit" help="-1 as None"/>
<param name="sw_match_value" type="integer" value="100" label="S-W Match Value" />
<param name="sw_mismatch_value" type="integer" value="-150" label="S-W Mismatch Value" />
<param name="sw_gap_open_ref" type="integer" value="-400" label="S-W Gap Open Penalty (Reference)" />
<param name="sw_gap_open_query" type="integer" value="-400" label="S-W Gap Open Penalty (Query)" />
<param name="sw_gap_ext_ref" type="integer" value="-70" label="S-W Gap Extend Penalty (Reference)" />
<param name="sw_gap_ext_query" type="integer" value="-70" label="S-W Gap Extend Penalty (Query)" />
<param name="sw_hit_threshold" type="float" value="68.0" label="S-W Hit Threshold" help="in percentage" />
</when>
</conditional>
</inputs>
<outputs>
<data name="output1" format="tabular"/>
<data name="output2" format="tabular"/>
</outputs>
<tests>
<test>
<param name="single_or_paired" value="single" />
<param name="skip_or_full" value="skip" />
<param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" />
<param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/>
<output name="output1" file="shrimp_wrapper_test1.out1" />
</test>
<!--
<test>
<param name="single_or_paired" value="paired" />
<param name="skip_or_full" value="skip" />
<param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" />
<param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa" />
<param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa" />
<param name="insertion_size" value="600" />
<output name="output1" file="shrimp_wrapper_test2.out1" />
</test>
<test>
<param name="single_or_paired" value="single" />
<param name="skip_or_full" value="full" />
<param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" />
<param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/>
<param name="spaced_seed" value="111111011111" />
<param name="seed_matches_per_window" value="2" />
<param name="seed_hit_taboo_length" value="4" />
<param name="seed_generation_taboo_length" value="0" />
<param name="seed_window_length" value="115.0" />
<param name="max_hits_per_read" value="100" />
<param name="max_read_length" value="1000" />
<param name="kmer" value="-1" />
<param name="sw_match_value" value="100" />
<param name="sw_mismatch_value" value="-150" />
<param name="sw_gap_open_ref" value="-400" />
<param name="sw_gap_open_query" value="-400" />
<param name="sw_gap_ext_ref" value="-70" />
<param name="sw_gap_ext_query" value="-70" />
<param name="sw_hit_threshold" value="68.0" />
<output name="output1" file="shrimp_wrapper_test1.out1" />
</test>
<test>
<param name="single_or_paired" value="paired" />
<param name="skip_or_full" value="full" />
<param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" />
<param name="spaced_seed" value="111111011111" />
<param name="seed_matches_per_window" value="2" />
<param name="seed_hit_taboo_length" value="4" />
<param name="seed_generation_taboo_length" value="0" />
<param name="seed_window_length" value="115.0" />
<param name="max_hits_per_read" value="100" />
<param name="max_read_length" value="1000" />
<param name="kmer" value="-1" />
<param name="sw_match_value" value="100" />
<param name="sw_mismatch_value" value="-150" />
<param name="sw_gap_open_ref" value="-400" />
<param name="sw_gap_open_query" value="-400" />
<param name="sw_gap_ext_ref" value="-70" />
<param name="sw_gap_ext_query" value="-70" />
<param name="sw_hit_threshold" value="68.0" />
<param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa"/>
<param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa"/>
<param name="insertion_size" value="600" />
<output name="output1" file="shrimp_wrapper_test2.out1" />
</test>
-->
</tests>
<help>
.. class:: warningmark
IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. Click pencil icon next to your dataset to set datatype to *fastqsolexa*.
-----
**What it does**
SHRiMP (SHort Read Mapping Package) is a software package for aligning genomic reads against a target genome.
This wrapper post-processes the default SHRiMP/rmapper-ls output and generates a table with all information from reads and reference for the mapping. The tool takes single- or paired-end reads. For single-end reads, only uniquely mapped alignment is considered. In paired-end reads, only pairs that meet the following criteria will be used to generate the table: 1). the ends fall within the insertion size; 2). the ends are mapped at the opposite directions. If there are still multiple mappings after applying the criteria, this paired-end read will be discarded.
-----
**Input formats**
A multiple-fastq file, for example::
@seq1
TACCCGATTTTTTGCTTTCCACTTTATCCTACCCTT
+seq1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
-----
**Outputs**
The tool gives two outputs.
**Table output**
Table output contains 8 columns::
1 2 3 4 5 6 7 8
----------------------------------------------------
chrM 14711 seq1 0 T A 40 1
chrM 14712 seq1 1 T T 40 1
where::
1. (chrM) - Reference sequence id
2. (14711) - Position of the mapping in the reference
3. (seq1) - Read id
4. (0) - Position of the mapping in the read
5. (T) - Nucleotide in the reference
6. (A) - Nucleotide in the read
7. (40) - Quality score for the nucleotide in the position of the read
8. (1) - The number of times this position is covered by reads
**SHRiMP output**
This is the default output from SHRiMP/rmapper-ls::
1 2 3 4 5 6 7 8 9 10
-------------------------------------------------------------------
seq1 chrM + 3644 3679 1 36 36 3600 36
where::
1. (seq1) - Read id
2. (chrM) - Reference sequence id
3. (+) - Strand of the read
4. (3466) - Start position of the alignment in the reference
5. (3679) - End position of the alignment in the reference
6. (1) - Start position of the alignment in the read
7. (36) - End position of the alignment in the read
8. (36) - Length of the read
9. (3600) - Score
10. (36) - Edit string
-----
**SHRiMP parameter list**
The commonly used parameters with default value setting::
-s Spaced Seed (default: 111111011111)
The spaced seed is a single contiguous string of 0's and 1's.
0's represent wildcards, or positions which will always be
considered as matching, whereas 1's dictate positions that
must match. A string of all 1's will result in a simple kmer scan.
-n Seed Matches per Window (default: 2)
The number of seed matches per window dictates how many seeds
must match within some window length of the genome before that
region is considered for Smith-Waterman alignment. A lower
value will increase sensitivity while drastically increasing
running time. Higher values will have the opposite effect.
-t Seed Hit Taboo Length (default: 4)
The seed taboo length specifies how many target genome bases
or colors must exist prior to a previous seed match in order
to count another seed match as a hit.
-9 Seed Generation Taboo Length (default: 0)
-w Seed Window Length (default: 115.00%)
This parameter specifies the genomic span in bases (or colours)
in which *seed_matches_per_window* must exist before the read
is given consideration by the Simth-Waterman alignment machinery.
-o Maximum Hits per Read (default: 100)
This parameter specifies how many hits to remember for each read.
If more hits are encountered, ones with lower scores are dropped
to make room.
-r Maximum Read Length (default: 1000)
This parameter specifies the maximum length of reads that will
be encountered in the dataset. If larger reads than the default
are used, an appropriate value must be passed to *rmapper*.
-d Kmer Std. Deviation Limit (default: -1 [None])
This option permits pruning read kmers, which occur with
frequencies greater than *kmer_std_dev_limit* standard
deviations above the average. This can shorten running
time at the cost of some sensitivity.
*Note*: A negative value disables this option.
-m S-W Match Value (default: 100)
The value applied to matches during the Smith-Waterman score calculation.
-i S-W Mismatch Value (default: -150)
The value applied to mismatches during the Smith-Waterman
score calculation.
-g S-W Gap Open Penalty (Reference) (default: -400)
The value applied to gap opens along the reference sequence
during the Smith-Waterman score calculation.
*Note*: Note that for backward compatibility, if -g is set
and -q is not set, the gap open penalty for the query will
be set to the same value as specified for the reference.
-q S-W Gap Open Penalty (Query) (default: -400)
The value applied to gap opens along the query sequence during
the Smith-Waterman score calculation.
-e S-W Gap Extend Penalty (Reference) (default: -70)
The value applied to gap extends during the Smith-Waterman score calculation.
*Note*: Note that for backward compatibility, if -e is set
and -f is not set, the gap exten penalty for the query will
be set to the same value as specified for the reference.
-f S-W Gap Extend Penalty (Query) (default: -70)
The value applied to gap extends during the Smith-Waterman score calculation.
-h S-W Hit Threshold (default: 68.00%)
In letter-space, this parameter determines the threshold
score for both vectored and full Smith-Waterman alignments.
Any values less than this quantity will be thrown away.
*Note* This option differs slightly in meaning between letter-space and color-space.
</help>
<citations>
<citation type="doi">10.1371/journal.pcbi.1000386</citation>
</citations>
</tool>
![swh spinner](/static/img/swh-spinner.gif)
Computing file changes ...