Skip to main content
https://github.com/arjunrajlaboratory/RajLabSeqTools
10 December 2020, 08:13:14 UTC
Revision c5b88eb5aa3fa9f6a657d8b078405ce82f7e0e2d authored by Eric Sanford on 09 October 2019, 20:53:45 UTC, committed by Eric Sanford on 09 October 2019, 20:53:45 UTC
Updated STAR version, set default reference genome to hg38, added gene_names from gtf file when there is no HGNC symbol match, made it easier to change the reference genome by defining it in the setEnvironmentVariables.sh script. Modified some snakemake files to make that alternate pipeline almost runnable on the cluster in an interactive node.
1 parent e650685
Raw File Download Save again
Tip revision: c5b88eb5aa3fa9f6a657d8b078405ce82f7e0e2d authored by Eric Sanford on 09 October 2019, 20:53:45 UTC
Updated STAR version, set default reference genome to hg38, added gene_names from gtf file when there is no HGNC symbol match, made it easier to change the reference genome by defining it in the setEnvironmentVariables.sh script. Modified some snakemake files to make that alternate pipeline almost runnable on the cluster in an interactive node.
Tip revision: c5b88eb
config.yaml 
# path or URL to sample sheet (TSV format, columns: sample, condition, ...)
samples: samples.tsv
# path or URL to sequencing unit sheet (TSV format, columns: sample, unit, fq1, fq2, 
# strandedness). Units are technical replicates (e.g. lanes, or resequencing of the 
# same biological sample).If the column "strandedness" is present (which is optional), 
# can be empty or has one of these values: none, yes or reverse. none is for unstranded 
# protocols, yes an reverse follow the nomenclature used in `htseq-count --reverse` 
# which is referenced in STAR manual section 7, "Counting number of reads per gene".

units: units.tsv

trimming:
  # skip trimming: false or true
  skip: true
  # the sequencing adapter
  adapter: ACGGATCGATCGATCGATCGAT

ref:
  # the STAR index
  index: "refs/hg38_STAR"
  # gtf file with transcripts
  annotation: "refs/hg38_STAR/hg38.gtf"

pca:
  labels:
    # columns of sample sheet to use for PCA
    - condition

diffexp:
  # contrasts for the deseq2 results method
  contrasts:
    infected-vs-mock:
      - infected
      - mock

params:
  star: ""
  cutadapt-se: ""
  cutadapt-pe: ""
  diffgenes: "20"
  log-sig: "-30"
  log2-fold: "2"