Skip to main content
  • Home
  • Development
  • Documentation
  • Donate
  • Operational login
  • Browse the archive

swh logo
SoftwareHeritage
Software
Heritage
Archive
Features
  • Search

  • Downloads

  • Save code now

  • Add forge now

  • Help

https://github.com/arjunrajlaboratory/RajLabSeqTools
10 December 2020, 08:13:14 UTC
  • Code
  • Branches (2)
  • Releases (0)
  • Visits
Revision c5b88eb5aa3fa9f6a657d8b078405ce82f7e0e2d authored by Eric Sanford on 09 October 2019, 20:53:45 UTC, committed by Eric Sanford on 09 October 2019, 20:53:45 UTC
Updated STAR version, set default reference genome to hg38, added gene_names from gtf file when there is no HGNC symbol match, made it easier to change the reference genome by defining it in the setEnvironmentVariables.sh script. Modified some snakemake files to make that alternate pipeline almost runnable on the cluster in an interactive node.
1 parent e650685
  • Files
  • Changes
    • Branches
    • Releases
    • HEAD
    • refs/heads/master
    • refs/import/heads/master
    • c5b88eb5aa3fa9f6a657d8b078405ce82f7e0e2d
    No releases to show
  • 7078d72
  • /
  • Snakemake_bulkRNA
  • /
  • config.yaml
Raw File Download Save again
Take a new snapshot of a software origin

If the archived software origin currently browsed is not synchronized with its upstream version (for instance when new commits have been issued), you can explicitly request Software Heritage to take a new snapshot of it.

Use the form below to proceed. Once a request has been submitted and accepted, it will be processed as soon as possible. You can then check its processing state by visiting this dedicated page.
swh spinner

Processing "take a new snapshot" request ...

To reference or cite the objects present in the Software Heritage archive, permalinks based on SoftWare Hash IDentifiers (SWHIDs) must be used.
Select below a type of object currently browsed in order to display its associated SWHID and permalink.

  • revision
  • directory
  • content
  • snapshot
origin badgerevision badge
swh:1:rev:c5b88eb5aa3fa9f6a657d8b078405ce82f7e0e2d
origin badgedirectory badge
swh:1:dir:8909dba22cf287e1b5a733eaa8187882930d7197
origin badgecontent badge
swh:1:cnt:c4e7a2cf2b3469953cc093e549c5c37140fccccb
origin badgesnapshot badge
swh:1:snp:8c426de7c1a52fbd96f065cdced641b6f2bc8788

This interface enables to generate software citations, provided that the root directory of browsed objects contains a citation.cff or codemeta.json file.
Select below a type of object currently browsed in order to generate citations for them.

  • revision
  • directory
  • content
  • snapshot
Generate software citation in BibTex format (requires biblatex-software package)
Generating citation ...
Generate software citation in BibTex format (requires biblatex-software package)
Generating citation ...
Generate software citation in BibTex format (requires biblatex-software package)
Generating citation ...
Generate software citation in BibTex format (requires biblatex-software package)
Generating citation ...
Tip revision: c5b88eb5aa3fa9f6a657d8b078405ce82f7e0e2d authored by Eric Sanford on 09 October 2019, 20:53:45 UTC
Updated STAR version, set default reference genome to hg38, added gene_names from gtf file when there is no HGNC symbol match, made it easier to change the reference genome by defining it in the setEnvironmentVariables.sh script. Modified some snakemake files to make that alternate pipeline almost runnable on the cluster in an interactive node.
Tip revision: c5b88eb
config.yaml
# path or URL to sample sheet (TSV format, columns: sample, condition, ...)
samples: samples.tsv
# path or URL to sequencing unit sheet (TSV format, columns: sample, unit, fq1, fq2, 
# strandedness). Units are technical replicates (e.g. lanes, or resequencing of the 
# same biological sample).If the column "strandedness" is present (which is optional), 
# can be empty or has one of these values: none, yes or reverse. none is for unstranded 
# protocols, yes an reverse follow the nomenclature used in `htseq-count --reverse` 
# which is referenced in STAR manual section 7, "Counting number of reads per gene".

units: units.tsv

trimming:
  # skip trimming: false or true
  skip: true
  # the sequencing adapter
  adapter: ACGGATCGATCGATCGATCGAT

ref:
  # the STAR index
  index: "refs/hg38_STAR"
  # gtf file with transcripts
  annotation: "refs/hg38_STAR/hg38.gtf"

pca:
  labels:
    # columns of sample sheet to use for PCA
    - condition

diffexp:
  # contrasts for the deseq2 results method
  contrasts:
    infected-vs-mock:
      - infected
      - mock

params:
  star: ""
  cutadapt-se: ""
  cutadapt-pe: ""
  diffgenes: "20"
  log-sig: "-30"
  log2-fold: "2"
The diff you're trying to view is too large. Only the first 1000 changed files have been loaded.
Showing with 0 additions and 0 deletions (0 / 0 diffs computed)
swh spinner

Computing file changes ...

back to top

Software Heritage — Copyright (C) 2015–2026, The Software Heritage developers. License: GNU AGPLv3+.
The source code of Software Heritage itself is available on our development forge.
The source code files archived by Software Heritage are available under their own copyright and licenses.
Terms of use: Archive access, API— Content policy— Contact— JavaScript license information— Web API